The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014139	Streptococcus pyogenes strain MEW123 chromosome, complete genome	1878699	36548	48861	1878699		Synechococcus_phage(28.57%)	8	NA	NA
WP_002987703.1|36548_40274_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	26.3	1.1e-38
WP_060383921.1|40434_41889_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.7	3.7e-54
WP_011284404.1|41916_42939_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	R9TMC7	Synechococcus_phage	42.1	2.4e-63
WP_002987709.1|43106_43661_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.6	6.8e-25
WP_002987711.1|43844_45392_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	E3SNU8	Prochlorococcus_phage	52.4	3.4e-45
WP_002987712.1|45449_46574_-	CHAP domain-containing protein	NA	F8HGP2	Streptococcus_phage	28.6	7.7e-07
WP_021340857.1|46826_48092_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_002987716.1|48369_48861_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.3	3.2e-18
>prophage 2
NZ_CP014139	Streptococcus pyogenes strain MEW123 chromosome, complete genome	1878699	839606	895556	1878699	tail,head,integrase,terminase	Streptococcus_phage(45.45%)	68	842973:843032	889140:889235
WP_011284887.1|839606_841871_+	glycogen/starch/alpha-glucan family phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	43.7	1.2e-11
WP_002989605.1|842127_842748_-	DUF3862 domain-containing protein	NA	NA	NA	NA	NA
842973:843032	attL	AACTCATGAACAAGACAAAAAGAAAAAACCTTGATGTAACAAGGTTTTAGTAAGTTATGA	NA	NA	NA	NA
WP_023079773.1|843110_844199_-|integrase	site-specific integrase	integrase	Q38159	Streptococcus_phage	98.6	3.0e-202
WP_002984270.1|844448_845258_-	MazF family toxin-antitoxin system	NA	J7KDP1	Streptococcus_phage	35.8	3.8e-24
WP_011284884.1|845270_846014_-	helix-turn-helix domain-containing protein	NA	A0A1S5S8T5	Streptococcus_phage	62.9	2.5e-75
WP_021341080.1|846505_846721_-	hypothetical protein	NA	J7KBX0	Streptococcus_phage	95.7	2.5e-28
WP_011284882.1|846966_847566_-	hypothetical protein	NA	A0A097PAT4	Streptococcus_pyogenes_phage	100.0	3.1e-108
WP_011284881.1|847619_847829_+	hypothetical protein	NA	A0A097PAQ9	Streptococcus_pyogenes_phage	100.0	1.7e-32
WP_011054589.1|847817_848204_-	hypothetical protein	NA	A0A097PAT1	Streptococcus_pyogenes_phage	100.0	1.2e-65
WP_002984281.1|848277_848505_+	hypothetical protein	NA	A0A141E1R7	Streptococcus_phage	57.3	2.9e-14
WP_011017884.1|848612_849122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002984292.1|849380_849590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011284879.1|849739_849979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011054585.1|850145_850331_+	helix-turn-helix transcriptional regulator	NA	A0A1X9I6I3	Streptococcus_phage	72.1	3.3e-16
WP_011017882.1|850409_850706_+	hypothetical protein	NA	A0A097PAT8	Streptococcus_pyogenes_phage	98.0	3.1e-48
WP_011284878.1|850920_851250_+	hypothetical protein	NA	J7KBZ0	Streptococcus_phage	41.8	7.9e-13
WP_002984315.1|851249_851444_+	hypothetical protein	NA	J7KK69	Streptococcus_phage	54.2	3.9e-12
WP_011284877.1|851440_851725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002984321.1|851721_852405_+	AAA family ATPase	NA	J7KC09	Streptococcus_phage	99.1	9.4e-125
WP_075340263.1|852440_853844_+	DEAD/DEAH box helicase	NA	A0A1P8BMH7	Lactococcus_phage	72.3	2.3e-194
WP_002984328.1|853848_854331_+	DUF669 domain-containing protein	NA	A0A1P8BM40	Lactococcus_phage	70.7	9.7e-60
WP_011284875.1|854348_855902_+	hypothetical protein	NA	A0A1P8BM51	Lactococcus_phage	70.6	5.7e-210
WP_014635521.1|856169_857039_+	hypothetical protein	NA	A0A1P8BME8	Lactococcus_phage	65.6	5.8e-103
WP_023079767.1|856992_857343_+	VRR-NUC domain-containing protein	NA	A0A1P8VVL5	Streptococcus_phage	88.5	9.9e-46
WP_011284873.1|857326_857683_+	hypothetical protein	NA	A0A097PAU4	Streptococcus_pyogenes_phage	100.0	2.9e-61
WP_002995955.1|857924_858161_+	DUF3310 domain-containing protein	NA	A0A097PAQ7	Streptococcus_pyogenes_phage	100.0	2.4e-40
WP_011284869.1|858324_858609_+	hypothetical protein	NA	A0A097PAV1	Streptococcus_pyogenes_phage	86.2	2.6e-36
WP_011888685.1|858610_859243_+	SAM-dependent DNA methyltransferase	NA	L0P368	Streptococcus_phage	68.6	5.1e-85
WP_011888686.1|859247_859727_+	DUF1642 domain-containing protein	NA	A0A141E0J6	Streptococcus_phage	41.9	6.5e-24
WP_011284866.1|860175_860610_+	ArpU family transcriptional regulator	NA	J7KDQ1	Streptococcus_phage	97.9	6.2e-74
WP_011284864.1|861187_862102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002990048.1|862191_862404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002987543.1|862719_863097_-	HicB family protein	NA	I3NLB2	Bifidobacterium_phage	44.0	3.3e-15
WP_001132273.1|863148_863334_-	addiction module toxin, HicA family	NA	D6PSW1	Lactobacillus_phage	54.0	1.7e-09
WP_044564892.1|863396_863864_+|terminase	terminase small subunit	terminase	A0A141E1Y3	Streptococcus_phage	70.8	1.1e-52
WP_020833530.1|863841_865149_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2H4IYR5	uncultured_Caudovirales_phage	75.7	2.0e-184
WP_011284860.1|866642_868205_+|head	phage head morphogenesis protein	head	U6E9F1	Streptococcus_phage	44.2	2.5e-48
WP_002988389.1|868208_868394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011284859.1|868463_868778_+	hypothetical protein	NA	M1PLI3	Streptococcus_phage	72.8	6.8e-38
WP_011284858.1|868780_869047_+	hypothetical protein	NA	A0A097PAR8	Streptococcus_pyogenes_phage	70.5	1.9e-25
WP_023079765.1|869190_869724_+	DUF4355 domain-containing protein	NA	A0A141E0S7	Streptococcus_phage	80.7	6.8e-14
WP_011284856.1|869733_870114_+|head	head decoration protein	head	A0A0K2CNR0	Brevibacillus_phage	32.5	1.8e-05
WP_011284855.1|870116_871199_+	hypothetical protein	NA	A0A2H4J022	uncultured_Caudovirales_phage	57.1	3.4e-105
WP_011284854.1|871208_871451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002984392.1|871464_871818_+	hypothetical protein	NA	A0A2H4J002	uncultured_Caudovirales_phage	49.6	9.7e-25
WP_011284852.1|871814_872123_+	hypothetical protein	NA	A0A2P1JTW8	Anoxybacillus_phage	40.2	7.4e-13
WP_030126607.1|872103_872469_+	HK97 gp10 family phage protein	NA	A0A097BY98	Enterococcus_phage	46.3	5.9e-17
WP_030126608.1|872908_873532_+|tail	phage major tail protein, TP901-1 family	tail	D7RWD5	Brochothrix_phage	50.5	3.2e-39
WP_002990023.1|873585_873939_+	hypothetical protein	NA	Q77RZ7	Lactococcus_phage	48.6	5.5e-20
WP_021340179.1|874013_874310_+	hypothetical protein	NA	A0A0S2MYH1	Enterococcus_phage	42.2	1.3e-09
WP_011284846.1|874324_877960_+	tape measure protein	NA	C5IUK3	Streptococcus_phage	41.4	1.2e-85
WP_011284845.1|877991_878771_+	hypothetical protein	NA	A3F655	Streptococcus_phage	54.0	1.9e-65
WP_011284844.1|878767_880822_+	hypothetical protein	NA	A3F656	Streptococcus_phage	84.1	0.0e+00
WP_011284843.1|880818_882033_+	hypothetical protein	NA	A3F657	Streptococcus_phage	49.5	5.0e-44
WP_021340983.1|882034_882349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011284841.1|882359_884255_+	hypothetical protein	NA	Q938J9	Temperate_phage	52.5	5.9e-76
WP_011284840.1|884432_885050_+	hypothetical protein	NA	A3F662	Streptococcus_phage	94.6	9.8e-89
WP_002990012.1|885060_885357_+	hypothetical protein	NA	Q938J6	Temperate_phage	98.0	3.7e-46
WP_011284839.1|885353_885539_+	hypothetical protein	NA	Q938J5	Temperate_phage	96.7	6.6e-25
WP_011284838.1|885650_886985_+	lysin	NA	Q5MY96	Streptococcus_phage	93.0	1.3e-247
WP_002985327.1|887060_887768_-	streptococcal pyrogenic exotoxin SpeC	NA	A0A097PAT7	Streptococcus_pyogenes_phage	27.1	3.9e-09
WP_011184727.1|887878_888637_-	DNase Mf2	NA	NA	NA	NA	NA
WP_002993136.1|888876_889065_+	hypothetical protein	NA	A3F673	Streptococcus_phage	76.3	2.1e-18
WP_002989607.1|889655_890270_+	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	52.3	6.2e-51
889140:889235	attR	AACTCATGAACAAGACAAAAAGAAAAAACCTTGATGTAACAAGGTTTTAGTAAGTTATGATTACTTACGGTAAGCATTGATGGAGCTGGTGGGAGT	NA	NA	NA	NA
WP_002984433.1|890396_891182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002984437.1|891191_891890_-	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	27.3	6.6e-09
WP_002989617.1|891889_892261_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011284836.1|892445_895556_+	DNA polymerase III subunit alpha	NA	A0A2L1IZ23	Streptomyces_phage	29.7	5.4e-119
>prophage 3
NZ_CP014139	Streptococcus pyogenes strain MEW123 chromosome, complete genome	1878699	1476776	1538091	1878699	protease,tRNA,bacteriocin	Streptococcus_phage(33.33%)	60	NA	NA
WP_002985729.1|1476776_1476977_-|bacteriocin	class IIb bacteriocin, lactobin A/cerein 7B family	bacteriocin	NA	NA	NA	NA
WP_002992018.1|1476989_1477217_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_002987564.1|1478411_1478594_-|bacteriocin	class IIb bacteriocin, lactobin A/cerein 7B family	bacteriocin	NA	NA	NA	NA
WP_011284576.1|1478608_1478842_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_011184258.1|1479239_1479494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002985741.1|1479799_1480276_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_002985743.1|1480295_1481192_-	GTPase Era	NA	NA	NA	NA	NA
WP_002985746.1|1481311_1481719_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_021340735.1|1481699_1482197_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_011284574.1|1482355_1482931_-	uracil-DNA glycosylase family protein	NA	NA	NA	NA	NA
WP_010921967.1|1482976_1484029_-	PhoH family protein	NA	W8D063	Erwinia_phage	50.0	1.2e-46
WP_023079722.1|1484187_1485960_-	oleate hydratase	NA	NA	NA	NA	NA
WP_011284572.1|1486274_1487456_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0E3XB61	Gordonia_phage	39.6	2.1e-15
WP_021340760.1|1487611_1487827_-	YozE family protein	NA	NA	NA	NA	NA
WP_011284570.1|1487823_1488333_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_011284568.1|1489370_1489928_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_002985765.1|1489956_1490685_-	UMP kinase	NA	NA	NA	NA	NA
WP_002985768.1|1491006_1491696_-	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_002990800.1|1491801_1492227_-	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_002990803.1|1492470_1492824_+	DUF3397 domain-containing protein	NA	NA	NA	NA	NA
WP_011284566.1|1492893_1495299_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	51.4	2.2e-88
WP_002985776.1|1495515_1496322_+	peptidylprolyl isomerase	NA	A0A2H4UTF4	Bodo_saltans_virus	36.6	1.5e-20
WP_002990814.1|1496468_1497323_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_002985780.1|1497323_1498049_-	metal ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	32.6	1.4e-17
WP_004218965.1|1498112_1499045_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002990820.1|1499189_1499837_+	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_011284563.1|1499935_1500277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011284562.1|1500427_1501123_-	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_021340729.1|1501142_1501394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011184238.1|1501393_1501948_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_011284560.1|1501978_1503361_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L4K9	Tupanvirus	36.0	8.5e-32
WP_002993065.1|1503533_1504871_-	MFS transporter	NA	NA	NA	NA	NA
WP_021340734.1|1505203_1506163_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_011284557.1|1506238_1506937_-	3-oxoacyl-ACP reductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	25.2	1.2e-10
WP_021340747.1|1506929_1507166_-	DUF2829 domain-containing protein	NA	NA	NA	NA	NA
WP_011284555.1|1507825_1508407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021340726.1|1509094_1509232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011284554.1|1509433_1510132_+	streptococcal pyrogenic exotoxin SpeJ	NA	NA	NA	NA	NA
WP_011284552.1|1510399_1510900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021340750.1|1511272_1511524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060383955.1|1511910_1512249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021340731.1|1514263_1514716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021340763.1|1515172_1515925_+	ADP-ribosyltransferase	NA	NA	NA	NA	NA
WP_011054229.1|1516129_1518310_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	43.2	1.2e-170
WP_011284545.1|1518276_1518765_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	R4JF54	Bacillus_phage	37.5	1.3e-11
WP_011284544.1|1518768_1519782_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	52.7	1.6e-96
WP_021340738.1|1520272_1522270_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	35.0	1.1e-85
WP_011284541.1|1522512_1523220_-	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
WP_011284539.1|1523991_1528929_-|protease	CXC chemokine-degrading serine protease SpyCEP	protease	NA	NA	NA	NA
WP_021340918.1|1529194_1530376_-	L-lactate oxidase	NA	NA	NA	NA	NA
WP_021340916.1|1530609_1531437_+	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	79.9	1.7e-128
WP_011284536.1|1531510_1531867_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	65.8	6.3e-40
WP_011284535.1|1532164_1532794_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_002985833.1|1532840_1533233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002985836.1|1533259_1534123_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	75.0	1.7e-115
WP_002985838.1|1534127_1534451_-	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	59.4	1.3e-28
WP_002985844.1|1534953_1535829_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	46.6	2.1e-68
WP_002990917.1|1535846_1536482_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	63.4	2.7e-65
WP_011284533.1|1536730_1537006_-	YlbG family protein	NA	NA	NA	NA	NA
WP_011284532.1|1537500_1538091_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	55.7	2.6e-54
>prophage 4
NZ_CP014139	Streptococcus pyogenes strain MEW123 chromosome, complete genome	1878699	1831790	1838623	1878699	integrase	Streptococcus_phage(83.33%)	11	1831364:1831378	1838925:1838939
1831364:1831378	attL	AATCCTTGAAGCTGT	NA	NA	NA	NA
WP_000694580.1|1831790_1831964_-	hypothetical protein	NA	A0A1X9I5U0	Streptococcus_phage	59.6	1.9e-10
WP_011285313.1|1832250_1833864_-	hypothetical protein	NA	A0A1P8BMF9	Lactococcus_phage	53.1	2.4e-147
WP_011285314.1|1833853_1834375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011285315.1|1834384_1834753_-	hypothetical protein	NA	A0A1X9I6M4	Streptococcus_phage	47.1	2.6e-12
WP_021340713.1|1834661_1834853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011285317.1|1834852_1835185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011285318.1|1835196_1835379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014407970.1|1835599_1835842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011285321.1|1836479_1836668_-	helix-turn-helix transcriptional regulator	NA	A0A1X9I5U7	Streptococcus_phage	59.7	1.7e-12
WP_011285322.1|1836836_1837280_+	helix-turn-helix transcriptional regulator	NA	A0A1X9I723	Streptococcus_phage	48.6	1.8e-07
WP_011285323.1|1837459_1838623_+|integrase	site-specific integrase	integrase	A0A1X9I6A9	Streptococcus_phage	70.5	2.8e-161
1838925:1838939	attR	ACAGCTTCAAGGATT	NA	NA	NA	NA
