The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LN999997	Salmonella enterica subsp. enterica serovar Typhimurium isolate SO4698-09 chromosome I	5037238	468	28561	5037238	protease,holin,integrase,capsid,tail,portal,terminase,head	Shigella_phage(60.98%)	41	851:865	31859:31873
WP_000497751.1|468_639_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000779279.1|647_1208_-	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	99.5	2.3e-105
851:865	attL	GCAGCGTGCCGCCGT	NA	NA	NA	NA
WP_022630978.1|1204_1711_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	99.4	5.0e-91
WP_000702388.1|1685_2096_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	97.8	5.9e-74
WP_000927719.1|2092_2416_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_021577001.1|2390_2618_-	hypothetical protein	NA	S5FNU1	Shigella_phage	94.9	2.2e-22
WP_000257507.1|2667_3873_-|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	100.0	1.8e-224
WP_022630979.1|3887_4547_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	98.6	1.8e-117
WP_001514795.1|4524_5766_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.5	5.0e-241
WP_000605606.1|5765_5948_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_000088161.1|5959_7693_-|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	100.0	0.0e+00
WP_000929174.1|7706_8192_-|terminase	phage terminase small subunit P27 family	terminase	Q8SBI1	Shigella_phage	99.4	2.1e-86
WP_032172868.1|8317_8668_-	HNH endonuclease	NA	Q8SBD7	Shigella_phage	99.1	3.6e-64
WP_024249233.1|8851_9244_-	DUF2570 domain-containing protein	NA	Q8SBD9	Shigella_phage	89.2	3.1e-56
WP_016244989.1|9227_9704_-	glycoside hydrolase family protein	NA	S5FV07	Shigella_phage	97.5	2.4e-87
WP_001120502.1|9707_10043_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	100.0	5.2e-60
WP_048348970.1|10119_11172_-	site-specific DNA-methyltransferase	NA	Q8SBE2	Shigella_phage	98.9	9.8e-206
WP_064759114.1|11321_11600_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	90.7	1.0e-29
WP_015967852.1|11765_12518_-	antitermination protein	NA	Q8SBE4	Shigella_phage	100.0	2.8e-138
WP_001439745.1|12531_13521_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	9.5e-195
WP_023352899.1|13528_14338_-	KilA-N domain-containing protein	NA	A5LH75	Enterobacteria_phage	99.6	1.8e-151
WP_021512743.1|14357_14747_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	99.2	1.6e-68
WP_048348968.1|14743_15070_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	98.1	4.5e-53
WP_001343335.1|15066_15720_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	9.6e-127
WP_072129969.1|15719_16214_-	PerC family transcriptional regulator	NA	K7PJR0	Enterobacteria_phage	98.8	3.3e-87
WP_001677149.1|16210_17029_-	helix-turn-helix domain-containing protein	NA	Q8SBF1	Shigella_phage	100.0	1.8e-122
WP_000933941.1|17025_17262_-	hypothetical protein	NA	A0A291AX25	Escherichia_phage	97.4	1.3e-38
WP_001087343.1|17254_18091_-	ash family protein	NA	A0A291AWU3	Escherichia_phage	99.6	2.2e-152
WP_000515860.1|18087_18639_-	hypothetical protein	NA	Q8SBF4	Shigella_phage	100.0	7.6e-101
WP_000649477.1|18682_18883_-	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000859462.1|18973_19648_+	LexA family transcriptional repressor	NA	Q8SBF6	Shigella_phage	100.0	1.2e-132
WP_000159356.1|20060_20252_-	hypothetical protein	NA	S5FM78	Shigella_phage	100.0	3.3e-27
WP_001325618.1|20672_21053_+	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-63
WP_000081309.1|21118_21943_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	1.7e-149
WP_000008200.1|22070_22607_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	100.0	4.3e-101
WP_001242749.1|22597_22960_+	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000206732.1|22959_23265_+	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
WP_000051887.1|23491_24655_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_000893231.1|24860_26111_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	1.6e-98
WP_001285275.1|26122_27226_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_001043675.1|27508_28561_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	1.7e-112
31859:31873	attR	ACGGCGGCACGCTGC	NA	NA	NA	NA
>prophage 2
NZ_LN999997	Salmonella enterica subsp. enterica serovar Typhimurium isolate SO4698-09 chromosome I	5037238	863554	907417	5037238	protease,holin,tRNA,plate,tail,head,portal,terminase,integrase	Shigella_phage(44.83%)	62	865688:865702	869094:869108
WP_000918353.1|863554_864970_-	replicative DNA helicase	NA	A0A1B0VG30	Salmonella_phage	78.4	7.0e-199
WP_000235551.1|865034_866018_+	quinone oxidoreductase	NA	NA	NA	NA	NA
865688:865702	attL	GAAAGATACCTGGGA	NA	NA	NA	NA
WP_000891414.1|866192_866435_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_022630972.1|866602_867640_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332264.1|867728_868826_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	100.0	4.3e-212
WP_033567204.1|868887_869136_+	DinI-like family protein	NA	K7PLW4	Enterobacteria_phage	98.8	2.0e-37
869094:869108	attR	GAAAGATACCTGGGA	NA	NA	NA	NA
WP_000639149.1|869279_869843_-	recombinase family protein	NA	K7PJT4	Enterobacteria_phage	79.1	3.4e-80
WP_006678262.1|870168_870897_+	hypothetical protein	NA	A0A1B0V7G4	Salmonella_phage	100.0	2.8e-143
WP_001747940.1|870898_871306_+|tail	tail assembly chaperone	tail	A0A1B0V844	Salmonella_phage	100.0	4.9e-73
WP_006678265.1|871309_871927_-|tail	tail fiber assembly protein	tail	A0A1B0VCD0	Salmonella_phage	100.0	5.7e-113
WP_023200332.1|871896_873429_-	hypothetical protein	NA	A0A1B0VFW4	Salmonella_phage	97.9	1.6e-241
WP_000383548.1|873432_874017_-	YmfQ family protein	NA	O22003	Shigella_phage	100.0	1.1e-113
WP_022630974.1|874007_875066_-|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	98.6	5.2e-199
WP_000424732.1|875052_875478_-	phage GP46 family protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_022630975.1|875477_876026_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	97.8	1.9e-96
WP_000999499.1|876025_877105_-|plate	baseplate protein	plate	Q8SBG7	Shigella_phage	99.7	5.3e-207
WP_000219913.1|877101_878430_-	DNA circularization N-terminal domain-containing protein	NA	Q8SBG8	Shigella_phage	99.3	8.4e-247
WP_001439754.1|878520_879033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023200330.1|879114_880947_-|tail	phage tail tape measure protein	tail	S5FM63	Shigella_phage	99.2	4.7e-304
WP_000661047.1|881088_881358_-|tail	phage tail assembly protein	tail	S5FNR3	Shigella_phage	100.0	3.5e-43
WP_000090998.1|881357_881714_-|tail	phage tail tube protein	tail	U5P076	Shigella_phage	100.0	5.3e-63
WP_022630977.1|881713_883210_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	M1FN90	Enterobacteria_phage	99.0	7.7e-273
WP_000497751.1|883193_883364_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000779279.1|883372_883933_-	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	99.5	2.3e-105
WP_022630978.1|883929_884436_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	99.4	5.0e-91
WP_000702388.1|884410_884821_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	97.8	5.9e-74
WP_000927719.1|884817_885141_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_021577001.1|885115_885343_-	hypothetical protein	NA	S5FNU1	Shigella_phage	94.9	2.2e-22
WP_021578635.1|886611_887262_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	99.1	3.6e-118
WP_001514795.1|887239_888481_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.5	5.0e-241
WP_000605606.1|888480_888663_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_000088161.1|888674_890408_-|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	100.0	0.0e+00
WP_048306293.1|890421_890907_-|terminase	phage terminase small subunit P27 family	terminase	Q8SBI1	Shigella_phage	98.8	6.1e-86
WP_001135098.1|891032_891383_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	94.8	9.8e-62
WP_001379492.1|891433_891766_-	hypothetical protein	NA	A0A192Y5Y1	Salmonella_phage	100.0	2.8e-58
WP_001530346.1|892228_892621_-	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	100.0	2.8e-65
WP_001624504.1|892617_893232_-	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	100.0	5.7e-113
WP_000422366.1|893231_893513_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	45.2	9.7e-20
WP_001283169.1|893499_893886_-|holin	phage holin family protein	holin	A0A192Y8P2	Salmonella_phage	100.0	7.0e-61
WP_001624505.1|894031_894289_-	hypothetical protein	NA	A0A1C9IHX4	Salmonella_phage	100.0	3.1e-41
WP_048306282.1|894439_895192_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	99.6	9.0e-145
WP_033567167.1|895205_896195_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	2.1e-194
WP_001061444.1|896202_897012_-	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	100.0	1.8e-151
WP_001398927.1|897031_897421_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A291AX14	Escherichia_phage	100.0	5.4e-69
WP_000210170.1|897417_897744_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_001433188.1|897740_898394_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	5.6e-127
WP_086936917.1|898393_898888_-	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	97.5	4.7e-86
WP_000104942.1|898884_899826_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	93.3	1.7e-140
WP_001250269.1|899815_899995_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515829.1|900170_900728_-	protein YmfL	NA	S5FXP0	Shigella_phage	96.2	1.1e-96
WP_000649477.1|900771_900972_-	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000848748.1|901062_901737_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_001369946.1|901908_902112_+	ClpX C4-type zinc finger	NA	A0A1C9IHZ4	Salmonella_phage	68.3	8.9e-15
WP_001514782.1|902120_902396_+	hypothetical protein	NA	Q8SBF7	Shigella_phage	97.8	7.0e-47
WP_001323604.1|902978_903359_+	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	1.3e-62
WP_033567165.1|903424_904249_+	DUF2303 family protein	NA	U5P439	Shigella_phage	98.9	1.1e-148
WP_000008210.1|904376_904913_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	99.4	9.7e-101
WP_001565177.1|904903_905266_+	phage protein	NA	U5P092	Shigella_phage	97.5	1.5e-65
WP_000206745.1|905265_906075_+	hypothetical protein	NA	Q8HAA7	Salmonella_phage	61.8	3.3e-76
WP_001061343.1|906074_906647_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	96.8	3.7e-106
WP_001093909.1|906683_906956_+	pyocin activator PrtN family protein	NA	S5MQM5	Escherichia_phage	86.7	5.9e-38
WP_000549966.1|906982_907417_-	type II toxin-antitoxin system YafO family toxin	NA	A0A0S2SYH1	Pseudomonas_phage	51.0	5.2e-36
>prophage 3
NZ_LN999997	Salmonella enterica subsp. enterica serovar Typhimurium isolate SO4698-09 chromosome I	5037238	933866	954286	5037238	tail,plate	Burkholderia_phage(45.0%)	26	NA	NA
WP_000615248.1|933866_934214_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226442.1|934789_935077_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_001270441.1|935079_935685_+	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_000777266.1|935697_936012_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449433.1|936171_936627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875314.1|936623_936821_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000729852.1|936810_938238_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000907494.1|938237_938762_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001003642.1|938813_939131_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|939090_939219_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001262499.1|939315_941670_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	9.0e-66
WP_000271423.1|941669_942623_+	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001269716.1|942622_942832_+|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000818154.1|942819_943863_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_000679398.1|943872_944595_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000593182.1|944922_945285_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000703632.1|945281_946211_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
WP_001095011.1|946210_947758_+	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_001093501.1|947921_948281_+	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000951736.1|948271_949387_+|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_000359500.1|949379_950012_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000368196.1|950014_951760_+|tail	tail fiber protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
WP_001526208.1|951764_952370_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000084331.1|952366_952822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989092.1|953070_953361_+	membrane protein	NA	NA	NA	NA	NA
WP_000587738.1|953557_954286_+	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
>prophage 4
NZ_LN999997	Salmonella enterica subsp. enterica serovar Typhimurium isolate SO4698-09 chromosome I	5037238	1974480	2031147	5037238	holin,tRNA,capsid,plate,tail,portal,terminase,head,integrase	Cronobacter_phage(62.5%)	60	1989768:1989783	2022618:2022633
WP_000785626.1|1974480_1974879_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_033567197.1|1974881_1975187_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_000877297.1|1975228_1975597_-	DUF1090 domain-containing protein	NA	NA	NA	NA	NA
WP_000917516.1|1975741_1976125_-	EnvZ/OmpR regulon moderator MzrA	NA	NA	NA	NA	NA
WP_000422143.1|1976128_1976791_-	DedA family protein	NA	NA	NA	NA	NA
WP_000235363.1|1977240_1978485_-	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_001098833.1|1978739_1979708_-	TerC family protein	NA	I7HPH5	Enterobacteria_phage	34.9	5.0e-39
WP_000617687.1|1979980_1980979_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_000951049.1|1981067_1981760_-	vancomycin high temperature exclusion protein	NA	NA	NA	NA	NA
WP_000202966.1|1981911_1982409_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_000019989.1|1982494_1983631_+	23S rRNA (guanine(1835)-N(2))-methyltransferase RlmG	NA	NA	NA	NA	NA
WP_000121523.1|1983711_1985730_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_001520281.1|1985900_1987280_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	29.0	2.9e-32
WP_000094651.1|1987709_1989230_+	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	48.5	6.4e-33
WP_000478472.1|1989617_1991183_+	MCP four helix bundle domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.9	1.0e-12
1989768:1989783	attL	ACCACGGTGAAAGCCA	NA	NA	NA	NA
WP_000983441.1|1991179_1991827_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000213760.1|1992058_1992826_+	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_000627044.1|1993083_1994865_-	ATP-binding protein	NA	X2KLG0	Campylobacter_phage	23.2	6.4e-08
WP_001145219.1|1994854_1995892_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	63.9	1.5e-121
WP_000568372.1|1995895_1996462_-	PH domain-containing protein	NA	Q4ZA70	Staphylococcus_virus	32.8	1.3e-18
WP_000514631.1|1996478_1997060_-	phage repressor protein	NA	A0A218M4J1	Erwinia_phage	37.2	1.2e-27
WP_001247711.1|1997203_1997425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460878.1|1997455_1997959_+	phage regulatory CII family protein	NA	F1BUN6	Cronobacter_phage	72.5	3.5e-60
WP_000643375.1|1997968_1998196_+	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_000996837.1|1998185_1998611_+	hypothetical protein	NA	F1BUN5	Cronobacter_phage	49.6	2.2e-23
WP_000022786.1|1998610_1999012_+	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.9	1.4e-48
WP_000551169.1|1999079_1999313_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_000279404.1|1999303_2000164_+	DNA adenine methylase	NA	F1BUN1	Cronobacter_phage	82.0	1.1e-130
WP_000170874.1|2000160_2002182_+	replication endonuclease	NA	F1BUM9	Cronobacter_phage	74.5	7.9e-297
WP_000353141.1|2002301_2002508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001552031.1|2002481_2002805_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	92.3	8.0e-50
WP_000038213.1|2002801_2003863_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	76.8	6.7e-162
WP_001151939.1|2003859_2005635_-	hypothetical protein	NA	F1BUM5	Cronobacter_phage	83.1	9.8e-291
WP_000018800.1|2005795_2006599_+|capsid	GPO family capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	56.0	2.0e-78
WP_000550495.1|2006660_2007683_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.5	3.9e-159
WP_001218537.1|2007686_2008388_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	66.8	9.4e-88
WP_001680743.1|2008484_2008937_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	82.7	1.6e-64
WP_000084218.1|2008933_2009440_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.1	1.2e-63
WP_000560080.1|2009436_2010144_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	76.1	1.3e-100
WP_000220203.1|2010140_2011268_+	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	83.7	1.9e-175
WP_000166743.1|2011264_2011720_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	1.5e-57
WP_001154425.1|2011729_2012023_+|holin	phage holin family protein	holin	C7BGD7	Burkholderia_phage	46.2	1.3e-14
WP_000175560.1|2012019_2012361_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_000376373.1|2012360_2012693_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.9	1.5e-35
WP_000411339.1|2012839_2013097_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	63.4	3.6e-21
WP_000811094.1|2013284_2015255_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.8	3.2e-274
WP_001002797.1|2015251_2015581_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_000136921.1|2015577_2016762_+|plate	baseplate J/gp47 family protein	plate	F1BUK6	Cronobacter_phage	78.4	6.7e-179
WP_001001828.1|2016754_2017342_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.6	3.8e-90
WP_000084307.1|2017351_2019586_+|tail	phage tail protein	tail	Q8HAB4	Salmonella_phage	73.7	7.2e-182
WP_000861353.1|2019598_2020153_+|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	89.0	2.7e-90
WP_000267957.1|2020142_2020868_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	53.5	3.7e-63
WP_000200789.1|2020839_2021385_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.0	3.2e-59
WP_000977530.1|2021384_2023088_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.4	9.9e-224
2022618:2022633	attR	ACCACGGTGAAAGCCA	NA	NA	NA	NA
WP_000340945.1|2024456_2024759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000237776.1|2025082_2025589_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001519776.1|2025712_2027560_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_000918865.1|2027709_2029455_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	2.1e-72
WP_001144069.1|2029690_2029906_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_001264394.1|2030133_2031147_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	2.8e-109
>prophage 5
NZ_LN999997	Salmonella enterica subsp. enterica serovar Typhimurium isolate SO4698-09 chromosome I	5037238	2592724	2668122	5037238	holin,protease,transposase,tRNA,capsid,tail,portal,terminase,head,lysis,integrase	Salmonella_phage(42.11%)	86	2584805:2584821	2673969:2673985
2584805:2584821	attL	CGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_000997368.1|2592724_2593762_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_000179978.1|2593877_2594567_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000627811.1|2594885_2595269_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000188414.1|2595330_2595918_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_001526875.1|2596020_2596920_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219174.1|2596937_2598272_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_000083343.1|2598402_2599140_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000989177.1|2599124_2600747_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_014344135.1|2601010_2601175_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000003307.1|2601171_2601747_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001168374.1|2601778_2602429_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000812017.1|2602428_2603385_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_000589087.1|2603381_2603861_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_001007939.1|2604358_2605588_+|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	94.4	2.9e-233
WP_001670787.1|2605565_2605850_-	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
WP_001237031.1|2605890_2606130_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_077248255.1|2606172_2607330_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.5	3.9e-216
WP_000017125.1|2607292_2610220_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	S4TNL0	Salmonella_phage	99.3	0.0e+00
WP_001539619.1|2610346_2610697_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	97.4	1.1e-60
WP_000917562.1|2610718_2610877_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	9.0e-23
WP_001009037.1|2611275_2611680_-	transcriptional regulator	NA	H6WRX4	Salmonella_phage	99.3	1.6e-71
WP_000869364.1|2611809_2612046_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	100.0	1.8e-38
WP_001574095.1|2612011_2612386_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000062941.1|2612470_2613454_+	replication protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_000800010.1|2613456_2614206_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000113623.1|2614216_2614564_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
WP_000065105.1|2614560_2615085_+	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
WP_000445792.1|2615084_2615558_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
WP_001217666.1|2616422_2616662_+	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	1.1e-37
WP_000929803.1|2616996_2617599_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	1.1e-108
WP_001096550.1|2617807_2618419_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	1.2e-91
WP_000801757.1|2618415_2618556_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001097241.1|2618552_2619230_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
WP_000211410.1|2619502_2620066_+	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
WP_000657897.1|2620572_2620761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001110783.1|2620975_2621662_-|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	100.0	9.4e-133
WP_001574216.1|2621937_2622267_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_015701345.1|2622250_2622703_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.0	1.0e-79
WP_001533543.1|2622720_2623173_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
WP_000669690.1|2623408_2623810_-	pre-peptidase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001102153.1|2624096_2624642_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000623091.1|2624613_2626545_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
WP_000201415.1|2626528_2626732_+	gpW family protein	NA	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000831821.1|2626728_2628309_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_001189503.1|2628298_2629795_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
WP_000011260.1|2629807_2630155_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_000522566.1|2630209_2631238_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000201486.1|2631295_2631655_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000083294.1|2631665_2632049_+|head,tail	head-tail joining protein	head,tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
WP_000677089.1|2632076_2632655_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000817263.1|2632703_2633834_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	100.0	9.2e-218
WP_000033885.1|2633942_2634344_+|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_077248250.1|2634351_2635098_+	Ig-like domain-containing protein	NA	A0A291AWU6	Escherichia_phage	76.5	1.9e-99
WP_000479607.1|2635148_2635544_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_010989052.1|2635540_2635879_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000372065.1|2635850_2638946_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	1.7e-274
WP_000447369.1|2638948_2639278_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_001152689.1|2639287_2639986_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000662739.1|2639992_2640730_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_000246126.1|2640627_2641275_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_000514917.1|2641336_2644699_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.7	0.0e+00
WP_000178853.1|2644737_2644980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144691.1|2645033_2647406_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	65.6	1.1e-90
WP_000593433.1|2647402_2648227_+	macro domain-containing protein	NA	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_000143154.1|2648216_2648795_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_010989049.1|2648891_2649119_-	PagK-like protein	NA	NA	NA	NA	NA
WP_001738443.1|2649225_2649438_+	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_001526383.1|2650190_2650310_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001542312.1|2651022_2651160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989047.1|2651644_2653138_-	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	100.0	3.4e-260
WP_000790154.1|2653542_2655342_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_000002559.1|2655358_2656333_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068341.1|2656606_2657287_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000102232.1|2657283_2658189_+	GTPase Era	NA	NA	NA	NA	NA
WP_033567169.1|2658200_2658929_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000818972.1|2658940_2659672_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000986043.1|2659671_2660052_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_001196290.1|2660163_2660424_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.4e-17
WP_001022463.1|2660461_2661388_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001276365.1|2661503_2662700_+	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_000684027.1|2662721_2663639_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000995703.1|2663677_2664526_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001048530.1|2664641_2665535_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000361663.1|2665545_2666907_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000253558.1|2666910_2667546_+	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_001134566.1|2667570_2668122_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
2673969:2673985	attR	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
>prophage 6
NZ_LN999997	Salmonella enterica subsp. enterica serovar Typhimurium isolate SO4698-09 chromosome I	5037238	3022156	3051749	5037238	holin,protease,tail	Salmonella_phage(38.46%)	32	NA	NA
WP_000781589.1|3022156_3022651_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_000228070.1|3023064_3023556_+	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_001260058.1|3023545_3023809_+	chaperone NapD	NA	NA	NA	NA	NA
WP_000778097.1|3023805_3026292_+	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_000091673.1|3026298_3026994_+	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_000013529.1|3026980_3027850_+	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000835182.1|3027965_3028415_+	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_000431778.1|3028424_3029027_+	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_000888541.1|3029047_3029665_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2H4PQG7	Staphylococcus_phage	27.2	2.2e-11
WP_000990028.1|3029661_3030321_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_000266008.1|3030372_3031110_+	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_000074110.1|3031106_3031319_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_001053618.1|3031315_3031795_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_000982518.1|3031791_3033723_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_000828296.1|3033719_3034277_+	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_033572444.1|3034273_3035317_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_001115498.1|3035360_3036008_-	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_000281877.1|3036737_3037301_+	acyloxyacyl hydrolase	NA	NA	NA	NA	NA
WP_001653202.1|3037492_3037696_-	virulence protein MsgA	NA	NA	NA	NA	NA
WP_000624225.1|3037998_3038790_+|tail	tail fiber protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
WP_001113462.1|3039086_3039290_+|tail	tail protein	tail	NA	NA	NA	NA
WP_001115840.1|3039458_3041825_+	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001202279.1|3042153_3043143_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_010989045.1|3043157_3043526_+	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_000894640.1|3043554_3044886_-	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_001120499.1|3045182_3045512_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000554739.1|3046104_3047346_+	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001215679.1|3047348_3047876_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000022213.1|3048253_3048697_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_000639473.1|3048750_3050580_-	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
WP_000884778.1|3050927_3051218_-	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000806401.1|3051245_3051749_+	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
>prophage 7
NZ_LN999997	Salmonella enterica subsp. enterica serovar Typhimurium isolate SO4698-09 chromosome I	5037238	3123801	3132972	5037238	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|3123801_3124749_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
WP_000824855.1|3124732_3125464_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|3125444_3125552_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|3125611_3126343_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272845.1|3126565_3128251_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_000598637.1|3128247_3128967_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|3129013_3129481_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001197952.1|3129537_3130068_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|3130239_3130698_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195332.1|3130938_3132972_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 8
NZ_LN999997	Salmonella enterica subsp. enterica serovar Typhimurium isolate SO4698-09 chromosome I	5037238	3201280	3211786	5037238		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001111841.1|3201280_3202684_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
WP_000981469.1|3202861_3203755_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697840.1|3204131_3205217_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_001023662.1|3205216_3206116_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000857529.1|3206163_3207042_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_000973708.1|3207042_3207594_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000018226.1|3207599_3208592_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648784.1|3208588_3209362_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565905.1|3209366_3210446_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000126349.1|3210472_3211786_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 9
NZ_LN999997	Salmonella enterica subsp. enterica serovar Typhimurium isolate SO4698-09 chromosome I	5037238	3297780	3348467	5037238	holin,integrase,protease,capsid,plate,tail,portal,terminase,head	Salmonella_phage(81.54%)	70	3292358:3292372	3308488:3308502
3292358:3292372	attL	AATCAGCGCCTGCTG	NA	NA	NA	NA
WP_001219015.1|3297780_3298254_-	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
WP_000598920.1|3299563_3300361_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000532847.1|3300652_3301642_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_001527041.1|3301643_3301871_-	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	3.2e-37
WP_001061334.1|3301910_3302480_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	100.0	7.1e-110
WP_020899398.1|3302483_3303065_-	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	100.0	4.7e-109
WP_000224241.1|3303075_3303333_-	hypothetical protein	NA	A0A192Y5W0	Salmonella_phage	100.0	1.3e-42
WP_000215886.1|3303334_3303868_-	hypothetical protein	NA	A0A192Y7N1	Salmonella_phage	100.0	2.5e-101
WP_000008351.1|3303938_3304478_-	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_000080416.1|3304614_3305442_-	DUF2303 family protein	NA	A0A192Y6E5	Salmonella_phage	100.0	2.6e-153
WP_000997191.1|3305499_3305871_-	hypothetical protein	NA	A0A192Y6G0	Salmonella_phage	100.0	2.5e-63
WP_023891434.1|3306410_3306635_+	hypothetical protein	NA	A0A1C9IHY8	Salmonella_phage	100.0	1.6e-33
WP_001067432.1|3306597_3306936_-	hypothetical protein	NA	A0A1C9IHZ4	Salmonella_phage	100.0	7.0e-57
WP_001020636.1|3307141_3307837_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	100.0	3.2e-128
WP_001191666.1|3307934_3308159_+	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_000509731.1|3308187_3308742_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
3308488:3308502	attR	AATCAGCGCCTGCTG	NA	NA	NA	NA
WP_001087404.1|3308738_3309881_+	Rha family phage regulatory protein	NA	A0A1C9IHV9	Salmonella_phage	100.0	1.5e-212
WP_000620702.1|3309877_3310102_+	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_033567233.1|3310098_3311073_+	conserved phage C-terminal domain-containing protein	NA	A0A1C9IHW0	Salmonella_phage	100.0	2.3e-169
WP_000054228.1|3311069_3311543_+	PerC family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	100.0	4.9e-56
WP_033567232.1|3311539_3312415_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	99.3	2.7e-169
WP_000779148.1|3312423_3312813_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	100.0	4.9e-70
WP_001061452.1|3312829_3313690_+	KilA-N domain-containing protein	NA	A0A192Y6F8	Salmonella_phage	100.0	1.1e-162
WP_070793644.1|3313697_3314687_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	100.0	2.1e-194
WP_020899401.1|3314700_3315453_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	100.0	1.8e-145
WP_001624505.1|3315603_3315861_+	hypothetical protein	NA	A0A1C9IHX4	Salmonella_phage	100.0	3.1e-41
WP_001283169.1|3316006_3316393_+|holin	phage holin family protein	holin	A0A192Y8P2	Salmonella_phage	100.0	7.0e-61
WP_000422366.1|3316379_3316661_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	45.2	9.7e-20
WP_001624504.1|3316660_3317275_+	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	100.0	5.7e-113
WP_001530346.1|3317271_3317664_+	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	100.0	2.8e-65
WP_001379492.1|3318126_3318459_+	hypothetical protein	NA	A0A192Y5Y1	Salmonella_phage	100.0	2.8e-58
WP_001135098.1|3318509_3318860_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	94.8	9.8e-62
WP_000929191.1|3318985_3319480_+|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	100.0	4.6e-89
WP_033567282.1|3319476_3321210_+|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	99.5	0.0e+00
WP_000605609.1|3321221_3321404_+	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
WP_000466255.1|3321403_3322645_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	2.0e-242
WP_033567207.1|3322622_3323273_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	97.7	3.1e-117
WP_033572441.1|3323287_3324493_+|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	98.0	9.4e-221
WP_033572442.1|3324542_3324743_+	hypothetical protein	NA	S5FNU1	Shigella_phage	98.5	5.8e-27
WP_000927721.1|3324745_3325069_+|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	97.2	2.4e-54
WP_033567256.1|3325065_3325470_+|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	74.6	3.7e-52
WP_033567257.1|3325441_3325954_+	hypothetical protein	NA	Q8HAC8	Salmonella_phage	87.6	1.6e-81
WP_000779213.1|3325950_3326508_+	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	93.4	1.1e-96
WP_065305283.1|3326529_3326694_+	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	94.4	7.1e-23
WP_033567258.1|3326683_3328180_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	Q8HAC5	Salmonella_phage	99.4	3.0e-277
WP_000515953.1|3328179_3328536_+|tail	phage tail tube protein	tail	A0A192Y8K0	Salmonella_phage	99.2	1.3e-61
WP_000588852.1|3328532_3328859_+|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000785381.1|3328943_3330869_+|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	97.3	0.0e+00
WP_001033736.1|3330885_3331335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033567259.1|3331394_3332735_+	DNA circularization N-terminal domain-containing protein	NA	A0A192Y5U9	Salmonella_phage	99.3	9.7e-251
WP_001066632.1|3332731_3333790_+|plate	baseplate protein	plate	A0A192Y7L7	Salmonella_phage	99.7	3.0e-202
WP_001273649.1|3333789_3334323_+|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	100.0	1.4e-96
WP_000605055.1|3334327_3334741_+	phage GP46 family protein	NA	A0A192Y6D0	Salmonella_phage	99.3	1.2e-74
WP_000785581.1|3334733_3335813_+|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	99.2	7.2e-204
WP_001207832.1|3335815_3336403_+	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_000554735.1|3336389_3337952_+	hypothetical protein	NA	A0A192Y7M1	Salmonella_phage	98.5	1.7e-283
WP_022742744.1|3337921_3338527_+|tail	tail fiber assembly protein	tail	A0A192Y8L2	Salmonella_phage	100.0	2.7e-107
WP_000836773.1|3338640_3338874_-	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	100.0	1.2e-36
WP_122815478.1|3338948_3339062_-	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	100.0	4.3e-11
WP_000842532.1|3339109_3339523_-	hypothetical protein	NA	A0A192Y6F0	Salmonella_phage	100.0	2.9e-73
WP_001093793.1|3339519_3339732_-	hypothetical protein	NA	A0A192Y5V6	Salmonella_phage	100.0	2.7e-30
WP_000500831.1|3340925_3341087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394196.1|3341213_3341633_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457662.1|3341635_3342904_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000208509.1|3343358_3343571_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|3343581_3343770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080680.1|3344030_3345227_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
WP_000107430.1|3345876_3346176_+	membrane protein	NA	NA	NA	NA	NA
WP_000377041.1|3346267_3346963_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_001157322.1|3347036_3348467_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 10
NZ_LN999997	Salmonella enterica subsp. enterica serovar Typhimurium isolate SO4698-09 chromosome I	5037238	3452511	3459320	5037238	tail,integrase	Salmonella_phage(33.33%)	11	3454721:3454743	3464436:3464458
WP_000856224.1|3452511_3452742_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
WP_000168393.1|3452879_3453254_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000979702.1|3453254_3454130_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000722368.1|3454146_3454500_+	YebY family protein	NA	NA	NA	NA	NA
3454721:3454743	attL	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
WP_001520095.1|3454873_3455728_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.6e-73
WP_010989030.1|3455787_3456282_-	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
WP_001013467.1|3456471_3456702_+	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_001050882.1|3456755_3457289_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
WP_000789530.1|3457545_3457713_-	lytic enzyme	NA	NA	NA	NA	NA
WP_001521334.1|3457777_3457966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000275418.1|3458438_3459320_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
3464436:3464458	attR	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
>prophage 11
NZ_LN999997	Salmonella enterica subsp. enterica serovar Typhimurium isolate SO4698-09 chromosome I	5037238	4246403	4337320	5037238	holin,protease,tRNA,tail,terminase,lysis	Salmonella_phage(58.7%)	91	NA	NA
WP_000938191.1|4246403_4247084_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
WP_000374050.1|4247704_4248364_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000904446.1|4248450_4248780_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|4248776_4249058_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548082.1|4249106_4249886_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000859419.1|4249911_4250460_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140480.1|4250674_4251886_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|4251943_4252261_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_001537782.1|4252305_4252719_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847719.1|4252892_4253555_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|4253649_4254108_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420505.1|4254143_4256198_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_001261222.1|4256321_4256768_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950880.1|4256786_4258940_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|4258926_4259532_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288732.1|4259748_4260258_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001674965.1|4260614_4261667_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|4261738_4262191_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156454.1|4262376_4264137_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|4264205_4264724_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|4264823_4264991_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_033567177.1|4265246_4265810_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433414.1|4265806_4267447_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333152.1|4267451_4268705_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|4268719_4270627_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_001086485.1|4270639_4272748_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224069.1|4272846_4273956_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001220671.1|4273952_4274495_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|4274660_4275671_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193784.1|4275878_4278491_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000497441.1|4278917_4279109_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_001525490.1|4279379_4280066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031603423.1|4280050_4280350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000334547.1|4280418_4281045_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001674638.1|4281692_4282661_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.4	3.0e-193
WP_000143167.1|4283136_4283718_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_031247858.1|4283717_4286156_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	63.8	7.5e-92
WP_000178849.1|4286209_4286452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001541993.1|4286490_4287366_-	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	77.1	1.1e-48
WP_001576012.1|4289912_4290617_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	63.1	2.4e-67
WP_000606351.1|4290514_4291252_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_001152415.1|4291261_4291957_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000877926.1|4292046_4292580_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_000725267.1|4292696_4293194_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_020899435.1|4293293_4293626_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	4.4e-35
WP_000867564.1|4294746_4295292_-|terminase	terminase small subunit	terminase	K7P7G0	Enterobacteria_phage	61.3	4.5e-53
WP_024143045.1|4295760_4296207_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	90.4	1.2e-64
WP_000984584.1|4296224_4296677_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.0	7.9e-80
WP_077248428.1|4296660_4296990_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	99.1	2.9e-55
WP_001141973.1|4297265_4297952_+|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_000798705.1|4298312_4298762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|4298897_4299023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097242.1|4299217_4299907_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	50.6	1.1e-59
WP_000801757.1|4299903_4300044_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001096542.1|4300040_4300652_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	98.0	2.7e-91
WP_000929788.1|4300860_4301463_-	DUF1367 family protein	NA	A0A0M4QX23	Salmonella_phage	99.0	7.5e-110
WP_000763780.1|4301547_4301769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000861985.1|4301878_4302112_-	DinI-like family protein	NA	A0A0M4REN2	Salmonella_phage	87.0	1.2e-31
WP_022630855.1|4302703_4303300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000493384.1|4303311_4304289_+	DUF4868 domain-containing protein	NA	NA	NA	NA	NA
WP_001536080.1|4304343_4304601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208142.1|4304600_4305245_-	hypothetical protein	NA	H6WRY2	Salmonella_phage	40.7	1.8e-29
WP_000850457.1|4305248_4305557_-	hypothetical protein	NA	A0A1P8DTP0	Salmonella_phage	69.3	1.8e-30
WP_000065109.1|4305560_4306019_-	ead/Ea22-like family protein	NA	S4TNP2	Salmonella_phage	77.4	7.1e-44
WP_020899441.1|4306015_4306363_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	90.4	1.8e-52
WP_000800012.1|4306373_4307123_-	ATP-binding protein	NA	S4TNF5	Salmonella_phage	100.0	4.3e-139
WP_000062943.1|4307125_4308109_-	replication protein	NA	H6WRX7	Salmonella_phage	99.3	2.1e-162
WP_000426364.1|4308193_4308514_-	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	100.0	1.3e-52
WP_001555460.1|4308548_4308776_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	45.9	1.7e-14
WP_000981510.1|4308881_4309316_+	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	38.2	2.5e-14
WP_000917559.1|4309612_4309744_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	97.7	1.2e-17
WP_023139985.1|4309792_4310143_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	94.0	3.5e-59
WP_020899444.1|4310269_4313470_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	S4TNL0	Salmonella_phage	78.8	0.0e+00
WP_014344386.1|4313432_4314590_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.7	7.9e-217
WP_001237031.1|4314632_4314872_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_000065276.1|4314912_4315161_+	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_020899445.1|4315205_4316498_+	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	99.8	4.5e-253
WP_000191399.1|4316692_4317895_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000893207.1|4317972_4319409_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000544849.1|4319653_4320868_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000762342.1|4321184_4321646_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000117870.1|4321846_4323247_+|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000977713.1|4323853_4324945_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
WP_000462653.1|4325129_4326320_+	aspartate transaminase	NA	NA	NA	NA	NA
WP_001109471.1|4326381_4327029_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000357052.1|4327056_4327605_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_000925872.1|4327864_4329706_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000572724.1|4330050_4334517_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_000060025.1|4334516_4335221_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_051120049.1|4335201_4336524_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001154025.1|4336516_4337320_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
>prophage 12
NZ_LN999997	Salmonella enterica subsp. enterica serovar Typhimurium isolate SO4698-09 chromosome I	5037238	4387383	4396115	5037238	protease,transposase	Enterobacteria_phage(14.29%)	7	NA	NA
WP_085983316.1|4387383_4388638_+|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
WP_000502119.1|4389101_4389560_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_000934063.1|4389751_4392028_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|4392058_4392379_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|4392702_4392924_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125877.1|4393053_4395000_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_001201751.1|4394996_4396115_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
>prophage 13
NZ_LN999997	Salmonella enterica subsp. enterica serovar Typhimurium isolate SO4698-09 chromosome I	5037238	5014685	5036098	5037238	plate,tail,integrase	Shigella_phage(55.56%)	26	5012402:5012415	5033397:5033410
5012402:5012415	attL	CATAATCATCCCTT	NA	NA	NA	NA
WP_001529722.1|5014685_5017037_-	toprim domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	48.5	6.8e-74
WP_001529721.1|5017049_5017652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000181940.1|5017644_5017866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024675.1|5017862_5018126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001065738.1|5018122_5018317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032150717.1|5018309_5019338_-	ash family protein	NA	Q8W643	Enterobacteria_phage	53.3	1.0e-13
WP_000476150.1|5019331_5019514_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_033567214.1|5019506_5020340_-	antA/AntB antirepressor family protein	NA	G9L6G1	Escherichia_phage	47.5	9.0e-21
WP_001529719.1|5020352_5020784_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	49.0	3.9e-28
WP_000035054.1|5020783_5020987_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	50.9	4.7e-08
WP_001529718.1|5021415_5022630_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.5	9.7e-133
WP_032214357.1|5023347_5023680_-	FlxA-like family protein	NA	NA	NA	NA	NA
WP_000639149.1|5024309_5024873_-	recombinase family protein	NA	K7PJT4	Enterobacteria_phage	79.1	3.4e-80
WP_000161707.1|5025397_5026120_+	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
WP_000006335.1|5026316_5026724_-|tail	tail fiber assembly protein	tail	A0A1B0V844	Salmonella_phage	84.2	1.8e-59
WP_022630973.1|5026730_5027813_-	hypothetical protein	NA	U5P0I1	Shigella_phage	96.2	1.9e-50
WP_000383548.1|5027816_5028401_-	YmfQ family protein	NA	O22003	Shigella_phage	100.0	1.1e-113
WP_022630974.1|5028391_5029450_-|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	98.6	5.2e-199
WP_000424732.1|5029436_5029862_-	phage GP46 family protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_022630975.1|5029861_5030410_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	97.8	1.9e-96
WP_000999499.1|5030409_5031489_-|plate	baseplate protein	plate	Q8SBG7	Shigella_phage	99.7	5.3e-207
WP_000219913.1|5031485_5032814_-	DNA circularization N-terminal domain-containing protein	NA	Q8SBG8	Shigella_phage	99.3	8.4e-247
WP_001439754.1|5032904_5033417_-	hypothetical protein	NA	NA	NA	NA	NA
5033397:5033410	attR	CATAATCATCCCTT	NA	NA	NA	NA
WP_023200330.1|5033498_5035331_-|tail	phage tail tape measure protein	tail	S5FM63	Shigella_phage	99.2	4.7e-304
WP_000661047.1|5035472_5035742_-|tail	phage tail assembly protein	tail	S5FNR3	Shigella_phage	100.0	3.5e-43
WP_000090998.1|5035741_5036098_-|tail	phage tail tube protein	tail	U5P076	Shigella_phage	100.0	5.3e-63
