The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_AP012335	Streptococcus pyogenes JRS4	1811124	37787	50174	1811124		Synechococcus_phage(28.57%)	8	NA	NA
WP_047149463.1|37787_41513_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	26.9	2.7e-40
WP_009880323.1|41746_43201_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.7	3.7e-54
WP_011184062.1|43228_44251_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3FGG1	Synechococcus_phage	41.7	2.4e-63
WP_002986700.1|44418_44973_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.1	2.4e-25
WP_047149464.1|45156_46704_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	E3SNU8	Prochlorococcus_phage	51.8	3.7e-44
WP_023078180.1|46762_47887_-	SH3 domain-containing protein	NA	F8HGP2	Streptococcus_phage	28.6	1.0e-06
WP_021340276.1|48139_49405_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_021340277.1|49682_50174_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	43.8	1.1e-18
>prophage 2
NZ_AP012335	Streptococcus pyogenes JRS4	1811124	325118	382844	1811124	tRNA,bacteriocin,transposase,protease	Streptococcus_phage(30.0%)	56	NA	NA
WP_002985850.1|325118_325709_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	55.7	2.6e-54
WP_002985847.1|326200_326476_+	YlbG family protein	NA	NA	NA	NA	NA
WP_011184214.1|326724_327360_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	63.9	9.2e-66
WP_002985844.1|327377_328253_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	46.6	2.1e-68
WP_011017422.1|328271_328511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002985838.1|328914_329238_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	59.4	1.3e-28
WP_011184217.1|329242_330106_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	73.6	3.6e-113
WP_011184218.1|330132_330525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011017427.1|330571_331201_-	CutC family protein	NA	NA	NA	NA	NA
WP_011184219.1|331499_331856_+	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	65.8	6.3e-40
WP_021340505.1|331930_332758_-	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	78.9	3.8e-128
WP_021340507.1|332991_334173_+	L-lactate oxidase	NA	NA	NA	NA	NA
WP_047149476.1|334438_339385_+|protease	CXC chemokine-degrading serine protease SpyCEP	protease	NA	NA	NA	NA
WP_002985820.1|340156_340864_+	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
WP_080343070.1|341103_343104_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	35.1	4.6e-87
WP_002995917.1|343597_344611_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	53.4	5.5e-97
WP_002990870.1|344614_345103_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	R4JF54	Bacillus_phage	37.5	1.3e-11
WP_011184226.1|345069_347250_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	43.2	6.2e-170
WP_021340582.1|347454_348207_-	ADP-ribosyltransferase	NA	NA	NA	NA	NA
WP_011184229.1|348663_349104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021340584.1|349291_349543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002990844.1|350728_350965_+	DUF2829 domain-containing protein	NA	NA	NA	NA	NA
WP_047149478.1|350957_351656_+	3-oxoacyl-ACP reductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	25.6	7.1e-11
WP_011184235.1|351731_352691_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_021340585.1|353023_354361_+	MFS transporter	NA	NA	NA	NA	NA
WP_023078438.1|354534_355917_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L4K9	Tupanvirus	36.0	6.5e-32
WP_011184238.1|355947_356502_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_002990826.1|356501_356753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011184240.1|356772_357468_+	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_011184241.1|357618_357960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011184242.1|358058_358706_-	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_011017446.1|358851_359784_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_021299377.1|359847_360573_+	metal ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	32.6	1.1e-17
WP_060823522.1|360573_361464_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_047149479.1|361573_362380_-	peptidylprolyl isomerase	NA	A0A2H4UTF4	Bodo_saltans_virus	36.6	2.5e-20
WP_011184246.1|362596_365002_+	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	51.4	4.2e-87
WP_011184247.1|365071_365425_-	DUF3397 domain-containing protein	NA	NA	NA	NA	NA
WP_060823523.1|366650_367682_-|transposase	IS30-like element IS1239 family transposase	transposase	H7BW61	unidentified_phage	35.0	2.8e-32
WP_002990800.1|367936_368362_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_002985768.1|368467_369157_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_011184251.1|369486_370485_+|transposase	IS30-like element IS1239 family transposase	transposase	H7BW61	unidentified_phage	35.0	2.1e-32
WP_002985765.1|370563_371292_+	UMP kinase	NA	NA	NA	NA	NA
WP_002985763.1|371320_371878_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_011184252.1|371986_372844_+	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002985759.1|372916_373426_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_002985757.1|373422_373638_+	YozE family protein	NA	NA	NA	NA	NA
WP_011184253.1|373793_374969_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0E3XB61	Gordonia_phage	40.5	5.5e-16
WP_021340134.1|375283_377056_+	oleate hydratase	NA	NA	NA	NA	NA
WP_032460063.1|377214_378267_+	PhoH family protein	NA	W8D063	Erwinia_phage	49.5	6.0e-46
WP_009880369.1|378312_378888_+	uracil-DNA glycosylase family protein	NA	NA	NA	NA	NA
WP_002985748.1|379046_379544_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_002985746.1|379524_379932_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_002985743.1|380051_380948_+	GTPase Era	NA	NA	NA	NA	NA
WP_021340137.1|380967_381444_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_002994504.1|382401_382647_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_002987564.1|382661_382844_+|bacteriocin	class IIb bacteriocin, lactobin A/cerein 7B family	bacteriocin	NA	NA	NA	NA
>prophage 3
NZ_AP012335	Streptococcus pyogenes JRS4	1811124	601595	612198	1811124		Streptococcus_phage(57.14%)	9	NA	NA
WP_011889006.1|601595_603806_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	68.9	6.5e-268
WP_011184379.1|603913_605077_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	64.9	1.3e-142
WP_002985140.1|605073_605760_+	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	68.9	7.0e-88
WP_002992640.1|605853_607020_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	32.8	5.8e-34
WP_002985134.1|607080_607422_+	YlbF/YmcA family competence regulator	NA	A0A1X9I5Y8	Streptococcus_phage	40.2	5.9e-19
WP_021340090.1|607642_608995_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	24.0	1.0e-29
WP_002990257.1|609082_610351_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_021340089.1|610380_610821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011184383.1|611055_612198_+	cysteine desulfurase	NA	A0A1X6WFP1	Pacmanvirus	27.3	1.4e-24
>prophage 4
NZ_AP012335	Streptococcus pyogenes JRS4	1811124	1082007	1122788	1811124	capsid,portal,terminase,holin,tail,integrase	Streptococcus_phage(68.0%)	59	1085447:1085466	1120161:1120180
WP_010922443.1|1082007_1082943_+	dihydroorotate oxidase	NA	A0A1V0SH91	Hokovirus	44.8	1.3e-65
WP_011184725.1|1083242_1085105_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	33.8	5.4e-90
1085447:1085466	attL	AATTATTTAACAGCGTCTTT	NA	NA	NA	NA
WP_011184726.1|1085635_1085818_-	hypothetical protein	NA	A3F673	Streptococcus_phage	81.7	2.0e-21
WP_011184727.1|1086057_1086816_+	DNase Mf2	NA	NA	NA	NA	NA
WP_002985327.1|1086926_1087634_+	streptococcal pyrogenic exotoxin SpeC	NA	A0A097PAT7	Streptococcus_pyogenes_phage	27.1	3.9e-09
WP_030126404.1|1087702_1088455_-	SH3 domain-containing protein	NA	A3F665	Streptococcus_phage	96.4	3.9e-140
WP_011184730.1|1088572_1089028_-|holin	phage holin family protein	holin	A0A0M4R3G6	Streptococcus_phage	81.5	2.3e-63
WP_011184731.1|1089037_1089649_-	DUF1366 domain-containing protein	NA	Q938J7	Temperate_phage	88.7	4.1e-79
WP_011184732.1|1089651_1090080_-	DUF1617 family protein	NA	A3F661	Streptococcus_phage	92.9	2.8e-66
WP_011184733.1|1090088_1091870_-	hypothetical protein	NA	Q938J9	Temperate_phage	41.7	3.4e-73
WP_011184734.1|1091884_1092994_-	hyaluronoglucosaminidase	NA	Q938K0	Temperate_phage	66.7	5.6e-127
WP_011054676.1|1092993_1094967_-|tail	phage tail protein	tail	M1PKG3	Streptococcus_phage	49.6	2.0e-98
WP_002992579.1|1094948_1095644_-	hypothetical protein	NA	A0A1B1P761	Bacillus_phage	32.2	4.7e-07
WP_047149495.1|1095640_1098004_-	hypothetical protein	NA	M1NRG5	Streptococcus_phage	50.2	2.1e-131
WP_011054678.1|1098003_1098375_-	DUF5361 domain-containing protein	NA	M1PL84	Streptococcus_phage	62.4	1.7e-35
WP_010922455.1|1098389_1098653_-	hypothetical protein	NA	A0A0B5A2F3	Streptococcus_phage	55.8	1.0e-18
WP_011054679.1|1098663_1099254_-	hypothetical protein	NA	M1PKG8	Streptococcus_phage	62.5	1.1e-60
WP_000573598.1|1099269_1099605_-	hypothetical protein	NA	A0A1P8BMR5	Lactococcus_phage	64.9	9.8e-35
WP_000032787.1|1099605_1099842_-	hypothetical protein	NA	A0A1P8BMT2	Lactococcus_phage	66.7	2.5e-21
WP_011054681.1|1099834_1100173_-	hypothetical protein	NA	A0A0B5A086	Streptococcus_phage	75.0	8.1e-45
WP_011054682.1|1100132_1100555_-	hypothetical protein	NA	A0A0B5A2F6	Streptococcus_phage	67.2	8.2e-47
WP_010922460.1|1100564_1100765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011054683.1|1100764_1101676_-|capsid	phage major capsid protein	capsid	M1PFL0	Streptococcus_phage	67.0	2.9e-113
WP_010922462.1|1101700_1102162_-	DUF4355 domain-containing protein	NA	M1Q1L0	Streptococcus_phage	53.2	4.5e-38
WP_011054685.1|1102242_1103658_-|terminase	terminase	terminase	A0A0B5A091	Streptococcus_phage	74.0	1.5e-212
WP_011106704.1|1103739_1103955_-	hypothetical protein	NA	M1IRA5	Streptococcus_phage	72.4	4.1e-26
WP_002986828.1|1103956_1104223_-	hypothetical protein	NA	Q938K9	Temperate_phage	95.5	6.4e-37
WP_011054687.1|1104215_1104368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002994100.1|1104444_1104669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010922467.1|1104674_1106168_-	hypothetical protein	NA	M1Q184	Streptococcus_phage	55.0	2.0e-87
WP_010922468.1|1106160_1107429_-|portal	phage portal protein	portal	M1PFL4	Streptococcus_phage	75.6	2.2e-188
WP_002994106.1|1107425_1107782_-	hypothetical protein	NA	M1PRL3	Streptococcus_phage	57.8	2.4e-07
WP_011054690.1|1107929_1108274_-	HNH endonuclease	NA	M1Q0W7	Streptococcus_phage	69.4	3.2e-41
WP_011054691.1|1108381_1108801_-	DUF1492 domain-containing protein	NA	A0A1X9I5B5	Streptococcus_phage	79.1	1.9e-56
WP_011054692.1|1108876_1109128_-	hypothetical protein	NA	M1PF60	Streptococcus_phage	59.0	1.6e-18
WP_011054693.1|1109124_1109280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011054694.1|1109276_1109594_-	DUF1372 family protein	NA	A1EAD7	Streptococcus_phage	71.4	9.0e-30
WP_011054695.1|1109629_1110142_-	hypothetical protein	NA	M1PFM2	Streptococcus_phage	85.9	1.7e-78
WP_011184741.1|1110138_1110471_-	hypothetical protein	NA	M1NS23	Streptococcus_phage	67.0	8.8e-36
WP_011054697.1|1110481_1111828_-	PcfJ domain-containing protein	NA	A8ATM0	Listeria_phage	49.4	1.0e-122
WP_011054698.1|1111824_1112220_-	hypothetical protein	NA	A8ATL9	Listeria_phage	52.3	1.4e-19
WP_011054699.1|1112584_1113382_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	J7KGZ1	Streptococcus_phage	83.8	1.3e-130
WP_000594115.1|1113374_1113575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011054700.1|1113571_1114498_-	recombinase RecT	NA	M1NRN6	Streptococcus_phage	71.8	1.2e-90
WP_010922207.1|1114500_1114830_-	hypothetical protein	NA	J7KGX3	Streptococcus_phage	82.6	3.5e-45
WP_002990074.1|1114885_1115092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002988354.1|1115100_1115241_-	hypothetical protein	NA	A0A1X9I6Y1	Streptococcus_phage	54.5	3.4e-05
WP_002988350.1|1115237_1115471_-	hypothetical protein	NA	Q938N1	Temperate_phage	94.8	1.8e-35
WP_002990076.1|1115451_1115838_-	DnaD domain-containing protein	NA	Q938N2	Temperate_phage	47.3	1.1e-24
WP_010922477.1|1116341_1116527_-	hypothetical protein	NA	Q938N3	Temperate_phage	83.6	1.3e-20
WP_010922478.1|1116528_1116840_-	excisionase	NA	A0A1S5SA25	Streptococcus_phage	77.7	5.3e-43
WP_010922479.1|1117109_1117322_-	helix-turn-helix transcriptional regulator	NA	A0A1X9I583	Streptococcus_phage	56.7	1.1e-10
WP_010922480.1|1117522_1118278_+	helix-turn-helix transcriptional regulator	NA	A0A1S5S8S8	Streptococcus_phage	60.8	2.8e-77
WP_010922481.1|1118289_1118808_+	restriction endonuclease	NA	E8ZDN5	Streptococcus_phage	45.9	9.2e-32
WP_003051793.1|1118931_1120074_+|integrase	site-specific integrase	integrase	M1NRJ9	Streptococcus_phage	77.4	2.4e-173
WP_002983920.1|1120162_1120438_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	73.0	2.6e-25
1120161:1120180	attR	AATTATTTAACAGCGTCTTT	NA	NA	NA	NA
WP_002989129.1|1120536_1121124_-	YpmS family protein	NA	NA	NA	NA	NA
WP_011888746.1|1121101_1121944_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_002983913.1|1121936_1122788_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	35.7	5.4e-13
>prophage 5
NZ_AP012335	Streptococcus pyogenes JRS4	1811124	1185001	1261219	1811124	tRNA,capsid,terminase,tail,integrase	Temperate_phage(56.14%)	81	1210655:1210670	1274878:1274893
WP_011184776.1|1185001_1187650_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	40.4	8.6e-150
WP_011018025.1|1187651_1188215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002989018.1|1188816_1189212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002983750.1|1189232_1189487_-	DUF1912 family protein	NA	NA	NA	NA	NA
WP_002983746.1|1189964_1190717_+	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_021340382.1|1190772_1191846_+	3-dehydroquinate synthase	NA	E5ERI4	Ostreococcus_lucimarinus_virus	31.6	7.3e-31
WP_002983743.1|1192281_1192587_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_002983741.1|1192588_1192927_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_047149497.1|1192979_1193735_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011018033.1|1193986_1194865_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_027968914.1|1195002_1198509_-	glycoside hydrolase family 2 protein	NA	NA	NA	NA	NA
WP_011184782.1|1198438_1199923_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_021340377.1|1199922_1201647_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	24.9	4.5e-14
WP_010922522.1|1201636_1202242_-	YesL family protein	NA	NA	NA	NA	NA
WP_014407727.1|1202547_1203993_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_002988998.1|1204073_1205000_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_021340369.1|1205009_1205960_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_047149498.1|1206176_1207055_+	ROK family protein	NA	NA	NA	NA	NA
WP_011184787.1|1207665_1209108_-	glycoside hydrolase family 1 protein	NA	NA	NA	NA	NA
WP_011184788.1|1209133_1210828_-	beta-N-acetylglucosaminidase domain-containing protein	NA	NA	NA	NA	NA
1210655:1210670	attL	TTCTTCAATCCACTGA	NA	NA	NA	NA
WP_021340386.1|1210878_1211919_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_023077201.1|1212051_1213338_+	glycoside hydrolase family 125 protein	NA	NA	NA	NA	NA
WP_011184791.1|1213352_1216058_+	alpha-mannosidase	NA	NA	NA	NA	NA
WP_011184792.1|1216158_1217514_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_011184793.1|1218179_1219535_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	33.0	2.0e-73
WP_011018104.1|1219725_1219908_-	hypothetical protein	NA	A3F673	Streptococcus_phage	81.7	1.7e-20
WP_032463908.1|1220147_1221146_+	streptodornase A	NA	A7J2B8	Streptococcus_phage	53.5	4.5e-83
WP_003051628.1|1221286_1221880_-	GNAT family N-acetyltransferase	NA	A0A0A8WFI2	Clostridium_phage	38.2	2.4e-23
WP_011018107.1|1221879_1222083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023078214.1|1222192_1223398_-	glucosaminidase domain-containing protein	NA	A7J2B5	Streptococcus_phage	83.3	4.7e-204
WP_011184796.1|1223510_1223696_-	hypothetical protein	NA	Q938J5	Temperate_phage	98.4	6.6e-25
WP_011184797.1|1223692_1223992_-	hypothetical protein	NA	Q938J6	Temperate_phage	92.7	4.3e-42
WP_011018111.1|1224002_1224620_-	DUF1366 domain-containing protein	NA	Q938J7	Temperate_phage	88.3	4.5e-78
WP_011184798.1|1224622_1225051_-	DUF1617 family protein	NA	Q938J8	Temperate_phage	77.9	1.2e-53
WP_011184799.1|1225062_1227078_-	gp58-like family protein	NA	Q938J9	Temperate_phage	72.5	1.0e-171
WP_011184800.1|1227092_1228205_-	hyaluronoglucosaminidase	NA	A7J2A8	Streptococcus_phage	64.6	1.8e-104
WP_023078210.1|1228204_1230352_-|tail	phage tail protein	tail	Q938K1	Temperate_phage	94.0	0.0e+00
WP_011018116.1|1230348_1231065_-|tail	phage tail family protein	tail	Q938K2	Temperate_phage	99.2	5.5e-136
WP_047149499.1|1231061_1234322_-	tape measure protein	NA	Q938K3	Temperate_phage	99.2	0.0e+00
WP_011018118.1|1234311_1234893_-	hypothetical protein	NA	Q938K4	Temperate_phage	92.2	2.9e-98
WP_011018119.1|1234896_1235331_-	hypothetical protein	NA	Q938K5	Temperate_phage	97.2	1.8e-68
WP_011018120.1|1235374_1235836_-	hypothetical protein	NA	Q938K6	Temperate_phage	78.8	1.9e-60
WP_011018121.1|1235835_1236234_-|capsid	phage capsid protein	capsid	Q79S87	Temperate_phage	99.2	1.3e-70
WP_010922083.1|1236230_1236587_-	hypothetical protein	NA	Q79S88	Temperate_phage	100.0	4.5e-62
WP_010922082.1|1236586_1236919_-	hypothetical protein	NA	Q79S86	Temperate_phage	100.0	9.6e-59
WP_011018123.1|1236908_1237325_-	hypothetical protein	NA	Q938K7	Temperate_phage	99.1	4.3e-56
WP_010922080.1|1237378_1238197_-|capsid	N4-gp56 family major capsid protein	capsid	Q79S85	Temperate_phage	100.0	4.0e-146
WP_010922079.1|1238200_1238815_-	hypothetical protein	NA	Q938K8	Temperate_phage	95.0	3.1e-95
WP_010922078.1|1238940_1239207_-	hypothetical protein	NA	Q938K9	Temperate_phage	95.5	8.3e-37
WP_010922077.1|1239293_1239521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011018124.1|1239520_1241014_-|capsid	phage minor capsid protein	capsid	Q938L1	Temperate_phage	80.6	1.1e-213
WP_011184805.1|1242533_1243745_-|terminase	PBSX family phage terminase large subunit	terminase	Q938L3	Temperate_phage	98.1	5.0e-222
WP_011018127.1|1243827_1244301_-	hypothetical protein	NA	Q938L4	Temperate_phage	98.1	2.8e-75
WP_002986841.1|1244351_1244729_-	ASCH domain-containing protein	NA	Q938L5	Temperate_phage	100.0	1.7e-67
WP_158296015.1|1244789_1245173_-	GNAT family N-acetyltransferase	NA	B5SP24	Lactococcus_phage	59.3	2.9e-35
WP_011018129.1|1245181_1245859_-	hypothetical protein	NA	Q938L6	Temperate_phage	99.6	4.3e-130
WP_011018130.1|1245837_1246356_-	ParB N-terminal domain-containing protein	NA	Q938L7	Temperate_phage	97.1	1.3e-86
WP_002990052.1|1246819_1247260_-	ArpU family transcriptional regulator	NA	Q938L8	Temperate_phage	98.6	4.2e-78
WP_011018131.1|1247533_1247800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011018133.1|1248288_1248921_-	SAM-dependent DNA methyltransferase	NA	L0P368	Streptococcus_phage	68.6	2.3e-85
WP_011018134.1|1248922_1249207_-	hypothetical protein	NA	A0A097PAV1	Streptococcus_pyogenes_phage	87.2	8.9e-37
WP_011018135.1|1249203_1249374_-	hypothetical protein	NA	Q938M0	Temperate_phage	100.0	8.5e-11
WP_011018136.1|1249370_1249775_-	hypothetical protein	NA	Q938M1	Temperate_phage	93.3	9.9e-66
WP_011018139.1|1250649_1251090_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A097PAS0	Streptococcus_pyogenes_phage	98.6	1.6e-80
WP_011106686.1|1251089_1251293_-	hypothetical protein	NA	Q938M6	Temperate_phage	100.0	4.7e-32
WP_011018140.1|1251298_1251718_-	single-stranded DNA-binding protein	NA	Q938M7	Temperate_phage	99.3	2.1e-71
WP_011018141.1|1251710_1252385_-	ERF family protein	NA	Q938M8	Temperate_phage	99.6	9.6e-106
WP_011018142.1|1252385_1252868_-	siphovirus Gp157 family protein	NA	Q938M9	Temperate_phage	100.0	8.2e-51
WP_011018143.1|1252889_1253144_-	hypothetical protein	NA	Q938N0	Temperate_phage	98.8	3.7e-42
WP_011018144.1|1253124_1253481_-	HTH domain-containing protein	NA	A0A097PAU3	Streptococcus_pyogenes_phage	98.3	2.0e-49
WP_011018145.1|1253491_1253629_-	hypothetical protein	NA	J7KBQ4	Streptococcus_phage	78.4	2.7e-07
WP_011018146.1|1253628_1254471_-	ATP-binding protein	NA	A0A1S5S7L9	Streptococcus_phage	40.7	1.3e-48
WP_021340238.1|1254480_1255401_-	phage replisome organizer N-terminal domain-containing protein	NA	J7KBV5	Streptococcus_phage	86.0	3.7e-116
WP_021340228.1|1255414_1255729_-	helix-turn-helix transcriptional regulator	NA	A0A1P8VVN6	Streptococcus_phage	94.2	5.9e-50
WP_021340237.1|1255909_1256161_-	DNA-binding protein	NA	A0A1P8VVV6	Streptococcus_phage	96.4	4.4e-40
WP_011018149.1|1256570_1257290_-	phage antirepressor KilAC domain-containing protein	NA	A0A141E1D3	Streptococcus_phage	69.2	2.8e-87
WP_023078130.1|1257317_1257530_-	hypothetical protein	NA	J7KBP9	Streptococcus_phage	94.3	3.5e-30
WP_011888679.1|1257727_1258069_+	helix-turn-helix transcriptional regulator	NA	J7KJZ4	Streptococcus_phage	85.8	1.2e-48
WP_032463929.1|1258052_1258439_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A1P8VVK5	Streptococcus_phage	77.6	8.3e-54
WP_011018151.1|1258453_1259875_+	DUF4041 domain-containing protein	NA	M1PLF9	Streptococcus_phage	74.5	7.4e-140
WP_011018152.1|1260052_1261219_+|integrase	tyrosine-type recombinase/integrase	integrase	C5J953	Streptococcus_phage	42.4	2.4e-80
1274878:1274893	attR	TTCTTCAATCCACTGA	NA	NA	NA	NA
>prophage 6
NZ_AP012335	Streptococcus pyogenes JRS4	1811124	1398651	1492438	1811124	tRNA,capsid,portal,terminase,holin,tail,integrase,head	Streptococcus_phage(67.24%)	86	1450933:1450950	1489514:1489531
WP_011184879.1|1398651_1400091_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_011184880.1|1400090_1401557_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_002988561.1|1401556_1401859_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_010922604.1|1402852_1403407_-	cysteine hydrolase	NA	G3MA16	Bacillus_virus	38.5	3.4e-24
WP_002983278.1|1403553_1404336_-	GTP-sensing pleiotropic transcriptional regulator CodY	NA	NA	NA	NA	NA
WP_011184883.1|1404553_1405768_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_002983265.1|1405998_1406451_+	universal stress protein	NA	NA	NA	NA	NA
WP_010922607.1|1406573_1407962_-	Cof-type HAD-IIB family hydrolase	NA	A0A0H3UZF4	Geobacillus_virus	37.1	2.1e-22
WP_011184885.1|1408033_1408999_+	asparaginase	NA	NA	NA	NA	NA
WP_002988556.1|1409347_1410052_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002991995.1|1410064_1410967_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	44.2	3.9e-38
WP_011184887.1|1411258_1413274_-	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_011184889.1|1413648_1415103_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.7	1.2e-12
WP_002983239.1|1415039_1415720_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_002983234.1|1415716_1416310_-	MptD family putative ECF transporter S component	NA	NA	NA	NA	NA
WP_021340306.1|1416306_1417977_-	ABC transporter ATP-binding protein	NA	F2Y165	Organic_Lake_phycodnavirus	29.1	9.9e-19
WP_011184891.1|1417969_1419733_-	ABC transporter ATP-binding protein/permease	NA	F2Y1V5	Organic_Lake_phycodnavirus	31.1	1.0e-21
WP_011184892.1|1419729_1420566_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.2	2.7e-17
WP_002995381.1|1420562_1421585_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.2	2.0e-14
WP_011184894.1|1421586_1423329_-	heme ABC transporter substrate-binding protein IsdE	NA	NA	NA	NA	NA
WP_027968854.1|1423525_1427353_-	NEAT domain-containing protein	NA	NA	NA	NA	NA
WP_011018178.1|1429440_1430541_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	29.0	1.8e-29
WP_002983199.1|1430537_1430894_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_002988523.1|1431009_1433529_-	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_011184898.1|1434748_1435702_-	mannose-6-phosphate isomerase, class I	NA	NA	NA	NA	NA
WP_011184899.1|1435796_1436681_-	ROK family protein	NA	NA	NA	NA	NA
WP_021340122.1|1436944_1439944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023078269.1|1440173_1442057_-	PTS beta-glucoside transporter subunit IIBCA	NA	NA	NA	NA	NA
WP_002983175.1|1442298_1443738_+	sucrose-6-phosphate hydrolase	NA	NA	NA	NA	NA
WP_023078282.1|1443742_1444729_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.3	2.0e-19
WP_002983167.1|1444847_1445300_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_002983163.1|1445292_1445682_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_002988496.1|1445727_1446285_-	elongation factor P	NA	NA	NA	NA	NA
WP_002988493.1|1446380_1446842_-	hypothetical protein	NA	F8WPT6	Bacillus_phage	55.1	1.1e-33
WP_021340125.1|1446876_1447950_-	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	32.2	1.7e-16
WP_023077881.1|1448065_1450894_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.7	1.0e-305
1450933:1450950	attL	CTTATATTATAACAAAAA	NA	NA	NA	NA
WP_047149504.1|1451120_1451303_-	hypothetical protein	NA	A3F673	Streptococcus_phage	73.3	1.7e-17
WP_047149505.1|1451999_1453205_-	glucosaminidase domain-containing protein	NA	A7J2B5	Streptococcus_phage	82.8	1.5e-202
WP_029714020.1|1453327_1453555_-|holin	phage holin	holin	A7J2B3	Streptococcus_phage	97.3	2.2e-30
WP_011017397.1|1453551_1453824_-	hypothetical protein	NA	A7J2B2	Streptococcus_phage	91.0	5.5e-36
WP_046735270.1|1453835_1454474_-	hypothetical protein	NA	A3F662	Streptococcus_phage	52.7	2.0e-44
WP_002988448.1|1454476_1454905_-	DUF1617 family protein	NA	Q938J8	Temperate_phage	84.3	8.1e-58
WP_011017395.1|1454916_1456821_-	gp58-like family protein	NA	Q938J9	Temperate_phage	83.7	1.1e-210
WP_011888927.1|1456835_1457951_-	hyaluronoglucosaminidase	NA	Q938K0	Temperate_phage	74.9	1.6e-142
WP_011888928.1|1457947_1459927_-|tail	phage tail protein	tail	A7J2A7	Streptococcus_phage	92.8	0.0e+00
WP_011054865.1|1459936_1460779_-	hypothetical protein	NA	A7J2A6	Streptococcus_phage	97.9	8.8e-157
WP_047149506.1|1460790_1465173_-	tape measure protein	NA	A7J2A5	Streptococcus_phage	74.1	2.1e-225
WP_011888930.1|1465187_1465421_-	hypothetical protein	NA	A7J2A4	Streptococcus_phage	98.7	1.3e-33
WP_011888931.1|1465495_1465951_-	hypothetical protein	NA	A7J2A3	Streptococcus_phage	99.3	5.3e-76
WP_047149507.1|1466004_1466577_-|tail	phage major tail protein, TP901-1 family	tail	A7J2A2	Streptococcus_phage	97.0	1.6e-85
WP_011054870.1|1466615_1466975_-	hypothetical protein	NA	A7J2A1	Streptococcus_phage	98.3	1.2e-57
WP_011106640.1|1466978_1467323_-	HK97 gp10 family phage protein	NA	A7J2A0	Streptococcus_phage	98.2	5.1e-55
WP_011054872.1|1467319_1467598_-	hypothetical protein	NA	A7J299	Streptococcus_phage	100.0	1.9e-47
WP_011888932.1|1467608_1467965_-|head,tail	phage head-tail connector protein	head,tail	A7J298	Streptococcus_phage	99.2	7.9e-59
WP_002983429.1|1467976_1468864_-	hypothetical protein	NA	A7J297	Streptococcus_phage	100.0	2.1e-161
WP_011888933.1|1468876_1469446_-	DUF4355 domain-containing protein	NA	A7J296	Streptococcus_phage	100.0	1.9e-83
WP_011888934.1|1469607_1469874_-	hypothetical protein	NA	Q938K9	Temperate_phage	96.6	2.9e-37
WP_011054876.1|1469878_1470067_-	hypothetical protein	NA	A7J294	Streptococcus_phage	100.0	7.4e-24
WP_032465703.1|1470094_1471543_-|capsid	minor capsid protein	capsid	A7J293	Streptococcus_phage	99.8	1.2e-278
WP_038433243.1|1471502_1473035_-|portal	phage portal protein	portal	A7J292	Streptococcus_phage	99.8	4.5e-292
WP_011054879.1|1473050_1474328_-|terminase	PBSX family phage terminase large subunit	terminase	A7J291	Streptococcus_phage	100.0	1.1e-246
WP_011106637.1|1474317_1474770_-|terminase	terminase small subunit	terminase	A7J290	Streptococcus_phage	100.0	6.9e-76
WP_011054881.1|1474859_1475276_-	transcriptional regulator	NA	A7J289	Streptococcus_phage	99.3	3.3e-72
WP_011054882.1|1475408_1475681_-	hypothetical protein	NA	A7J287	Streptococcus_phage	73.3	5.7e-25
WP_011054883.1|1475673_1475844_-	hypothetical protein	NA	A7J285	Streptococcus_phage	94.2	3.1e-21
WP_047149508.1|1475844_1477167_-	DEAD/DEAH box helicase family protein	NA	A7J284	Streptococcus_phage	96.8	1.1e-249
WP_011054885.1|1477163_1477439_-	VRR-NUC domain-containing protein	NA	A7J283	Streptococcus_phage	96.7	2.9e-45
WP_047149509.1|1477824_1480209_-	DNA primase	NA	A7J282	Streptococcus_phage	94.2	1.6e-275
WP_047149510.1|1480213_1482136_-	DNA polymerase	NA	A7J280	Streptococcus_phage	99.1	0.0e+00
WP_086934854.1|1482178_1482742_-	DUF2815 family protein	NA	D2J040	Enterococcus_phage	58.5	3.3e-51
WP_011888943.1|1482750_1483908_-	DUF2800 domain-containing protein	NA	A7J278	Streptococcus_phage	98.2	1.0e-216
WP_030127426.1|1484295_1484499_-	hypothetical protein	NA	A7J276	Streptococcus_phage	89.6	3.7e-29
WP_047149511.1|1484644_1485031_-	hypothetical protein	NA	A7J274	Streptococcus_phage	86.6	4.0e-56
WP_047149512.1|1485027_1485231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023611037.1|1485223_1485394_-	hypothetical protein	NA	A7J273	Streptococcus_phage	87.5	2.9e-19
WP_047149513.1|1485422_1485680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047149514.1|1485767_1485998_-	hypothetical protein	NA	A7J271	Streptococcus_phage	89.3	6.5e-30
WP_001283052.1|1486018_1486210_-	hypothetical protein	NA	A7J270	Streptococcus_phage	100.0	7.3e-27
WP_011184049.1|1486851_1487202_+	helix-turn-helix transcriptional regulator	NA	M1I9X0	Streptococcus_phage	85.3	1.2e-48
WP_047149515.1|1487215_1487599_+	phage protein	NA	A7J268	Streptococcus_phage	98.4	1.5e-68
WP_047149516.1|1487609_1488161_+	hypothetical protein	NA	A7J267	Streptococcus_phage	92.3	9.0e-86
WP_047149517.1|1488336_1489434_+|integrase	site-specific integrase	integrase	Q938N9	Temperate_phage	94.8	1.7e-197
WP_002983147.1|1489677_1490622_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
1489514:1489531	attR	CTTATATTATAACAAAAA	NA	NA	NA	NA
WP_002983144.1|1490753_1491410_+	DUF1129 domain-containing protein	NA	NA	NA	NA	NA
WP_002983142.1|1491542_1491782_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_002983122.1|1491946_1492438_-	single-stranded DNA-binding protein	NA	A0A286QNX2	Streptococcus_phage	74.2	1.7e-59
