The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014164	Aerococcus viridans strain CCUG4311 chromosome, complete genome	2199877	89082	204773	2199877	transposase,tRNA,integrase	Streptococcus_phage(21.43%)	109	83400:83416	172155:173479
83400:83416	attL	GATCATCAAAAGTGGCT	NA	NA	NA	NA
WP_003142863.1|89082_90249_+|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	34.0	1.0e-54
83400:83416	attL	GATCATCAAAAGTGGCT	NA	NA	NA	NA
WP_003142862.1|90766_91333_+	cobalt ABC transporter permease	NA	NA	NA	NA	NA
WP_003142861.1|91329_92685_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	26.1	1.4e-10
WP_003142860.1|92691_93354_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003142859.1|93353_94049_+	thiaminase II	NA	NA	NA	NA	NA
WP_039935873.1|94038_94542_+	energy coupling factor transporter S component ThiW	NA	NA	NA	NA	NA
WP_003142857.1|94660_95176_-	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
WP_039935827.1|95457_96102_-	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	37.1	1.7e-38
WP_039935824.1|96271_97048_+	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_003142853.1|97047_97572_+	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_003142851.1|97695_98877_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_039935821.1|98967_99792_+	DUF2185 domain-containing protein	NA	NA	NA	NA	NA
WP_003142848.1|99831_100206_+	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_039935817.1|100198_100891_+	LrgB family protein	NA	NA	NA	NA	NA
WP_081453835.1|101146_102175_+	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
WP_003142845.1|102335_102839_-	nucleoside deoxyribosyltransferase	NA	K4I206	Lactobacillus_phage	37.0	4.3e-18
WP_003142844.1|102908_103574_-	phosphohydrolase	NA	S4W232	Pandoravirus	27.9	8.3e-09
WP_003142843.1|103602_104277_-	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	43.9	1.8e-43
WP_106427309.1|104398_105088_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	57.8	3.7e-52
WP_003142840.1|105149_107420_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	60.1	3.7e-258
WP_003142838.1|107698_109708_-	DUF438 domain-containing protein	NA	NA	NA	NA	NA
107785:107801	attR	GATCATCAAAAGTGGCT	NA	NA	NA	NA
WP_147291237.1|109688_109964_-	DUF1858 domain-containing protein	NA	NA	NA	NA	NA
107785:107801	attR	GATCATCAAAAGTGGCT	NA	NA	NA	NA
WP_003142835.1|110179_110539_+	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_060779288.1|110809_111082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060779289.1|111111_111795_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	98.7	1.1e-125
WP_003143671.1|112138_113134_+	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_060779290.1|113250_113934_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	98.2	1.1e-125
WP_060779291.1|113961_114375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003143333.1|114563_114806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003143332.1|114867_115227_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_003143330.1|115219_115498_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_050774130.1|115735_116053_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_003143327.1|116042_116318_+	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
WP_060779292.1|116484_116820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003143325.1|117390_117705_-	type II toxin-antitoxin system MqsA family antitoxin	NA	NA	NA	NA	NA
WP_003143749.1|120431_121604_+|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	99.6	1.7e-134
WP_003143698.1|122030_122315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039936024.1|122352_122883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003143700.1|122903_123296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003142583.1|126246_126645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050774112.1|126706_127183_+	signal peptidase I	NA	NA	NA	NA	NA
WP_003142568.1|128213_128834_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	34.2	5.0e-16
WP_106427304.1|129341_131144_+	AAA domain-containing protein	NA	K4I1H4	Acidithiobacillus_phage	26.1	1.9e-15
WP_003142565.1|131127_132453_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_106427303.1|132514_132613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060779293.1|132760_134284_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	36.9	6.4e-89
WP_003142217.1|134564_135599_+	R3H domain protein	NA	NA	NA	NA	NA
WP_003142216.1|135811_136387_+	recombinase family protein	NA	A0A0A8WIK3	Clostridium_phage	45.2	3.6e-37
WP_003142215.1|136367_136646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003142213.1|136747_137164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003142211.1|137181_137427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003142210.1|137438_137699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060779294.1|138105_138333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060779295.1|138394_139078_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	98.2	2.5e-125
WP_039935802.1|139284_140655_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_082702790.1|141173_142061_-|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	48.7	4.1e-40
WP_003143773.1|142416_142818_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_039936041.1|142831_143053_+	mercury resistance system transport protein MerF	NA	NA	NA	NA	NA
WP_003143769.1|143010_143217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002360746.1|143359_143515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002360745.1|143533_143683_+	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_003143766.1|143715_145356_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.8	4.1e-49
WP_039936039.1|145639_146203_-	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	47.5	4.2e-38
WP_060779296.1|146592_147933_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	24.4	5.0e-13
WP_060779297.1|148276_150202_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	35.9	8.9e-96
WP_003143894.1|150569_150884_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_060779298.1|150907_151831_+	cation transporter	NA	NA	NA	NA	NA
WP_003143749.1|152161_153334_+|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	99.6	1.7e-134
WP_003143859.1|153637_154720_+	SAM-dependent DNA methyltransferase	NA	A0A2H4PQP4	Staphylococcus_phage	47.8	1.8e-77
WP_003140916.1|155318_156473_+	SIR2 family protein	NA	NA	NA	NA	NA
WP_003140915.1|156489_158274_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_003140914.1|158306_159740_+	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_003140913.1|160363_160951_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003140912.1|160952_161342_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_005232990.1|161521_162841_+|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	88.4	1.0e-223
WP_050774100.1|163052_163706_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_147291236.1|164362_164557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003141396.1|164916_166308_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_003141395.1|166304_168872_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_039934828.1|168881_170759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060779302.1|170737_170956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003143749.1|170939_172112_-|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	99.6	1.7e-134
WP_060779303.1|172174_172513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004262250.1|173230_174439_+	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	26.5	1.7e-07
WP_039935337.1|174564_177588_+	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_003140767.1|177766_178342_-	dihydroxyacetone kinase subunit L	NA	NA	NA	NA	NA
WP_003140768.1|178366_179359_-	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_003140769.1|179434_179821_-	PTS-dependent dihydroxyacetone kinase phosphotransferase subunit DhaM	NA	NA	NA	NA	NA
WP_003140770.1|180134_181319_+	putative C-S lyase	NA	NA	NA	NA	NA
WP_003140771.1|181422_182316_-	cation transporter	NA	NA	NA	NA	NA
WP_003140773.1|182563_182938_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003140774.1|183040_184261_+	LL-diaminopimelate aminotransferase	NA	NA	NA	NA	NA
WP_003140775.1|184880_185873_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_003140776.1|185892_186702_+	mannose/fructose/sorbose family PTS transporter subunit IIC	NA	NA	NA	NA	NA
WP_003140778.1|186714_187662_+	PTS mannose/fructose/sorbose transporter family subunit IID	NA	NA	NA	NA	NA
WP_003140779.1|187663_188047_+	DUF956 family protein	NA	NA	NA	NA	NA
WP_003140781.1|188052_189003_+	mannose-6-phosphate isomerase, class I	NA	NA	NA	NA	NA
WP_039934523.1|189165_189957_-	formate/nitrite transporter family protein	NA	NA	NA	NA	NA
WP_039934525.1|190238_190730_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_039934528.1|191320_192085_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_003140788.1|192201_195126_+	peptidase M16	NA	NA	NA	NA	NA
WP_003140790.1|195453_195642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003140791.1|195656_196328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003140794.1|196751_198347_+	alpha-amylase	NA	NA	NA	NA	NA
WP_039934533.1|198449_198989_+	dUTP diphosphatase	NA	J9PV85	Bacillus_phage	43.8	3.3e-32
WP_003140797.1|199036_200419_+	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_003140798.1|200634_201828_+	PIN/TRAM domain-containing protein	NA	NA	NA	NA	NA
WP_039934536.1|201916_203392_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_060779304.1|203534_204773_+|transposase	IS21 family transposase	transposase	A0A059NT83	Lactococcus_phage	49.5	1.4e-105
>prophage 2
NZ_CP014164	Aerococcus viridans strain CCUG4311 chromosome, complete genome	2199877	211988	277245	2199877	transposase,tRNA	Lactobacillus_phage(18.18%)	55	NA	NA
WP_060779305.1|211988_212990_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.6	3.0e-55
WP_003143704.1|213154_214111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060779306.1|214363_214786_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	62.6	1.1e-46
WP_060779307.1|214886_216029_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	C1KFJ5	Lactobacillus_virus	47.6	1.2e-95
WP_039934929.1|216168_217707_+	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_003141522.1|217706_218645_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.5	7.3e-27
WP_003141520.1|218684_219233_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_039934926.1|219693_220614_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	55.2	3.4e-85
WP_003141957.1|220794_221787_-	aliphatic sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003141956.1|221806_222556_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003141954.1|222555_223326_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.4	3.0e-34
WP_060779308.1|224167_225493_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.2	5.1e-50
WP_003143749.1|225663_226836_+|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	99.6	1.7e-134
WP_003141000.1|226893_228381_+	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_039934622.1|228758_229583_+	methionine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003140998.1|230301_231723_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	31.6	3.5e-49
WP_003140996.1|231769_232207_+	Mini-ribonuclease 3	NA	NA	NA	NA	NA
WP_003140994.1|232199_233015_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_003140992.1|233062_233602_+	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_016897297.1|233667_234294_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_167541423.1|234413_234860_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	62.6	2.3e-47
WP_060779310.1|234937_236080_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0ICY9	Lactobacillus_phage	49.1	8.1e-97
WP_003142585.1|236314_237646_+	GntP family permease	NA	NA	NA	NA	NA
WP_003142586.1|237803_237956_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_003142588.1|237996_238170_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_003142589.1|238314_238869_+	transcription termination/antitermination protein NusG	NA	NA	NA	NA	NA
WP_106427305.1|239222_239891_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_029315747.1|240167_240593_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_003142595.1|240692_241382_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_003142597.1|241606_242110_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_003142599.1|242166_242535_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_003142601.1|242842_243778_+	zinc ABC transporter solute-binding protein	NA	NA	NA	NA	NA
WP_039935644.1|243834_244572_+	metal ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	26.9	2.7e-13
WP_003142604.1|244555_245470_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_003142605.1|245469_246327_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_106427306.1|246535_247153_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016897314.1|247442_248687_+	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.5	1.7e-31
WP_003142612.1|248679_249537_+	proline/glycine betaine ABC transporter permease	NA	NA	NA	NA	NA
WP_003142613.1|249559_250465_+	glycine betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003142617.1|251743_253108_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003142618.1|253588_257170_+	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	24.7	8.9e-49
WP_003142619.1|257202_260859_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	24.6	3.7e-58
WP_003142621.1|260922_261762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003142623.1|261793_262510_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_039935652.1|263110_265456_+	HAD-IC family P-type ATPase	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	26.0	3.2e-39
WP_003142625.1|265552_266728_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	67.4	3.5e-143
WP_060779311.1|267182_268418_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0IJS6	Lactobacillus_phage	45.9	1.6e-90
WP_039934987.1|268621_270469_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	40.0	3.6e-54
WP_003141629.1|270544_270859_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_003141630.1|271072_271672_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_003141632.1|271702_272362_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	52.2	3.0e-51
WP_003141634.1|272419_273433_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	34.0	4.1e-36
WP_003141636.1|273593_274448_+	Rgg/GadR/MutR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003141638.1|274799_275375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060779312.1|275904_277245_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	24.4	5.0e-13
>prophage 3
NZ_CP014164	Aerococcus viridans strain CCUG4311 chromosome, complete genome	2199877	449720	514596	2199877	transposase,protease	Staphylococcus_phage(26.32%)	60	NA	NA
WP_004262636.1|449720_451835_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	39.1	3.7e-119
WP_004262638.1|452080_452290_-	helix-turn-helix transcriptional regulator	NA	A0A097PBE6	Streptococcus_pyogenes_phage	58.6	3.6e-11
WP_004262641.1|452576_453755_-	hypothetical protein	NA	A0A218MNE0	uncultured_virus	29.5	6.7e-38
WP_004262652.1|454494_455376_-	methylenetetrahydrofolate reductase [NAD(P)H]	NA	NA	NA	NA	NA
WP_039935901.1|455379_457632_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_039935902.1|458116_459028_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004262667.1|459180_459624_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_004262670.1|459638_460031_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_004262678.1|460880_461834_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	52.9	2.7e-93
WP_039935904.1|461941_462895_-	ribonucleoside-triphosphate reductase	NA	A0A096XT60	Enterococcus_phage	32.0	3.3e-35
WP_004262686.1|462936_463398_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	NA	NA	NA	NA
WP_004262691.1|463544_464210_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_106427320.1|464569_464845_-	DUF4298 domain-containing protein	NA	NA	NA	NA	NA
WP_039935905.1|465294_465729_+	cupin domain-containing protein	NA	Q2I8C5	Bacillus_phage	50.4	3.7e-34
WP_004262703.1|465969_466353_+	tautomerase family protein	NA	NA	NA	NA	NA
WP_004262705.1|466452_466980_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	40.5	3.7e-28
WP_106427319.1|467067_467703_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_004262713.1|468040_469135_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	37.7	1.0e-48
WP_004262717.1|469135_469738_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	41.2	1.7e-37
WP_060779318.1|469738_470935_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	51.8	2.5e-112
WP_060779319.1|471017_472160_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0ICY9	Lactobacillus_phage	48.0	2.0e-95
WP_060779320.1|472261_472681_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	61.9	2.6e-45
WP_039935099.1|472750_473224_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	53.0	1.3e-35
WP_003141824.1|473369_474749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060779321.1|474889_475312_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	61.9	1.4e-46
WP_039936020.1|475384_476221_+	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
WP_003143680.1|476379_480333_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_039936019.1|480346_481048_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.1	1.3e-33
WP_003143683.1|481227_481812_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_106427291.1|482615_482903_-	DUF1232 domain-containing protein	NA	NA	NA	NA	NA
WP_003142197.1|482977_483475_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003142195.1|483983_484823_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_039935308.1|484822_485449_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_003142193.1|485449_486274_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_003142191.1|486750_487929_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_106427290.1|488240_489374_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_003142187.1|489814_491041_+	amidohydrolase	NA	NA	NA	NA	NA
WP_003142185.1|491012_492299_+	amidohydrolase	NA	NA	NA	NA	NA
WP_003142184.1|492291_493242_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003142183.1|493327_494272_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003142182.1|494292_495921_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003142181.1|495905_497129_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.0	1.3e-15
WP_003142180.1|497140_498088_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.0	2.4e-17
WP_157832729.1|498164_498326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003142176.1|499306_500113_+	ATP phosphoribosyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_003142175.1|500109_500718_+	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_003142174.1|500718_501969_+	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_003142173.1|501972_503013_+	histidinol-phosphate aminotransferase family protein	NA	NA	NA	NA	NA
WP_003142172.1|503002_503587_+	imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_003142171.1|503652_504351_+	1-(5-phosphoribosyl)-5-((5- phosphoribosylamino)methylideneamino)imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_003142169.1|504354_505101_+	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_003142166.1|505104_505743_+	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	NA	NA	NA	NA
WP_003142165.1|506232_506427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003142162.1|506423_507146_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003142160.1|507477_507942_+	glutathione peroxidase	NA	NA	NA	NA	NA
WP_060779322.1|508299_509472_-|transposase	IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	87.6	5.4e-120
WP_003141351.1|509764_510826_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_003141349.1|510876_511860_-	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_048726159.1|511875_512262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060779323.1|513360_514596_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0IJS6	Lactobacillus_phage	45.9	4.2e-91
>prophage 4
NZ_CP014164	Aerococcus viridans strain CCUG4311 chromosome, complete genome	2199877	570355	632050	2199877	transposase,tRNA	Lactobacillus_phage(25.0%)	60	NA	NA
WP_060779331.1|570355_571696_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	24.6	2.2e-13
WP_003140895.1|571947_572115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081453817.1|572114_572285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003140897.1|572298_572709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050774094.1|572888_573332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115609885.1|573388_573520_-	HAD hydrolase family protein	NA	NA	NA	NA	NA
WP_016897805.1|573665_574253_+	chromate transporter	NA	NA	NA	NA	NA
WP_003140902.1|574249_574822_+	chromate transporter	NA	NA	NA	NA	NA
WP_039934580.1|574911_575916_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003140906.1|576663_577500_+	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_039934582.1|577619_578648_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A067ZJG7	Escherichia_phage	35.7	2.2e-45
WP_060779332.1|579291_580434_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0ICY9	Lactobacillus_phage	49.1	6.2e-97
WP_003142791.1|580813_581152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003142793.1|581339_582725_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_003142795.1|582952_583699_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	34.5	9.2e-25
WP_003142796.1|583691_584375_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003142798.1|584486_585338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039935775.1|586378_586945_+	FMN reductase	NA	NA	NA	NA	NA
WP_003142802.1|586926_587487_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_060779333.1|587570_588359_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003140845.1|588468_589788_+|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	94.3	6.9e-241
WP_003142362.1|590030_590861_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003142361.1|590885_591716_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_060779334.1|591734_592448_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_003142358.1|592444_593188_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.3	1.2e-32
WP_003142357.1|593552_594665_-	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_039935449.1|594742_595804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003142355.1|595834_596074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003142354.1|596088_596604_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_106427297.1|596761_598525_+	DUF4153 domain-containing protein	NA	NA	NA	NA	NA
WP_003142352.1|598799_600893_+	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_039935445.1|601070_601445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039935443.1|601691_602969_+	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_003142349.1|602971_605719_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_003142348.1|605743_606787_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_106427296.1|607266_607689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039935441.1|607702_609289_+	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_060779335.1|609372_610896_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	36.9	1.1e-88
WP_003141613.1|611366_612497_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_003141611.1|612610_612976_-	YtxH domain-containing protein	NA	NA	NA	NA	NA
WP_003141609.1|612977_613412_-	HIT family protein	NA	D7NW73	Streptomyces_phage	30.2	2.7e-08
WP_039934976.1|613627_614374_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.2	1.4e-20
WP_106427272.1|614360_615608_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_039934974.1|615753_616566_+	phosphotransferase family protein	NA	NA	NA	NA	NA
WP_003141604.1|616919_617561_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_003141603.1|617608_617959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039934972.1|618356_618992_+|tRNA	DUF4479 and tRNA-binding domain-containing protein	tRNA	NA	NA	NA	NA
WP_106427271.1|619167_619917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003141600.1|619909_621253_+	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
WP_003141599.1|621334_622312_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_003141598.1|622409_623312_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	43.9	8.2e-60
WP_003141597.1|623368_624679_-	alkaline phosphatase	NA	NA	NA	NA	NA
WP_039934968.1|624811_625819_+	nucleoid-associated protein	NA	NA	NA	NA	NA
WP_003141595.1|625868_626051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003141594.1|626466_628269_+	M3 family oligoendopeptidase	NA	NA	NA	NA	NA
WP_003141593.1|628413_629232_+	ADP-ribosylglycohydrolase	NA	NA	NA	NA	NA
WP_003141592.1|629253_629844_+	uracil-DNA glycosylase family protein	NA	NA	NA	NA	NA
WP_158320207.1|630214_630367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060779336.1|630384_630807_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	61.2	1.8e-46
WP_060779337.1|630907_632050_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0ICY9	Lactobacillus_phage	48.5	4.0e-96
>prophage 5
NZ_CP014164	Aerococcus viridans strain CCUG4311 chromosome, complete genome	2199877	651324	709004	2199877	transposase,protease,tRNA	Tupanvirus(20.0%)	58	NA	NA
WP_039935182.1|651324_653253_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	35.8	6.8e-112
WP_003142010.1|653613_654804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003142011.1|654920_655454_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_060779338.1|655650_656466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003142014.1|656563_657004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081453827.1|657274_657796_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	36.8	8.2e-12
WP_003142016.1|657821_658022_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_003142018.1|658075_658435_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_003142019.1|658772_659846_+	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.7	4.4e-28
WP_003142020.1|659845_660523_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003142022.1|660561_661476_+	methionine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003142024.1|661509_662424_+	methionine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_060779308.1|662638_663964_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.2	5.1e-50
WP_003141392.1|664508_665045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003141391.1|665103_666126_+	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_003141390.1|666253_666955_-	adapter protein MecA	NA	NA	NA	NA	NA
WP_003141389.1|667084_667501_-	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_003141388.1|667715_668711_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003141387.1|669044_669218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003141386.1|669506_670604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039934813.1|670672_672469_+	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_003141382.1|672591_673287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003141380.1|673501_674092_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_039934810.1|674300_675002_+	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
WP_003141377.1|675094_675934_+	NAD kinase	NA	NA	NA	NA	NA
WP_039934821.1|676017_676899_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_039934818.1|677075_678437_+	magnesium transporter	NA	NA	NA	NA	NA
WP_039934806.1|678893_679829_+	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_003141369.1|679871_680360_+	redoxin family protein	NA	NA	NA	NA	NA
WP_003141366.1|680453_680867_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	35.4	3.5e-18
WP_003141365.1|681026_681827_+	glutathione-dependent disulfide-bond oxidoreductase	NA	NA	NA	NA	NA
WP_003141363.1|682035_682488_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_039934801.1|682718_684293_+	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	35.0	1.1e-14
WP_003141359.1|684465_684984_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_039934798.1|685450_686467_+	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_107127075.1|686592_686781_-|transposase	transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	54.1	2.9e-12
WP_003142310.1|687382_687730_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003142311.1|687729_688137_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_039935390.1|688255_690445_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	41.2	2.2e-127
WP_003140845.1|690731_692051_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	94.3	6.9e-241
WP_039935992.1|692449_692716_+	phosphocarrier protein HPr	NA	NA	NA	NA	NA
WP_003143593.1|692717_694451_+	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_003143594.1|694662_695919_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_039935993.1|696055_696283_+	YkuJ family protein	NA	NA	NA	NA	NA
WP_003143596.1|696410_697955_+	UDP-N-acetylmuramyl-tripeptide synthetase	NA	NA	NA	NA	NA
WP_039935995.1|698026_699331_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_003143599.1|699340_700228_+	homoserine kinase	NA	NA	NA	NA	NA
WP_039935996.1|700445_700976_+	YqeG family HAD IIIA-type phosphatase	NA	NA	NA	NA	NA
WP_003143601.1|700968_702096_+	ribosome biogenesis GTPase YqeH	NA	NA	NA	NA	NA
WP_003143603.1|702209_702518_+	ribosome assembly RNA-binding protein YhbY	NA	NA	NA	NA	NA
WP_050774134.1|702573_703197_+	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_003143607.1|703186_703813_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_003143608.1|703842_704202_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_003143610.1|704211_704979_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003143612.1|705012_706284_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_003143613.1|706483_707041_+	nucleic acid-binding protein	NA	NA	NA	NA	NA
WP_016897670.1|707067_707253_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_060779335.1|707480_709004_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	36.9	1.1e-88
>prophage 6
NZ_CP014164	Aerococcus viridans strain CCUG4311 chromosome, complete genome	2199877	913788	983221	2199877	transposase,protease	Streptococcus_phage(11.76%)	48	NA	NA
WP_107127077.1|913788_915078_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.0	3.8e-50
WP_003142153.1|915351_916290_-	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_003142151.1|916428_917628_-	pyrimidine nucleoside transporter NupC	NA	NA	NA	NA	NA
WP_003142149.1|917871_919128_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.2	3.8e-140
WP_003142147.1|919213_919819_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_106427289.1|919919_921815_+	DNA primase	NA	A0A1S5RH70	Helicobacter_phage	29.9	5.0e-43
WP_003142143.1|921852_922977_+	RNA polymerase sigma factor RpoD	NA	F4YCU2	Synechococcus_phage	38.6	7.6e-39
WP_060779331.1|923110_924451_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	24.6	2.2e-13
WP_003141106.1|925838_929018_+	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_167541429.1|929706_930546_+	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_003141103.1|930561_931587_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_003141101.1|931587_932628_+	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_003141099.1|932653_933925_+	bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ	NA	NA	NA	NA	NA
WP_003141097.1|933934_935134_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.0	1.5e-29
WP_003141096.1|935571_937113_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2H4UUX5	Bodo_saltans_virus	22.5	1.5e-29
WP_060779346.1|937275_937698_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	59.0	1.1e-43
WP_003141055.1|939273_939978_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003141054.1|939990_940806_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_003141053.1|940819_942076_+	peptidase T	NA	NA	NA	NA	NA
WP_003141050.1|942208_945937_+	ATP-dependent deoxyribonuclease subunit B	NA	NA	NA	NA	NA
WP_003141049.1|945926_949790_+	helicase-exonuclease AddAB subunit AddA	NA	G3MA40	Bacillus_virus	22.8	1.1e-12
WP_003141048.1|950111_950774_+	reverse transcriptase-like protein	NA	A0A220BZ00	Staphylococcus_phage	37.2	1.3e-17
WP_003141047.1|950832_951306_+	signal peptidase II	NA	NA	NA	NA	NA
WP_039934639.1|951317_952271_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_003141045.1|952349_952580_+	YneF family protein	NA	NA	NA	NA	NA
WP_003141044.1|952754_954524_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	28.8	4.2e-44
WP_003141043.1|954510_956322_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.7	2.8e-43
WP_039934635.1|956311_956977_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_003141040.1|957038_957530_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_050774096.1|957857_961058_+	DEAD/DEAH box helicase family protein	NA	A0A0P0YMN2	Yellowstone_lake_phycodnavirus	33.6	1.4e-48
WP_039934631.1|961256_962015_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_003141035.1|962168_963047_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_003141034.1|963166_963886_+	UMP kinase	NA	NA	NA	NA	NA
WP_003141032.1|963899_964460_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_003141030.1|964713_965460_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	41.6	4.7e-21
WP_003141028.1|965474_966272_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_003141026.1|966321_967587_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_003141024.1|967677_971997_+	PolC-type DNA polymerase III	NA	A0A0A8WJ41	Clostridium_phage	37.0	8.5e-22
WP_003141022.1|972222_973698_+	DUF1538 domain-containing protein	NA	NA	NA	NA	NA
WP_003141020.1|973710_974364_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_026465958.1|974507_974984_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_003141016.1|975014_976358_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_003141014.1|976376_976676_+	YlxR family protein	NA	NA	NA	NA	NA
WP_003141013.1|976665_976953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003141012.1|977033_979295_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	23.1	1.0e-18
WP_003141011.1|979307_979703_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_060779347.1|980144_980990_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003140845.1|981901_983221_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	94.3	6.9e-241
>prophage 7
NZ_CP014164	Aerococcus viridans strain CCUG4311 chromosome, complete genome	2199877	1146484	1155946	2199877		Thermus_phage(16.67%)	10	NA	NA
WP_106427257.1|1146484_1147405_-	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	38.0	3.9e-25
WP_039934570.1|1147472_1148228_-	ribonuclease HII	NA	G9E3X7	Emiliania_huxleyi_virus	34.4	2.5e-22
WP_003140861.1|1148282_1149158_-	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_003140863.1|1149244_1149805_-	signal peptidase I	NA	NA	NA	NA	NA
WP_003140864.1|1149899_1151471_-	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	29.9	2.3e-25
WP_003140866.1|1151529_1151763_-	D-Ala-D-Ala carboxypeptidase	NA	NA	NA	NA	NA
WP_106427258.1|1151787_1152441_-	DUF2140 family protein	NA	NA	NA	NA	NA
WP_003140871.1|1152458_1152962_-	dihydrofolate reductase	NA	A0A1Q2U372	Vibrio_phage	36.9	4.6e-20
WP_003140872.1|1153017_1153971_-	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	60.8	7.2e-115
WP_003140874.1|1154032_1155946_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.7	2.5e-58
>prophage 8
NZ_CP014164	Aerococcus viridans strain CCUG4311 chromosome, complete genome	2199877	1329440	1381679	2199877	transposase,tRNA,integrase	Staphylococcus_phage(29.41%)	46	1325038:1325053	1366422:1366437
1325038:1325053	attL	ATGTTGCTGTTGAAGC	NA	NA	NA	NA
WP_060779340.1|1329440_1330442_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.9	1.8e-55
WP_039934722.1|1330705_1330927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039934724.1|1331530_1331692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003141212.1|1331684_1331894_-	helix-turn-helix transcriptional regulator	NA	A0A1S5SDM7	Streptococcus_phage	61.7	1.6e-14
WP_003141211.1|1332139_1332445_+	helix-turn-helix transcriptional regulator	NA	A0A1S5SDR1	Streptococcus_phage	44.6	7.6e-10
WP_003141210.1|1332474_1332843_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A223LGM3	Staphylococcus_phage	31.8	8.0e-06
WP_003141209.1|1332858_1333236_+	TM2 domain-containing protein	NA	NA	NA	NA	NA
WP_003141208.1|1333322_1333904_+	DUF5067 domain-containing protein	NA	NA	NA	NA	NA
WP_003141206.1|1333993_1334908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003141203.1|1335225_1336341_+|integrase	site-specific integrase	integrase	A0A0A8WF08	Clostridium_phage	48.4	2.3e-88
WP_039934718.1|1336394_1337954_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	32.4	4.6e-18
WP_003141201.1|1338157_1339156_+	mevalonate kinase	NA	NA	NA	NA	NA
WP_003141200.1|1339218_1340232_+	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_003141199.1|1340215_1341400_+	phosphomevalonate kinase	NA	NA	NA	NA	NA
WP_039934716.1|1341401_1342451_+	type 2 isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_003141197.1|1342857_1343169_-	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_003141196.1|1343179_1343890_-	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_003141195.1|1343929_1345606_-	ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	27.2	1.8e-12
WP_003141193.1|1345678_1346614_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_003141192.1|1346841_1347081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003141190.1|1347141_1347681_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003141188.1|1347728_1348196_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_158320208.1|1348284_1348383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060779331.1|1349190_1350531_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	24.6	2.2e-13
WP_039936052.1|1350672_1351656_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_003143822.1|1351813_1353298_-	gluconokinase	NA	NA	NA	NA	NA
WP_003143823.1|1353479_1355909_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_003143824.1|1355915_1356962_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.3	1.6e-30
WP_003143825.1|1357317_1357662_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003143827.1|1357645_1358278_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_003143829.1|1358390_1359185_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_003143830.1|1359189_1360593_-	dipeptidase PepV	NA	NA	NA	NA	NA
WP_003143832.1|1361205_1361982_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_003143833.1|1361971_1363792_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_050774136.1|1364185_1365049_-	pyridoxamine kinase	NA	NA	NA	NA	NA
WP_039936056.1|1365112_1367527_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	69.9	0.0e+00
1366422:1366437	attR	GCTTCAACAGCAACAT	NA	NA	NA	NA
WP_003143838.1|1367855_1368758_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_106427344.1|1368761_1369895_-	3-dehydroquinate synthase	NA	E5ERI4	Ostreococcus_lucimarinus_virus	31.3	3.3e-26
WP_039936058.1|1369956_1370826_-	3-deoxy-7-phosphoheptulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	31.7	5.3e-16
WP_003143842.1|1371248_1373570_-	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXE4	Bacillus_phage	42.4	3.1e-18
WP_003143844.1|1373766_1374333_+	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	36.6	4.8e-26
WP_003143846.1|1374333_1375062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060779326.1|1377390_1377813_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	61.9	1.8e-46
WP_060779361.1|1377914_1379057_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0ICY9	Lactobacillus_phage	48.0	2.0e-95
WP_003141880.1|1379343_1380459_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_060779340.1|1380677_1381679_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.9	1.8e-55
>prophage 9
NZ_CP014164	Aerococcus viridans strain CCUG4311 chromosome, complete genome	2199877	1427373	1434885	2199877		Staphylococcus_phage(16.67%)	7	NA	NA
WP_003141800.1|1427373_1427694_-	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	46.3	7.7e-21
WP_003141803.1|1428668_1429922_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_003141804.1|1429952_1431473_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	42.7	7.3e-61
WP_003141805.1|1431525_1432089_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.4	5.0e-23
WP_003141806.1|1432085_1433111_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SR00	Cyanophage	44.5	3.3e-65
WP_003141807.1|1433141_1434392_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	28.1	1.4e-30
WP_003141809.1|1434405_1434885_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	49.0	2.6e-28
>prophage 10
NZ_CP014164	Aerococcus viridans strain CCUG4311 chromosome, complete genome	2199877	1487657	1526718	2199877	transposase,integrase	Enterobacteria_phage(38.46%)	42	1479225:1479241	1520577:1520593
1479225:1479241	attL	AGGAATTTTTGAACTAA	NA	NA	NA	NA
WP_060779365.1|1487657_1488893_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0IJS6	Lactobacillus_phage	45.7	2.1e-90
WP_060779366.1|1489043_1489487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003141443.1|1489476_1490151_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_003141445.1|1490201_1490450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003141446.1|1490454_1490721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081453820.1|1490721_1490985_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_147291243.1|1490965_1491205_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	41.2	1.5e-08
WP_003141452.1|1491459_1492041_-	YdcF family protein	NA	NA	NA	NA	NA
WP_003141454.1|1492281_1492647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003141644.1|1494065_1494806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106427274.1|1494912_1495212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003141646.1|1495245_1495722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003141647.1|1495712_1495970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050774102.1|1496036_1496909_-	hypothetical protein	NA	A0A2H4J8H9	uncultured_Caudovirales_phage	30.4	2.9e-30
WP_003141651.1|1498946_1499993_-	pseudaminic acid synthase	NA	NA	NA	NA	NA
WP_003141652.1|1499982_1500960_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_003141654.1|1500949_1501654_-	metallophosphoesterase family protein	NA	NA	NA	NA	NA
WP_003141656.1|1501658_1502429_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003141657.1|1502433_1503417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003141658.1|1503429_1504164_-	glycosyltransferase family protein	NA	NA	NA	NA	NA
WP_003141660.1|1504172_1505363_-	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	26.9	1.3e-33
WP_003141661.1|1505378_1506383_-	UDP-N-acetylglucosamine 4,6-dehydratase (inverting)	NA	A0A2P1ELS8	Moumouvirus	35.6	1.5e-41
WP_003141663.1|1506412_1507690_-	flippase	NA	NA	NA	NA	NA
WP_003141665.1|1507776_1509129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003141667.1|1509133_1510120_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_003141668.1|1510109_1510949_-	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	39.5	5.1e-40
WP_039935001.1|1510948_1511980_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	46.8	2.5e-81
WP_003141670.1|1511999_1512551_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	48.6	8.5e-44
WP_003141671.1|1512567_1513452_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.0	2.3e-107
WP_003141672.1|1513448_1514174_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_003141674.1|1514170_1514986_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_039935004.1|1515059_1515410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039935006.1|1515436_1516345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003141678.1|1516384_1517512_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_039935019.1|1517511_1518381_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_003141683.1|1519773_1520502_-	CpsD/CapB family tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_003141685.1|1520505_1521243_-	LPS chain length-determining protein	NA	NA	NA	NA	NA
1520577:1520593	attR	TTAGTTCAAAAATTCCT	NA	NA	NA	NA
WP_060779369.1|1521483_1522656_-|transposase	IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	88.4	6.3e-121
WP_082702807.1|1523661_1523796_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_003141336.1|1523843_1524581_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	50.8	3.2e-62
WP_060779370.1|1524570_1525809_-|transposase	IS21 family transposase	transposase	A0A059NT83	Lactococcus_phage	49.3	6.7e-105
WP_107127079.1|1525899_1526718_-|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	51.2	8.0e-46
>prophage 11
NZ_CP014164	Aerococcus viridans strain CCUG4311 chromosome, complete genome	2199877	1541629	1596689	2199877	transposase,tRNA	Lactobacillus_phage(33.33%)	42	NA	NA
WP_003140845.1|1541629_1542949_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	94.3	6.9e-241
WP_003141966.1|1543381_1543903_-	DUF3324 domain-containing protein	NA	NA	NA	NA	NA
WP_039935165.1|1545060_1545573_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	49.1	4.7e-36
WP_003141972.1|1545652_1545976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107127080.1|1547446_1547941_-	helix-turn-helix domain-containing protein	NA	A0A1B1P776	Bacillus_phage	35.6	8.8e-08
WP_060779369.1|1548002_1549175_+|transposase	IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	88.4	6.3e-121
WP_003143296.1|1549398_1550094_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.3	6.4e-28
WP_039935926.1|1550103_1551219_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_039935927.1|1551325_1551556_-	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_003143299.1|1551722_1552286_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_157832732.1|1552376_1552481_-	putative metal homeostasis protein	NA	NA	NA	NA	NA
WP_060779374.1|1553034_1562742_-	Cna B-type domain-containing protein	NA	NA	NA	NA	NA
WP_060779375.1|1562809_1563046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003143301.1|1563598_1563826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157832733.1|1564019_1564976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003143304.1|1565049_1566732_-	DAK2 domain-containing protein	NA	NA	NA	NA	NA
WP_003143306.1|1566758_1567124_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_039935929.1|1567344_1567536_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_003143308.1|1567632_1568304_-	thiamine diphosphokinase	NA	NA	NA	NA	NA
WP_039935930.1|1568357_1569008_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_003143312.1|1569023_1569956_-	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_060779376.1|1570094_1571237_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0ICY9	Lactobacillus_phage	48.3	9.0e-96
WP_060779320.1|1571337_1571757_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	61.9	2.6e-45
WP_003142448.1|1571959_1574161_-	serine/threonine-protein kinase	NA	A0A1V0SH95	Hokovirus	27.1	1.1e-20
WP_003142449.1|1574160_1574964_-	Stp1/IreP family PP2C-type Ser/Thr phosphatase	NA	NA	NA	NA	NA
WP_003142450.1|1574983_1576432_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_003142452.1|1576421_1577405_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	31.7	4.2e-09
WP_039935517.1|1577511_1579929_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_003142454.1|1580188_1581553_+	guanine deaminase	NA	NA	NA	NA	NA
WP_003142455.1|1581717_1581930_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_039935521.1|1581929_1582562_-	guanylate kinase	NA	A0A0M5KCK5	Mollivirus	30.3	2.0e-12
WP_003142457.1|1582852_1583245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003142458.1|1583324_1584773_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_003142459.1|1584884_1585490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003142460.1|1585501_1587205_-	ribonuclease J	NA	NA	NA	NA	NA
WP_003142462.1|1587394_1588438_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003142463.1|1588623_1590732_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_003142464.1|1590942_1591212_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_003142465.1|1591866_1592562_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_003142466.1|1592669_1594664_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_060779377.1|1595023_1595446_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	60.4	1.6e-45
WP_060779378.1|1595546_1596689_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0ICY9	Lactobacillus_phage	48.0	1.2e-95
>prophage 12
NZ_CP014164	Aerococcus viridans strain CCUG4311 chromosome, complete genome	2199877	1611121	1651480	2199877	transposase,integrase	Streptococcus_phage(20.0%)	33	1610968:1611027	1622054:1623729
1610968:1611027	attL	CCTGAATAATTCATAGTTTTTCAAAAACGTTTCAAAAACCTTGTTATAACAGTCTATTTT	NA	NA	NA	NA
WP_003141076.1|1611121_1612435_+|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	62.4	1.2e-157
WP_003143621.1|1613143_1613674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039936000.1|1613951_1614311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003143623.1|1614325_1614790_-	replication initiation protein	NA	NA	NA	NA	NA
WP_060779379.1|1614851_1615184_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1B1P773	Bacillus_phage	46.2	6.3e-18
WP_158320209.1|1615128_1615278_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_003143785.1|1615562_1616513_-	class A sortase	NA	NA	NA	NA	NA
WP_106427342.1|1616670_1618029_+|transposase	ISL3 family transposase	transposase	A0A2R2ZGN7	Clostridioides_phage	23.6	1.3e-08
WP_082702799.1|1618100_1620806_-	choice-of-anchor A family protein	NA	NA	NA	NA	NA
WP_003143791.1|1620845_1621151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016896373.1|1621471_1621951_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_003141076.1|1622207_1623521_+|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	62.4	1.2e-157
WP_060779380.1|1624203_1625271_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	29.1	1.3e-27
1622054:1623729	attR	CCTGAATAATTCATAGTTTTTCAAAAACGTTTCAAAAACCTTGTTATAACAGTCTATTTTGTTTCGTTTATTCGCACCCTTTGGGTGTACAAAAAGAACCCCAATCTGCTATGGTTAAAGTGACTAAACCTAACCAAAGAAAGGGGTTCTCTCAATGGCAACTTTACACGAAAATCGTCTACTTTTCAATTCAAATGTTACAGTATCTCACTCTGGTGGAAATTTGTCCTCAGATTCCGGCTTAATATTAGCAAAAGAATTCATGAACAAATTTGAGTTTAGCCAAATCTTATGTAAAAACATCCAGATTCAAGATGACCGACTGTATCATGTTCATGAAAATGAATCTATTCTGGAACAAATCATCTTGCAGTTGATTGCAGGCTATCCTACAGATTCTTCAGCCAATATATTAGCAACGGATCCTATCTTTCAAGCTGTTTTAAGCAAAAAGCGGTTGGCTTCACAGTCATCCATTTCTCGCTTTTGGGATCGGATATCAACAGAAAATATCGTCCAGCTACAAAAGGTTAACCAGATTTTGATTGATAAAGCACGGACGATTCGAAATACGAACGAAATGATTTTCGATTTAGATTCTACTCACAGTGATACCTTTGGAAACCAAGAAATGACCGATTATAATGCGCATTACCAGACAACCGGTTATCATCCACTCGTTGCCTTTGATGGTCTTACCGGAGACTTTCTTAAAGCAGAACTTCGTTCTGGAAATGTCTACACCTCAAAAGGCGTCGCAGCATTTACTCGTCCATTATTTGAGCATTATCACTCTGTGACACCAGTAAGCACTATTATGGTACGTGCAGATAGTGGATTCGCAATGCCTGATTTGTATGAGCTTTGTGAAGAGTACGATAGTTTGTATACTATCCGTTTGAAATCCAATCGTAATCTGTACAGAATCGCTGATCAATTCGTTACCATTAAGGATCATCACGATTGGAGTAAGAAAGAAGTTCATTACTATAACGCCACTTATCAAGCAAAGTCATGGGGAAAATCCAGAAGGATCTGCATAAAATCAACCAGAGAAGCTAGTGAATTGCTTTTTAGACATGAATTCATCATTACTAATTTTTCAAAAGACGTCTCTCCAGAAATGGTTTTCCAAACGTATTCAAAAAGAGGAACGATGGAAAATTACATTAAGGACGCAAAAAACGGCTTTTACTTGGATAAAACAGATAGCCCACGTTTTATAGAAAATCATGCTCGTATGATCGTAAGCCTATTGGCTTACAATATCGTGAACTTCATGCGGACACTGTGTTTTACCAATGAAACGAAAGGGTATCAGGTTTCTACTATTCGCTTATTTCTCTTTAAAATTGCTGGAAAGATAGTTCATTCCGGAAGAAGACAATACTTGAAATTAAGTAGTTACCATGTTTACCAGAAGCTATTTTATCGGATTCTACAAAACATTCAGGTACTGCAGTGTTAGTTGCGTTTATTGCGCCATTCAAAAAAATTCGTTAACCATCCGATAGGATGAGTGCGCCCAAAATGAGGTCTTTCTTGAACTTAATCAGTTAGCAAAAATAAATTAAACCCTTTAGAAAAATATTTTTGAGAAAAAGAACCATTGAGCATAAAACTAAACAGATAATTATAAAATTTGGTAGTTTATAAAAAGTATGAATTATTCAGGA	NA	NA	NA	NA
WP_003141859.1|1625496_1626333_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003141860.1|1626426_1626750_-	YlbG family protein	NA	NA	NA	NA	NA
WP_039935128.1|1626880_1630306_-	pyruvate carboxylase	NA	NA	NA	NA	NA
WP_003141862.1|1630609_1632103_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_003141863.1|1632158_1633061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003141864.1|1633691_1635068_-	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
WP_039935123.1|1635341_1637177_-	translational GTPase TypA	NA	NA	NA	NA	NA
WP_003141866.1|1637413_1638193_-	inositol monophosphatase family protein	NA	NA	NA	NA	NA
WP_003141868.1|1638238_1638514_-	UPF0223 family protein	NA	NA	NA	NA	NA
WP_003141870.1|1638931_1640344_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.0	1.7e-43
WP_003141871.1|1640351_1642010_-	biotin/lipoyl-binding protein	NA	NA	NA	NA	NA
WP_003141872.1|1642102_1643080_-	alpha-ketoacid dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_003141873.1|1643082_1644186_-	pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha	NA	NA	NA	NA	NA
WP_039935126.1|1644575_1645148_+	peptide deformylase	NA	A0A067XQZ3	Caulobacter_phage	35.5	9.0e-12
WP_060779340.1|1645274_1646276_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.9	1.8e-55
WP_060779381.1|1646333_1647545_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	30.5	3.9e-41
WP_039936036.1|1647569_1649060_-	threonine synthase	NA	NA	NA	NA	NA
WP_003143761.1|1649328_1649964_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_039936035.1|1650135_1650699_-	energy-coupled thiamine transporter ThiT	NA	NA	NA	NA	NA
WP_060779382.1|1651057_1651480_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	60.4	1.2e-45
>prophage 13
NZ_CP014164	Aerococcus viridans strain CCUG4311 chromosome, complete genome	2199877	1735795	1848741	2199877	transposase,protease,tRNA	Lactobacillus_phage(26.67%)	92	NA	NA
WP_003143073.1|1735795_1737814_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	38.3	3.8e-97
WP_003143074.1|1738028_1738550_-	C40 family peptidase	NA	A0A2H4PQY6	Streptomyces_phage	46.3	3.0e-14
WP_003143076.1|1738736_1740002_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.2	1.1e-81
WP_003143078.1|1740420_1740633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003143079.1|1740647_1741328_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_060779384.1|1741428_1741851_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	61.2	5.3e-46
WP_060779385.1|1741951_1743094_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0ICY9	Lactobacillus_phage	48.8	1.4e-96
WP_060779386.1|1743176_1744712_-	AbgT family transporter	NA	NA	NA	NA	NA
WP_003140818.1|1745077_1745683_-	cyclodeaminase/cyclohydrolase family protein	NA	NA	NA	NA	NA
WP_003140820.1|1745750_1746338_-	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_106427256.1|1746645_1747986_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_003140823.1|1748199_1749033_-	DUF975 family protein	NA	NA	NA	NA	NA
WP_003140825.1|1749265_1749964_-	zinc metallopeptidase	NA	NA	NA	NA	NA
WP_003140826.1|1750025_1751039_-	alpha/beta hydrolase fold domain-containing protein	NA	NA	NA	NA	NA
WP_003140828.1|1751343_1751970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003140830.1|1751996_1753421_+	putative glycoside hydrolase	NA	NA	NA	NA	NA
WP_003140832.1|1753645_1754188_-	cysteine hydrolase family protein	NA	G3MA16	Bacillus_virus	57.2	5.6e-56
WP_003140835.1|1754268_1755438_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_039934560.1|1755434_1755929_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_060779387.1|1756222_1757458_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0IJS6	Lactobacillus_phage	45.9	1.6e-90
WP_003143318.1|1757940_1758921_+	DUF1002 domain-containing protein	NA	NA	NA	NA	NA
WP_102950041.1|1759106_1759781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003143320.1|1759867_1761358_-	carbon starvation protein A	NA	NA	NA	NA	NA
WP_003143321.1|1761716_1762424_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_060779388.1|1763795_1764218_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	58.3	7.2e-43
WP_158320210.1|1764510_1768863_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_003143745.1|1768940_1769237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147291240.1|1769315_1769780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060779389.1|1770076_1770556_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_003143502.1|1770786_1772124_+	potassium transporter	NA	NA	NA	NA	NA
WP_039935970.1|1772133_1772808_+	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
WP_003143507.1|1773240_1774599_-	PDZ domain-containing protein	NA	W5SAB9	Pithovirus	28.7	8.1e-11
WP_003143508.1|1774710_1775526_-	MBL fold metallo-hydrolase	NA	A0A0B5A2C7	Paenibacillus_phage	39.0	1.1e-39
WP_003143509.1|1775591_1777370_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_003143510.1|1777388_1778210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003143511.1|1778212_1779775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003143512.1|1779761_1781657_-	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	36.7	8.9e-40
WP_003143513.1|1781666_1782383_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.8	2.6e-40
WP_060779390.1|1782597_1784154_-	peptidoglycan endopeptidase	NA	D2KRB9	Lactobacillus_phage	38.3	1.5e-13
WP_003143515.1|1784533_1785283_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_060779391.1|1785441_1786584_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0ICY9	Lactobacillus_phage	48.5	5.3e-96
WP_060779392.1|1786684_1787107_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	61.2	3.1e-46
WP_003141694.1|1787711_1788140_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_039935037.1|1788831_1789575_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_003141700.1|1789661_1790999_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003141701.1|1791413_1792634_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_003141703.1|1792681_1793707_-	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_003141706.1|1793703_1794588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003141708.1|1794662_1795496_-	protein-ADP-ribose hydrolase	NA	A0A2K9L8X2	Tupanvirus	38.1	1.8e-32
WP_003141710.1|1795500_1795839_-	glycine cleavage system protein H	NA	NA	NA	NA	NA
WP_003141711.1|1795974_1796985_-	MsnO8 family LLM class oxidoreductase	NA	NA	NA	NA	NA
WP_003141713.1|1797226_1798423_+	NADH-dependent flavin oxidoreductase	NA	NA	NA	NA	NA
WP_003141714.1|1798467_1798761_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003141716.1|1798899_1800081_-	potassium transporter	NA	NA	NA	NA	NA
WP_039935029.1|1800711_1801401_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_003141718.1|1801464_1801965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003141722.1|1802827_1804030_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_039935031.1|1804137_1804833_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_003141726.1|1804887_1805592_-	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_003141728.1|1805789_1806305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039935035.1|1806486_1807827_+	amino acid permease	NA	NA	NA	NA	NA
WP_060779393.1|1808069_1809374_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	30.8	9.7e-46
WP_003143289.1|1810306_1812397_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	29.4	6.5e-60
WP_002294571.1|1812535_1812742_-	copper chaperone TcrZ	NA	NA	NA	NA	NA
WP_060779394.1|1813240_1814242_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_060779396.1|1815875_1816202_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_060779397.1|1816506_1817742_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0IJS6	Lactobacillus_phage	45.2	8.8e-89
WP_039935897.1|1817932_1818136_-	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_004262484.1|1818500_1820969_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	34.7	1.3e-102
WP_004262479.1|1820981_1821437_-	copper-responsive transcriptional repressor TcrY	NA	A3QSD4	Clostridium_virus	35.4	4.6e-11
WP_107127085.1|1821649_1821769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039935896.1|1822592_1823483_-	DegV family protein	NA	NA	NA	NA	NA
WP_158320212.1|1823509_1823707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005232990.1|1823877_1825197_+|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	88.4	1.0e-223
WP_039934709.1|1825851_1826742_-	fructose bisphosphate aldolase	NA	NA	NA	NA	NA
WP_003141178.1|1826931_1827126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060779398.1|1827157_1828162_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_003143498.1|1828570_1829929_-	DUF1541 domain-containing protein	NA	NA	NA	NA	NA
WP_060779417.1|1831607_1832459_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.8	2.3e-48
WP_060779399.1|1832844_1833753_-	cation transporter	NA	NA	NA	NA	NA
WP_003143660.1|1833791_1834106_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_060779400.1|1834471_1836397_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	35.8	1.5e-95
WP_039935500.1|1836655_1837219_+	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	46.4	1.6e-37
WP_039935508.1|1838121_1838805_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.6	1.0e-38
WP_003142441.1|1838801_1840211_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	34.9	4.1e-42
WP_003142439.1|1840755_1840989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003142438.1|1841033_1841873_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_003142437.1|1841916_1842309_-	peptidoglycan DD-metalloendopeptidase family protein	NA	D7RWE0	Brochothrix_phage	52.8	3.8e-06
WP_003142436.1|1842625_1842829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003142434.1|1842845_1843493_+	TIGR01906 family membrane protein	NA	NA	NA	NA	NA
WP_039934596.1|1845307_1847170_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	35.0	1.8e-98
WP_060779355.1|1847421_1848741_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	88.6	1.2e-224
>prophage 14
NZ_CP014164	Aerococcus viridans strain CCUG4311 chromosome, complete genome	2199877	1968649	1980222	2199877		Streptococcus_phage(50.0%)	11	NA	NA
WP_003143348.1|1968649_1969870_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	47.2	6.6e-89
WP_003143349.1|1969862_1970513_-	VanZ family protein	NA	NA	NA	NA	NA
WP_003143350.1|1970554_1971997_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	33.8	4.7e-33
WP_003143352.1|1971999_1972725_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.5	2.4e-30
WP_003143353.1|1972986_1973367_+	single-stranded DNA-binding protein	NA	A0A097BYB0	Leuconostoc_phage	30.4	7.5e-07
WP_039935936.1|1973564_1973990_+	DUF1772 domain-containing protein	NA	NA	NA	NA	NA
WP_003143355.1|1974377_1975322_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	38.2	1.3e-52
WP_003143356.1|1975346_1976378_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	49.5	1.2e-86
WP_003143357.1|1976374_1977262_-	RNase adapter RapZ	NA	NA	NA	NA	NA
WP_003143358.1|1977334_1979059_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	55.7	8.0e-181
WP_081453839.1|1979283_1980222_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	49.2	3.1e-86
>prophage 15
NZ_CP014164	Aerococcus viridans strain CCUG4311 chromosome, complete genome	2199877	2171661	2180430	2199877		Prochlorococcus_phage(33.33%)	7	NA	NA
WP_003142083.1|2171661_2172150_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	43.1	1.0e-24
WP_003142084.1|2172194_2173463_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_003142086.1|2173538_2175077_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	50.8	1.3e-76
WP_039935260.1|2175079_2175661_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	38.3	6.9e-28
WP_003142090.1|2175671_2176706_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	47.9	8.2e-64
WP_003142092.1|2176771_2178223_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.3	1.1e-53
WP_003142093.1|2178198_2180430_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.7	1.2e-149
