The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013975	Piscirickettsia salmonis strain CGR02, complete genome	3205229	3456	56568	3205229	tRNA,transposase	Escherichia_phage(28.57%)	54	NA	NA
WP_017378478.1|3456_4836_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_017378479.1|4950_6843_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_017378480.1|6890_7517_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_017378481.1|7536_8421_+	ParA family protein	NA	Q8JL10	Natrialba_phage	28.4	5.8e-18
WP_027242747.1|8453_9344_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	31.8	6.7e-14
WP_017378483.1|9458_9857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378484.1|9861_10677_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_016209328.1|10728_11133_+	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_017378485.1|11187_11658_+	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_017378486.1|11669_12197_+	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_017378487.1|12213_13755_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_027242748.1|13780_14641_+	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_016209339.1|14671_16063_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_017378489.1|16087_16516_+	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_027242749.1|16609_17974_+	UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	40.9	3.9e-37
WP_027242750.1|18030_19866_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.7	5.8e-121
WP_036773290.1|19979_20708_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.2	2.3e-44
WP_027242751.1|21234_22776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378498.1|23042_23699_-	2OG-Fe dioxygenase family protein	NA	NA	NA	NA	NA
WP_048876081.1|24396_25056_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_017376300.1|25200_25458_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075275376.1|25570_26323_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_017376303.1|26381_27095_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	36.0	2.2e-28
WP_027242752.1|27286_27919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|29653_31057_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046628.1|31053_31278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771332.1|31357_32332_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	7.3e-30
WP_036815787.1|32351_32669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376724.1|32746_32959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063559.1|33205_33625_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_036816796.1|33722_34169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242563.1|34513_35512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929590.1|35544_35898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929591.1|35942_36215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376728.1|36611_38030_-	MFS transporter	NA	NA	NA	NA	NA
WP_017376729.1|38256_39198_+	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_026063560.1|39232_41212_+	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_027242562.1|41208_41814_+	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_016211294.1|41815_42157_+	prokaryotic cytochrome C oxidase subunit IV family protein	NA	NA	NA	NA	NA
WP_027242561.1|42157_42994_+	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_080963573.1|43159_43477_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_027242560.1|43554_44976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376735.1|44972_45668_-	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_047927112.1|45831_46158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420744.1|46854_47700_+	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_017376738.1|47709_48048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876080.1|48616_50020_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420590.1|50052_50997_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275257.1|51189_51375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876079.1|51982_53032_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275379.1|53186_53405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|53724_55128_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048876179.1|55138_55696_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772663.1|55692_56568_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP013975	Piscirickettsia salmonis strain CGR02, complete genome	3205229	185958	322960	3205229	tRNA,protease,transposase,tail	Acinetobacter_phage(11.11%)	120	NA	NA
WP_048876075.1|185958_187095_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375625.1|187134_187362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053063431.1|187358_188024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377597.1|188248_188455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377599.1|188548_189643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377600.1|189708_190290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377601.1|190530_190974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377602.1|191028_191286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377603.1|191263_191890_+	23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE	NA	NA	NA	NA	NA
WP_017377604.1|191967_193950_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G9E4U6	Ostreococcus_lucimarinus_virus	41.1	1.0e-115
WP_017377605.1|194159_195503_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_017377606.1|195769_198439_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_017377607.1|198462_200379_+	pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_026063653.1|200548_201970_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.1	3.1e-45
WP_017377609.1|202114_203089_+	phospholipase A	NA	NA	NA	NA	NA
WP_027242692.1|203098_203398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377612.1|203515_203737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377613.1|203900_205562_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	64.5	7.7e-181
WP_016209850.1|205634_205925_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	42.6	3.3e-15
WP_017377614.1|206151_206607_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_017377615.1|206671_207136_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_027242691.1|207227_208574_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_017377618.1|208573_209479_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_017377619.1|209540_210527_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_016209851.1|210519_210762_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_017377620.1|210880_212425_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	46.9	1.6e-63
WP_017377621.1|212471_213758_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_017377622.1|213800_215204_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_144420750.1|215208_217746_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_144420593.1|218142_218391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963589.1|218322_218784_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_017377624.1|219278_219974_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_080963590.1|220075_221638_-	APC family permease	NA	NA	NA	NA	NA
WP_017377626.1|221965_223759_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	41.0	2.2e-117
WP_017377627.1|223845_224118_+	DUF615 domain-containing protein	NA	NA	NA	NA	NA
WP_017377628.1|224123_224750_+	DUF938 domain-containing protein	NA	NA	NA	NA	NA
WP_017377629.1|224736_226167_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_017377630.1|226488_227544_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	34.7	5.1e-29
WP_017377631.1|227512_228190_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017377632.1|228179_229028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210080.1|229173_229467_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_036772063.1|229578_230391_-	trfA family protein	NA	NA	NA	NA	NA
WP_017377635.1|230689_231544_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_017377636.1|231697_232747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377637.1|232792_233449_-	DedA family protein	NA	NA	NA	NA	NA
WP_017377638.1|233466_234747_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_017377639.1|235020_236382_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_036772069.1|236442_236994_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_017376225.1|242424_243696_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_017376226.1|243752_244736_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_027243088.1|244732_245518_+	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_017376227.1|245825_246275_-	DUF1499 domain-containing protein	NA	NA	NA	NA	NA
WP_048876031.1|246368_247772_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376228.1|248209_249691_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	5.3e-48
WP_017376229.1|249746_250856_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.8	1.7e-35
WP_017376234.1|252428_252641_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_027243087.1|252681_253377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376236.1|256238_256805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243085.1|256962_257523_+	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_053856766.1|257642_259046_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875886.1|259042_259399_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_017376838.1|259654_260479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243084.1|261176_261701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|261986_262961_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_027243083.1|263060_263612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999961.1|263724_264378_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_144420594.1|264629_266087_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420595.1|266200_266680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376842.1|266917_267523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376843.1|267802_268918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963586.1|268856_269543_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_027243079.1|269536_270514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376846.1|270548_271712_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_027243078.1|272051_272276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210632.1|272658_272946_-	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_017376847.1|273120_273876_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_036774056.1|273908_274340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376849.1|274315_274792_+	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376850.1|274798_276376_+	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	31.4	3.6e-10
WP_017376851.1|276378_277143_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_017376852.1|277196_277733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376853.1|277729_278461_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_027243077.1|278685_279447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875887.1|279772_280648_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378284.1|282050_282206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963635.1|282399_284109_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017375924.1|284762_285071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420596.1|285088_287281_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	44.9	3.5e-141
WP_069971668.1|288088_288337_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	56.1	2.9e-07
WP_017375921.1|288449_288683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375920.1|288917_289448_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_017375919.1|289452_290166_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_144420751.1|290793_291519_+	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_048875888.1|291527_293591_+	serine/threonine protein kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	28.0	3.9e-17
WP_027243033.1|293770_294250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062312049.1|294742_296110_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376531.1|296501_297299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243034.1|297410_298700_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_144420597.1|298880_299867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376534.1|299983_300163_+	rubredoxin	NA	NA	NA	NA	NA
WP_017376535.1|300174_300606_-	protoporphyrinogen oxidase HemJ	NA	NA	NA	NA	NA
WP_017376536.1|300818_301178_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.5	4.4e-25
WP_017376537.1|301347_302973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999962.1|303696_305124_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376538.1|305417_306599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243035.1|309201_310500_-	MFS transporter	NA	NA	NA	NA	NA
WP_144420752.1|310855_311749_+	DNA polymerase III subunit delta'	NA	S5WKH4	Pseudomonas_phage	33.8	2.3e-14
WP_047927468.1|311745_312051_+	pilus assembly protein PilZ	NA	NA	NA	NA	NA
WP_017376543.1|312076_312856_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_144420598.1|312885_313116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210862.1|313267_313513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376547.1|313699_314491_+	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_017376548.1|315190_315913_+	putative N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_017376549.1|315909_316791_+	ROK family protein	NA	NA	NA	NA	NA
WP_027243038.1|316814_318305_+	sodium:solute symporter	NA	A0A219Y9P9	Aeromonas_phage	23.8	8.0e-20
WP_027243039.1|318394_319282_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_017376551.1|319954_320446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375625.1|320450_320678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|320770_321745_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_069971669.1|321721_322960_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP013975	Piscirickettsia salmonis strain CGR02, complete genome	3205229	330926	384340	3205229	transposase	Staphylococcus_phage(57.14%)	49	NA	NA
WP_053856767.1|330926_332330_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420600.1|332435_332621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053856766.1|333319_334723_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999963.1|334813_335317_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771639.1|335356_336331_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017376774.1|336327_336897_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	40.3	4.5e-32
WP_017376776.1|337383_338076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420601.1|338683_339676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376778.1|339665_341438_+	single-stranded-DNA-specific exonuclease RecJ	NA	NA	NA	NA	NA
WP_080963634.1|341438_341627_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_036774259.1|341664_342639_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036815640.1|342697_342892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375625.1|342958_343186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971671.1|343315_344191_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155046623.1|344418_344568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420602.1|344559_344826_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420603.1|344970_345870_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046619.1|345956_346214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243075.1|346826_348053_+	cysteine desulfurase-like protein	NA	NA	NA	NA	NA
WP_027243074.1|348142_348682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243073.1|348803_349442_-	MFS transporter	NA	NA	NA	NA	NA
WP_075275265.1|349475_349964_-	VUT family protein	NA	NA	NA	NA	NA
WP_144420604.1|350210_350513_-	VUT family protein	NA	NA	NA	NA	NA
WP_036772686.1|350493_350982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963628.1|351552_352851_-	MFS transporter	NA	NA	NA	NA	NA
WP_017378171.1|352967_353258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420605.1|353296_355951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243070.1|356664_356919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062365658.1|357228_357957_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.2	8.7e-44
WP_017377650.1|358727_359912_+	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_017377649.1|359930_360875_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_027243069.1|361180_361966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377647.1|362079_362448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377646.1|362676_364254_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_144420753.1|365037_369462_+	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_065653746.1|369598_371122_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017377643.1|371326_371554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377642.1|371698_371956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772743.1|372523_373495_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_144420754.1|373419_373728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772729.1|373791_374013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|374132_375107_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036771744.1|375160_376132_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771639.1|376211_377186_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_027242739.1|377546_380216_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	24.5	5.5e-19
WP_036774478.1|380386_381268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378307.1|381278_381935_-	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_017378308.1|382001_382706_-	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_048876031.1|382936_384340_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP013975	Piscirickettsia salmonis strain CGR02, complete genome	3205229	441343	563731	3205229	tRNA,transposase	Staphylococcus_phage(25.0%)	107	NA	NA
WP_048875895.1|441343_442507_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.0	3.8e-25
WP_144420756.1|442560_443562_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_017378362.1|443643_444213_+	elongation factor P	NA	NA	NA	NA	NA
WP_144420608.1|444426_445398_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A1V0SAC0	Catovirus	25.9	7.3e-22
WP_017378364.1|445409_447005_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_017378367.1|448389_449493_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_017378368.1|449604_450789_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_017378369.1|450866_452855_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_155046621.1|453305_453527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420609.1|454014_455388_+	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_017378374.1|455405_456392_+	UDP-N-acetylglucosamine 4,6-dehydratase (inverting)	NA	K7Y9E1	Megavirus	34.2	2.2e-42
WP_080963622.1|456394_457549_+	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2D2W2B8	Stenotrophomonas_phage	28.2	2.3e-14
WP_017378376.1|457545_458241_+	pseudaminic acid cytidylyltransferase	NA	A0A1B1IVD3	uncultured_Mediterranean_phage	32.3	8.6e-09
WP_017378377.1|458383_459874_+	UDP-2,4-diacetamido-2,4, 6-trideoxy-beta-L-altropyranose hydrolase	NA	NA	NA	NA	NA
WP_017378378.1|459894_460944_+	pseudaminic acid synthase	NA	NA	NA	NA	NA
WP_027242727.1|461010_462405_-	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_017378381.1|463337_465269_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.0	3.1e-117
WP_075273353.1|465273_465804_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.9	4.7e-15
WP_017378382.1|465838_466033_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_016210495.1|466075_466435_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_017378383.1|466566_467562_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	36.5	3.2e-33
WP_017378384.1|467574_469956_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211707.1|469961_470249_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	33.7	3.0e-08
WP_080963621.1|470515_470722_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_017378388.1|472330_473104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378389.1|473105_474047_-	hypothetical protein	NA	A0A068C8G6	Acinetobacter_phage	26.5	1.7e-20
WP_017378390.1|474180_475758_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_036816949.1|475951_476350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378392.1|476927_477080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378393.1|477350_477557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875897.1|478361_479006_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.2	2.7e-09
WP_069971672.1|479073_480330_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376600.1|480585_480765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927402.1|480987_481215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377704.1|482490_483249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420757.1|483466_484030_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_017377702.1|484133_484682_+	DUF2058 family protein	NA	NA	NA	NA	NA
WP_087910634.1|485278_486431_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.5	2.3e-59
WP_017377698.1|486776_487073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420758.1|487332_488244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146619438.1|488478_489030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046620.1|490180_490318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|490564_491293_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_017377686.1|491339_491948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155635843.1|492218_492425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210764.1|493222_493483_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_017377283.1|493656_495195_+	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_017377282.1|495373_496300_+	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SJE1	Klosneuvirus	34.5	1.6e-10
WP_062365662.1|496404_497088_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.2	2.4e-11
WP_155635844.1|497097_497337_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	42.9	2.8e-07
WP_017377278.1|500642_501152_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_017377277.1|501155_501599_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_027243089.1|501694_502996_-	MFS transporter	NA	NA	NA	NA	NA
WP_017377276.1|503258_503627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377275.1|503618_504341_-	aquaporin family protein	NA	M1H9L8	Acanthocystis_turfacea_Chlorella_virus	37.6	1.6e-26
WP_017377274.1|505402_506755_+	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	45.7	3.2e-36
WP_017377273.1|506748_506988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875901.1|507522_508497_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	6.2e-29
WP_017377271.1|508907_509237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377270.1|509622_509988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377269.1|510111_510972_+	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_017377268.1|510958_511738_+	DUF2063 domain-containing protein	NA	NA	NA	NA	NA
WP_016210168.1|511813_512497_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036771941.1|512657_513263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377265.1|513479_513983_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_017377264.1|514184_514439_+	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_017377263.1|514940_515408_+	DoxX family protein	NA	NA	NA	NA	NA
WP_036771922.1|515974_517165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|517999_519403_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275269.1|519709_520330_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875903.1|520509_521484_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	6.2e-29
WP_017376501.1|521649_521916_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_144420759.1|521912_522413_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_048875904.1|522533_523409_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375999.1|525068_525599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376000.1|525598_526123_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	58.4	1.5e-50
WP_017376001.1|526285_527401_-	DSD1 family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017376003.1|527637_528798_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	58.7	2.8e-121
WP_017376004.1|529249_531253_+	transketolase	NA	NA	NA	NA	NA
WP_017376005.1|531321_532329_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_017376006.1|532402_533587_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_017376007.1|533596_535051_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_017376008.1|535081_536119_+	fructose-bisphosphate aldolase class II	NA	NA	NA	NA	NA
WP_017376009.1|536441_536732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|538086_539061_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_146619442.1|539194_539857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377794.1|540380_540632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377795.1|540836_542000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275388.1|542022_542712_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017377798.1|542859_543510_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_017377799.1|543610_544270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875907.1|546331_547093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377800.1|547511_547772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377801.1|547857_548520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377802.1|548636_549764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377803.1|550139_550301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420613.1|552432_552804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243006.1|553083_554325_+	protein kinase family protein	NA	NA	NA	NA	NA
WP_075275272.1|554462_554693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377811.1|554826_555711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243005.1|555739_556366_-	ribonuclease T	NA	NA	NA	NA	NA
WP_036773165.1|556396_557596_-	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
WP_144420614.1|557834_558932_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	43.1	1.1e-05
WP_017377815.1|559085_560624_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.5	3.5e-87
WP_017375632.1|560944_561280_-|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.5	2.3e-23
WP_017377700.1|562092_562386_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_036773116.1|562756_563731_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
>prophage 5
NZ_CP013975	Piscirickettsia salmonis strain CGR02, complete genome	3205229	573558	679354	3205229	tRNA,transposase	Bacillus_phage(16.67%)	107	NA	NA
WP_017377787.1|573558_573786_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_048875857.1|574042_575017_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
WP_048876031.1|575440_576844_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420615.1|576877_577666_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_017376557.1|577796_578492_-	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	27.4	1.2e-10
WP_017376558.1|578996_579503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242585.1|579596_580154_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_080999966.1|580451_581801_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046619.1|581887_582145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376564.1|582212_582923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062365666.1|583067_583322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376566.1|583777_585037_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_017376567.1|585169_585643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376568.1|585651_587034_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_026063542.1|587026_587641_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_017376570.1|587720_588437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376571.1|588611_590936_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	49.7	7.6e-25
WP_036771330.1|591102_592077_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376573.1|593006_594749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376574.1|594920_596012_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017376575.1|596044_596683_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_017376576.1|596721_596994_-	DUF1315 family protein	NA	NA	NA	NA	NA
WP_144420763.1|597092_597335_-	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_017376578.1|597352_597655_-	YciI family protein	NA	NA	NA	NA	NA
WP_017376579.1|597738_598281_-	septation protein A	NA	NA	NA	NA	NA
WP_016210074.1|598441_599068_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_017376580.1|599073_599913_+	hypothetical protein	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	24.2	4.2e-10
WP_017376581.1|599902_600553_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	33.5	3.9e-19
WP_026063543.1|600556_601390_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_017376583.1|601479_602607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963588.1|602873_603026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927249.1|603133_603328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376585.1|603520_604171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376586.1|604425_605517_-	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_017376587.1|605513_606878_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A088FRM7	Mycobacterium_phage	52.2	2.6e-17
WP_017376588.1|607002_608199_+|tRNA	tyrosine--tRNA ligase	tRNA	A0A2I2L594	Orpheovirus	24.8	2.8e-07
WP_144420764.1|608255_608819_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_017376590.1|609751_610420_-	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	44.1	4.7e-28
WP_017376591.1|610566_611868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376593.1|613358_613763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243040.1|613996_615079_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.2	1.4e-18
WP_017376596.1|615063_615684_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376597.1|615748_616624_+	hypothetical protein	NA	A0A140B3P3	Vibrio_phage	24.0	1.8e-11
WP_017376598.1|616701_617277_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_017377700.1|618085_618379_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_080999967.1|618495_618645_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036771330.1|619973_620948_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420617.1|621046_621202_-	phosphatase	NA	NA	NA	NA	NA
WP_080999968.1|621120_621381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046618.1|621557_622085_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	48.9	3.8e-33
WP_026063680.1|622339_622564_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	46.2	1.2e-07
WP_144420618.1|622708_623530_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.9	1.2e-41
WP_017377700.1|623487_623781_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_027243138.1|625257_625545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875909.1|626037_626808_-|transposase	IS982-like element ISPsa1 family transposase	transposase	NA	NA	NA	NA
WP_080963670.1|626877_628290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910635.1|628656_630027_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046582.1|630023_630188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377223.1|630247_630535_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_017377833.1|631566_632157_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_026063682.1|632283_633669_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_017377835.1|633766_633964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243136.1|634056_634890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420766.1|635428_635782_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_027243135.1|635794_636031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062365668.1|636030_636231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377840.1|636399_637119_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_017377841.1|637207_638992_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_155601396.1|639298_639454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377842.1|639380_639635_+	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_027243133.1|639780_640602_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_080963580.1|640784_641009_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_048876031.1|641114_642518_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377200.1|643082_643271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243131.1|643400_643667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377198.1|644052_645693_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_017377197.1|645805_647155_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.0	3.0e-74
WP_027243130.1|647151_648021_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.2	9.3e-69
WP_017377194.1|648945_650259_+	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_048875913.1|650255_651026_+	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_017375625.1|651022_651250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875914.1|651954_653115_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.4e-25
WP_069971647.1|653083_653680_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|654648_654876_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_048875916.1|655843_656248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155048063.1|656251_657247_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420620.1|657232_658435_-	MFS transporter	NA	NA	NA	NA	NA
WP_036774946.1|658361_658976_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	35.1	3.8e-16
WP_155046615.1|659672_659834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377737.1|660113_660659_+	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_017377736.1|660692_661358_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_027243185.1|661417_662374_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	31.6	6.3e-34
WP_144420767.1|662652_663330_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_048875918.1|663372_663954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046614.1|664098_664770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927746.1|665372_665960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|666928_667156_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_036773915.1|667128_667524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377727.1|667952_668768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377726.1|668858_669845_+	transaldolase	NA	V5UTB0	Synechococcus_phage	33.5	1.3e-13
WP_017377725.1|670014_670536_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.8	1.8e-27
WP_017377724.1|670569_670821_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	57.6	3.9e-20
WP_017377722.1|673088_673616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377721.1|673732_676045_-	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_036773913.1|676173_676989_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017377718.1|677245_677710_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_017377787.1|679126_679354_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
>prophage 6
NZ_CP013975	Piscirickettsia salmonis strain CGR02, complete genome	3205229	686709	758939	3205229	tRNA,transposase	Staphylococcus_phage(44.44%)	54	NA	NA
WP_048875919.1|686709_687027_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377706.1|687044_687257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|688210_688438_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_144420621.1|689595_690357_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771325.1|692547_693522_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_027242902.1|693646_695083_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_017376308.1|695162_696623_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_017376309.1|696743_697031_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_016210526.1|697228_698272_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_017376311.1|698287_699187_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_017376312.1|699183_699702_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_017376313.1|699771_700389_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_026063524.1|700398_701886_+	ribonuclease G	NA	NA	NA	NA	NA
WP_027242903.1|701895_705576_+	DUF3971 domain-containing protein	NA	NA	NA	NA	NA
WP_017376318.1|705649_706459_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_017376319.1|706458_707139_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_036773116.1|707763_708738_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_048875923.1|708780_709776_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|709828_710803_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017376224.1|711115_712000_-	DUF2608 domain-containing protein	NA	NA	NA	NA	NA
WP_017376223.1|712130_712952_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_017376222.1|712953_713991_-	asparaginase	NA	NA	NA	NA	NA
WP_017376221.1|713994_716652_-	[protein-PII] uridylyltransferase	NA	NA	NA	NA	NA
WP_017376220.1|716729_717539_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_017376219.1|717945_718713_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_017376218.1|718877_719756_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_017376217.1|719759_720497_+	UMP kinase	NA	NA	NA	NA	NA
WP_017376216.1|720500_721058_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_026063514.1|721065_721812_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	44.0	6.6e-23
WP_080963646.1|721726_722626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771906.1|722714_723590_+	lipid A biosynthesis acyltransferase	NA	NA	NA	NA	NA
WP_144420622.1|723686_725264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376212.1|725708_727619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376211.1|728155_728695_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_017376210.1|728691_729720_-	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_017376209.1|729709_730774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065653749.1|730761_732990_-	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_027242906.1|732976_734044_-	hydroxymethylglutaryl-CoA reductase	NA	NA	NA	NA	NA
WP_036771893.1|734328_736746_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_017376207.1|736826_737360_+	OmpH family outer membrane protein	NA	NA	NA	NA	NA
WP_017376206.1|737470_738520_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_075275393.1|738537_738984_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_017376204.1|738983_739757_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_027242907.1|739775_740930_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_017376201.1|741143_741713_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	43.4	3.4e-27
WP_017376200.1|741736_745243_+	DNA polymerase III subunit alpha	NA	A0A291AVA6	Streptomyces_phage	38.6	1.9e-192
WP_027242908.1|745320_746280_+	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_017376198.1|746254_747715_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_017376197.1|747750_749280_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	42.6	1.1e-85
WP_080999970.1|749313_750717_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155635845.1|752874_754443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|754527_755931_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048876012.1|756076_757480_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036771330.1|757964_758939_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 7
NZ_CP013975	Piscirickettsia salmonis strain CGR02, complete genome	3205229	771412	831636	3205229	transposase	Acinetobacter_phage(18.18%)	51	NA	NA
WP_048876012.1|771412_772816_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_082300719.1|773034_773460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243151.1|773511_774999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377221.1|775308_775848_-	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_082300723.1|776137_776365_-|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377224.1|777610_778186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999971.1|778299_779703_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377226.1|779699_779990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377227.1|780357_780771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052106211.1|781459_783247_+	protein kinase family protein	NA	NA	NA	NA	NA
WP_017377229.1|783413_784034_+	DUF2272 domain-containing protein	NA	NA	NA	NA	NA
WP_155046612.1|784380_784521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377230.1|784540_786517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377231.1|786889_788347_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	42.1	9.4e-98
WP_017377232.1|788415_789996_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	27.3	1.1e-16
WP_017377234.1|790636_794533_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	54.4	3.4e-118
WP_016210741.1|794539_794863_-	late competence development ComFB family protein	NA	NA	NA	NA	NA
WP_017377235.1|794936_795410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772195.1|795441_796437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243012.1|796688_798326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910659.1|798685_799633_+	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	35.2	4.3e-35
WP_017377238.1|799951_800296_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_144420626.1|800389_801061_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_017377240.1|801101_801929_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_036772199.1|802015_802543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155635846.1|803416_803848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052106212.1|803957_804539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377245.1|804893_806174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377246.1|806294_807158_-	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
WP_017377247.1|807246_808041_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_036772212.1|808278_809265_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_027243014.1|809270_810797_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_144420771.1|810892_812137_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_017377251.1|812190_813570_+	leucyl aminopeptidase family protein	NA	Q6GYZ8	Mycoplasma_phage	35.8	2.4e-34
WP_026063614.1|813687_814473_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	33.3	3.7e-32
WP_016211687.1|814815_815460_+	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_017377253.1|815494_817300_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_016211684.1|817323_817899_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_036771330.1|818948_819923_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_053093666.1|822459_823137_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	47.4	1.4e-48
WP_144420627.1|824635_824857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081000005.1|825737_825899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999972.1|825835_826336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376821.1|826431_826860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875928.1|827119_827569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420628.1|827621_828056_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080999973.1|828032_828998_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.6	2.0e-48
WP_017377288.1|829216_829477_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_087910637.1|829571_830306_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.3	2.0e-24
WP_155046611.1|830334_830487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875930.1|830691_831636_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP013975	Piscirickettsia salmonis strain CGR02, complete genome	3205229	845299	903960	3205229	protease,transposase,integrase	Bacillus_phage(26.67%)	48	871378:871437	887535:888031
WP_017377305.1|845299_846601_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.3	6.5e-135
WP_017377306.1|846668_849101_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.7	1.2e-219
WP_016209655.1|849204_849477_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	62.9	2.0e-22
WP_075275280.1|849559_851458_+	surA N-terminal domain protein	NA	NA	NA	NA	NA
WP_017377308.1|851489_852374_+	hypothetical protein	NA	A0A1W6JP29	Morganella_phage	35.7	2.2e-41
WP_017377309.1|852382_852778_-	CrcB family protein	NA	NA	NA	NA	NA
WP_048875932.1|853201_855349_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	36.2	3.1e-25
WP_017377313.1|855320_856670_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017377314.1|856666_858787_-	ATP-binding cassette domain-containing protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	28.1	2.0e-16
WP_017377315.1|858783_860487_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	25.0	3.4e-22
WP_017377316.1|860621_861764_-	galactokinase	NA	NA	NA	NA	NA
WP_017377317.1|861820_862849_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_026063623.1|862975_864490_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_017377319.1|864596_864797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420630.1|864941_865277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275281.1|865421_865658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420772.1|865928_866807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875933.1|867443_868388_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080999974.1|868661_870065_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420631.1|870069_870855_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	29.7	1.2e-06
WP_075275282.1|871245_872088_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
871378:871437	attL	TCTAATTACCGAAATTTTAAGATGTATTATCTTCATGTAATAAAAGGTAGCATGGTAAAA	NA	NA	NA	NA
WP_017377467.1|872084_872381_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_017377471.1|873862_874474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377472.1|874542_875349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|875652_876627_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377475.1|876798_878691_+	DNA topoisomerase IV subunit B	NA	A0A172JHT4	Bacillus_phage	32.3	3.6e-81
WP_144420632.1|879263_881579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|881993_883397_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875935.1|883837_884317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420633.1|884384_885641_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036772665.1|885787_886312_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_017376899.1|886716_886857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929562.1|887054_887759_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376902.1|888613_888925_-	hypothetical protein	NA	NA	NA	NA	NA
887535:888031	attR	TTTTACCATGCTACCTTTTATTACATGAAGATAATACATCTTAAAATTTCGGTAATTAGATTTGTGAAAATAAATCATAATTGTCATTATTTCACTTGTTGACATTTGTGAAGGCTTATTACGTTTTTTATTCGTATCTTCTAGCAAAATAGCATTCCATTGAGGTAATAACTCTTGGCAGAAATCATCTATTACACAAAAGAGAGAAATCAATGTTAAGTCCATTTTATTGCTTCTTTAGAACTAAATTTAGACTCTATTTAGCCGCAAAATCACTGGTTTTTCAAATACTTCTTATGTCGAACTCACGTTAGAATCACAAATGATTACTGATGAGGTGTTTTTATCATTTTGTCAAACAACTATCTTGACTATAACAAAAGTTATGAGTGATTTTTGTGTGGGTTATAAGGACTTTGAACATAAAGAAATTTGGCTGGAAGGCGTGAAAGATAAAATTCATCAGGGAGTAGACAAATTTTTTAATGCAGGAAATG	NA	NA	NA	NA
WP_017376903.1|888988_889168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243159.1|889730_889913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376905.1|889976_890204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063576.1|890411_891176_+	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	33.0	6.3e-29
WP_026063577.1|891402_891696_+	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	52.8	4.7e-17
WP_048875878.1|892221_893625_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376909.1|894094_895072_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_027243158.1|895168_896629_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_017376911.1|896655_897309_-	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_017376912.1|897433_898000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774028.1|898296_900030_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	30.0	1.6e-32
WP_047927497.1|900101_901808_+	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	26.3	3.6e-24
WP_017376916.1|901799_902858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875936.1|903111_903960_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.4	1.4e-16
>prophage 9
NZ_CP013975	Piscirickettsia salmonis strain CGR02, complete genome	3205229	909335	1046864	3205229	tRNA,protease,transposase	Staphylococcus_phage(18.52%)	117	NA	NA
WP_144420634.1|909335_910667_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036771639.1|910771_911746_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377669.1|911795_912500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420635.1|912940_913753_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420636.1|913811_916322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036815620.1|916667_917843_+	outer membrane transport family protein	NA	NA	NA	NA	NA
WP_144420637.1|919190_919415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875940.1|919443_920607_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.4e-25
WP_036774146.1|922849_923995_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_027243152.1|924587_925523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875941.1|927020_927332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420638.1|927328_928411_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377679.1|928726_928933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243160.1|929030_929561_+	prokaryotic cytochrome b561 family protein	NA	NA	NA	NA	NA
WP_017377681.1|929848_931027_-	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	31.6	7.7e-50
WP_144420775.1|931175_934940_-	bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA	NA	NA	NA	NA	NA
WP_017377683.1|934998_936501_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_036773927.1|937052_937688_+	peroxiredoxin C	NA	NA	NA	NA	NA
WP_016211781.1|938192_939440_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_075275285.1|939662_941099_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_048875943.1|941274_942492_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999976.1|942953_943733_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_036771330.1|944451_945426_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_048875941.1|946471_946783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420638.1|946779_947862_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046609.1|948172_948379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243178.1|950099_951461_-	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	35.5	4.3e-12
WP_017375734.1|951571_951943_-	DUF1043 family protein	NA	NA	NA	NA	NA
WP_017375735.1|952165_952816_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017375736.1|952858_953941_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_069971648.1|954667_955642_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	4.7e-29
WP_082300723.1|956512_956740_-|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017376860.1|958920_960474_+	protein kinase family protein	NA	NA	NA	NA	NA
WP_017376859.1|961262_961499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275287.1|961618_962662_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375571.1|962908_963310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774710.1|963483_964383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875946.1|964777_965989_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.8e-25
WP_036771959.1|965999_966224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376857.1|966545_966776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|966802_968206_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027243219.1|968372_968681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046689.1|968965_969142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875947.1|969764_970814_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875948.1|970882_971905_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.4	3.9e-135
WP_017378198.1|971950_972865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|973833_974061_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017378197.1|974017_974887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376026.1|977487_979359_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	28.4	1.4e-34
WP_027243175.1|979450_981196_-	DNA primase	NA	A0A1S5RGL3	Helicobacter_phage	36.7	7.6e-46
WP_017376029.1|981275_981725_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	44.9	1.4e-20
WP_016211035.1|981777_981993_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_017376030.1|982239_983256_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	54.2	1.8e-100
WP_017376031.1|983304_983934_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_017376032.1|984274_985486_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_048875949.1|985518_985869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420640.1|985834_986515_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376035.1|986791_987211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146619425.1|987356_988043_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155048060.1|988187_988445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|988524_989499_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_144420641.1|989518_990154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275290.1|990397_991399_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_062365683.1|991497_992724_-	MFS transporter	NA	NA	NA	NA	NA
WP_062365685.1|992713_993226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081078109.1|993212_993698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081078110.1|993651_993918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062365690.1|993844_994453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875952.1|996533_997169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376043.1|997283_998618_-	dihydroorotase	NA	NA	NA	NA	NA
WP_017376044.1|998746_999388_-	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_017376045.1|999693_1000116_+	universal stress protein	NA	NA	NA	NA	NA
WP_017376046.1|1000393_1001356_+	formimidoylglutamase	NA	NA	NA	NA	NA
WP_075275404.1|1001394_1002570_+	imidazolonepropionase	NA	NA	NA	NA	NA
WP_087910638.1|1002658_1004359_+	urocanate hydratase	NA	NA	NA	NA	NA
WP_017376050.1|1004358_1005897_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	37.4	2.1e-71
WP_017376051.1|1005936_1007589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210558.1|1007662_1008418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063502.1|1008604_1009480_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420642.1|1009744_1009939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773960.1|1010083_1010557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046586.1|1010826_1011000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155635847.1|1011192_1012518_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376055.1|1012514_1013159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772015.1|1013677_1014865_-	MFS transporter	NA	NA	NA	NA	NA
WP_027242844.1|1015045_1015687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376060.1|1015760_1017110_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	27.6	7.5e-33
WP_048876123.1|1017213_1019394_+	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_036772169.1|1019463_1020339_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_080999977.1|1020385_1020682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376065.1|1020805_1021213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420776.1|1021192_1021771_-	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	34.3	6.9e-20
WP_017376067.1|1022193_1022856_+	adenylate kinase	NA	NA	NA	NA	NA
WP_016211263.1|1022886_1023255_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_017376068.1|1023265_1024582_-	MFS transporter	NA	NA	NA	NA	NA
WP_144420644.1|1024828_1025440_+	DedA family protein	NA	NA	NA	NA	NA
WP_065653731.1|1025515_1025695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211261.1|1025865_1026159_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.5	5.8e-15
WP_036772670.1|1026399_1026702_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	40.0	7.5e-10
WP_017376072.1|1026756_1029030_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.3e-167
WP_016211259.1|1029089_1029335_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_036771330.1|1030184_1031159_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_048875955.1|1031433_1032408_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	4.3e-30
WP_036771709.1|1032615_1033377_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_017376076.1|1033360_1034317_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.7	1.6e-61
WP_017376077.1|1034579_1037078_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	42.9	2.4e-85
WP_017376078.1|1037081_1037822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376079.1|1038271_1039066_-	inositol monophosphatase	NA	NA	NA	NA	NA
WP_017376080.1|1039228_1040017_+|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_017376081.1|1040013_1041225_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_144420777.1|1041217_1041574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376083.1|1041668_1042097_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	39.4	1.8e-17
WP_036771725.1|1042248_1043358_+	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_017376085.1|1043354_1044083_+	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_017376086.1|1044140_1045028_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017376087.1|1045112_1045487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376088.1|1045586_1046864_+|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	24.8	3.6e-21
>prophage 10
NZ_CP013975	Piscirickettsia salmonis strain CGR02, complete genome	3205229	1052076	1104636	3205229	tRNA,transposase	unidentified_phage(20.0%)	52	NA	NA
WP_075275292.1|1052076_1052907_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155046605.1|1053134_1053284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242840.1|1053478_1054300_+	ParA family protein	NA	H7BUL8	unidentified_phage	33.0	3.9e-16
WP_017375751.1|1054296_1055190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375750.1|1055235_1055757_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_017375749.1|1055834_1056320_+	DUF2802 domain-containing protein	NA	NA	NA	NA	NA
WP_048875957.1|1056453_1057110_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.9	9.6e-10
WP_017375746.1|1057106_1057415_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	41.4	1.7e-09
WP_036771957.1|1057763_1058735_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377899.1|1059039_1059831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875958.1|1059820_1060684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377897.1|1060710_1061130_-	response regulator	NA	W8CYM9	Bacillus_phage	29.4	1.2e-05
WP_017377896.1|1061182_1062139_-	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
WP_027242839.1|1062621_1065294_+	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_017377894.1|1065374_1066001_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_026063687.1|1066157_1067756_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_017377892.1|1067845_1069267_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_017377891.1|1069297_1069819_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	34.2	2.0e-10
WP_017377890.1|1069815_1070421_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_017377889.1|1070497_1071508_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	30.8	6.9e-07
WP_017377888.1|1071620_1072325_+	protein TolQ	NA	NA	NA	NA	NA
WP_017377887.1|1072359_1072791_+	protein TolR	NA	NA	NA	NA	NA
WP_036771700.1|1072793_1073888_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_048875959.1|1073947_1075300_+	Tol-Pal system beta propeller repeat protein TolB	NA	NA	NA	NA	NA
WP_017377882.1|1075335_1075977_+	OmpA family protein	NA	NA	NA	NA	NA
WP_144420778.1|1076049_1076949_+	tol-pal system protein YbgF	NA	NA	NA	NA	NA
WP_027242836.1|1076951_1077599_+	7-carboxy-7-deazaguanine synthase QueE	NA	J9PV61	Bacillus_phage	38.6	1.6e-36
WP_027242835.1|1077649_1078453_-	AAA family ATPase	NA	A0A0E3G5H5	Synechococcus_phage	43.1	6.8e-42
WP_017377879.1|1078634_1078850_+	SlyX family protein	NA	NA	NA	NA	NA
WP_017377878.1|1078853_1079087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377877.1|1079148_1080741_-	exodeoxyribonuclease VII large subunit	NA	NA	NA	NA	NA
WP_017377875.1|1080943_1081873_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	31.9	7.0e-14
WP_017377874.1|1081874_1082642_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_047927659.1|1083007_1083778_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_036771330.1|1083836_1084811_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017377870.1|1084918_1085281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377869.1|1085450_1087160_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_048875961.1|1087400_1088804_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_146619530.1|1088855_1089113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155048058.1|1089418_1089601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242834.1|1090149_1091457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773793.1|1091916_1092294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376708.1|1092438_1092840_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875964.1|1093404_1094184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046604.1|1094251_1094392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420647.1|1094592_1094790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053093668.1|1094927_1095527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420648.1|1095709_1097182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378009.1|1097584_1099330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243143.1|1099765_1100626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378007.1|1101143_1103087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875961.1|1103232_1104636_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP013975	Piscirickettsia salmonis strain CGR02, complete genome	3205229	1112934	1154996	3205229	protease,transposase	Burkholderia_virus(40.0%)	34	NA	NA
WP_027243145.1|1112934_1113990_+|protease	protease SohB	protease	NA	NA	NA	NA
WP_017377998.1|1114000_1114531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875965.1|1116688_1117609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420649.1|1117753_1117894_-	phosphatase	NA	NA	NA	NA	NA
WP_017375623.1|1118782_1119166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774918.1|1119175_1119535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999979.1|1120469_1120616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420650.1|1120854_1122111_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376600.1|1122366_1122546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420651.1|1122865_1123519_+|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	33.1	5.8e-15
WP_075275295.1|1123723_1124050_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080999971.1|1124821_1126225_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377761.1|1126395_1127766_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_144420780.1|1127812_1128712_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377764.1|1131576_1132173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377765.1|1132586_1133342_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017377787.1|1133431_1133659_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_027242898.1|1134775_1135417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377768.1|1135686_1137012_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_047927230.1|1137008_1139066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377771.1|1139043_1139616_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_144420781.1|1139698_1140031_+	DUF1820 family protein	NA	NA	NA	NA	NA
WP_017377773.1|1140095_1141130_+	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_027242897.1|1141117_1142239_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_122941582.1|1142332_1143316_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_027242896.1|1143472_1145140_+	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	25.3	1.2e-19
WP_027242895.1|1145426_1146278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377782.1|1146686_1149155_+	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_017377783.1|1149168_1150143_+	homoserine kinase	NA	NA	NA	NA	NA
WP_017377784.1|1150129_1151398_+	threonine synthase	NA	NA	NA	NA	NA
WP_027242894.1|1151431_1153180_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_017375591.1|1153359_1153563_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_080999980.1|1153769_1154459_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.8	2.6e-34
WP_047927086.1|1154738_1154996_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.8	4.1e-09
>prophage 12
NZ_CP013975	Piscirickettsia salmonis strain CGR02, complete genome	3205229	1195184	1250035	3205229	tRNA,transposase	uncultured_Mediterranean_phage(25.0%)	44	NA	NA
WP_051929562.1|1195184_1195889_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_036771332.1|1196139_1197114_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	7.3e-30
WP_017376395.1|1198001_1200728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|1201251_1202226_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017376397.1|1202423_1203905_-	MFS transporter	NA	NA	NA	NA	NA
WP_016209947.1|1204364_1205027_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_017376398.1|1205268_1206501_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_017376399.1|1206657_1209429_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.4	6.9e-150
WP_017376400.1|1209497_1209941_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_017376401.1|1210093_1211566_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	30.2	1.8e-43
WP_017376402.1|1211677_1212739_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_027242800.1|1212735_1213770_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_017376405.1|1213772_1214813_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_026063528.1|1214997_1216113_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	49.2	2.2e-94
WP_017376407.1|1216151_1216505_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	46.5	1.1e-07
WP_017376408.1|1216525_1218394_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_017376409.1|1218415_1219360_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.2	2.4e-38
WP_017376410.1|1219593_1219872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209938.1|1220234_1220873_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_017376411.1|1220847_1222272_-	aminodeoxychorismate synthase component I	NA	A0A0B5J984	Pandoravirus	33.4	3.9e-40
WP_017376412.1|1222472_1223150_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_017376414.1|1224614_1225370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376415.1|1225421_1226339_+	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_017376416.1|1226473_1226644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420654.1|1226763_1227543_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376231.1|1227595_1227883_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_051929627.1|1227942_1228293_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_081078111.1|1228415_1229168_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376433.1|1230774_1232133_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	26.0	3.9e-37
WP_026063530.1|1232356_1232545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376430.1|1232558_1233692_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_062365691.1|1233892_1235560_+	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_155635848.1|1235764_1238053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376428.1|1238087_1238813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|1239202_1239931_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_017375910.1|1240333_1241062_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_075275409.1|1241125_1241953_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027242802.1|1242134_1242503_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_017376425.1|1242499_1243318_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_017376424.1|1243418_1244234_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_017376423.1|1244517_1246578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420655.1|1246574_1247000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062365695.1|1247184_1248642_-	neurotransmitter symporter family protein	NA	NA	NA	NA	NA
WP_075275417.1|1249870_1250035_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP013975	Piscirickettsia salmonis strain CGR02, complete genome	3205229	1260934	1305990	3205229	transposase	uncultured_Caudovirales_phage(12.5%)	38	NA	NA
WP_144420657.1|1260934_1261996_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036772905.1|1263486_1263840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242803.1|1264048_1265761_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.9	2.5e-25
WP_027242804.1|1266207_1268061_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	40.5	2.2e-43
WP_016209821.1|1268163_1268496_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_017377485.1|1268526_1269123_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_017377486.1|1269119_1270244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377487.1|1270355_1271003_+	hypothetical protein	NA	W8CYT3	Bacillus_phage	30.8	1.4e-08
WP_017377488.1|1271054_1272968_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.6	1.8e-117
WP_017377489.1|1273172_1274210_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_062365699.1|1274268_1275111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062365701.1|1275341_1275755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062365703.1|1275791_1277600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242806.1|1278306_1279275_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_027242807.1|1279404_1279893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777920.1|1280334_1280568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036817939.1|1280877_1281066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375667.1|1281554_1282040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275301.1|1282310_1282580_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_017377496.1|1282614_1283940_-	ribonuclease HI	NA	G3MB70	Bacillus_virus	36.3	1.3e-37
WP_144420783.1|1283995_1284643_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_027242809.1|1284836_1286795_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.2	2.5e-45
WP_047927313.1|1286938_1289869_+	peptidase M16	NA	NA	NA	NA	NA
WP_048875980.1|1290674_1292078_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378296.1|1293518_1294304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378295.1|1294394_1296044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378294.1|1296188_1297034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|1297147_1298551_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_047927801.1|1298547_1298994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242792.1|1299235_1299895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378290.1|1299913_1300789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275303.1|1300924_1301914_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420658.1|1301890_1302652_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.3	6.9e-44
WP_144420659.1|1302684_1303464_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875973.1|1303740_1304376_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046582.1|1304372_1304537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1304735_1305710_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017378288.1|1305768_1305990_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP013975	Piscirickettsia salmonis strain CGR02, complete genome	3205229	1376129	1406556	3205229	tRNA,transposase	Staphylococcus_phage(28.57%)	29	NA	NA
WP_017378219.1|1376129_1376600_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_144420785.1|1376709_1377960_+	AMIN domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	27.4	1.7e-15
WP_016211840.1|1378648_1379113_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	32.9	4.7e-19
WP_155635849.1|1381674_1381884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420662.1|1382029_1382233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378212.1|1382423_1382822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875983.1|1383007_1383613_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	49.5	6.3e-48
WP_017375549.1|1383621_1383918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875984.1|1383922_1384459_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046598.1|1384603_1385173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|1385252_1386227_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_048875986.1|1386223_1386721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910640.1|1387128_1387545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856767.1|1387612_1389016_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275305.1|1389012_1389633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|1389904_1390879_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_036773538.1|1391043_1391667_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017376442.1|1391663_1393604_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	33.0	1.8e-72
WP_017376443.1|1393759_1394413_+	glutaredoxin 2	NA	NA	NA	NA	NA
WP_017376444.1|1394581_1395757_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_017376445.1|1396110_1397436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063532.1|1397528_1398317_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_017376447.1|1398418_1399291_+	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_017376448.1|1399477_1400740_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_017376449.1|1400813_1401344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376450.1|1401365_1402871_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	40.4	7.7e-87
WP_017376451.1|1402883_1403549_+|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_017376452.1|1403642_1405403_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_036773947.1|1405680_1406556_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP013975	Piscirickettsia salmonis strain CGR02, complete genome	3205229	1412222	1517660	3205229	tRNA,protease,transposase	Burkholderia_phage(13.64%)	93	NA	NA
WP_017376460.1|1412222_1414817_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	41.3	2.4e-88
WP_017376461.1|1415123_1415387_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	68.6	4.1e-12
WP_069971651.1|1415759_1416635_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155046597.1|1416749_1416926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376465.1|1417470_1419033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772167.1|1419574_1420522_-	sphingomyelin phosphodiesterase	NA	NA	NA	NA	NA
WP_017376467.1|1420741_1422217_-	APC family permease	NA	NA	NA	NA	NA
WP_017376469.1|1422736_1423759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376470.1|1424115_1425483_+	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_026063533.1|1425758_1426013_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_048876132.1|1426061_1427315_+	GTPase HflX	NA	NA	NA	NA	NA
WP_027242811.1|1427334_1428549_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_017376474.1|1428548_1429442_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_017376475.1|1429639_1430938_+	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	34.1	2.4e-65
WP_027242812.1|1431027_1432305_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	33.1	7.5e-51
WP_036772166.1|1432318_1434718_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.3	5.2e-69
WP_017376476.1|1434714_1435473_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_017376477.1|1435649_1436039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376231.1|1438161_1438449_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_081078114.1|1438814_1439606_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.4	1.9e-44
WP_017375672.1|1440264_1440756_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377694.1|1440744_1441473_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_017377465.1|1441491_1442349_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	31.3	5.3e-16
WP_027242813.1|1442354_1443608_-	type III PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_027242814.1|1443641_1445510_-	IucA/IucC family siderophore biosynthesis protein	NA	NA	NA	NA	NA
WP_052106215.1|1445496_1446735_-	MFS transporter	NA	NA	NA	NA	NA
WP_080963599.1|1446719_1448567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377461.1|1448551_1449757_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_017377460.1|1449768_1451958_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_017377459.1|1452526_1453156_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_075275307.1|1453178_1453598_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_036772544.1|1453578_1453995_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_075275308.1|1453994_1454837_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_027242817.1|1454892_1455873_+	iron-siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017377453.1|1455853_1457851_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_027242818.1|1457868_1459044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875989.1|1459325_1460729_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242819.1|1460877_1461240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377447.1|1461411_1461630_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_027242820.1|1462175_1464203_+	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_017377445.1|1464284_1465535_-	MFS transporter	NA	NA	NA	NA	NA
WP_017377444.1|1465834_1466170_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_016211283.1|1466481_1466730_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_017377443.1|1466765_1467275_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_017377442.1|1467274_1468054_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_017377441.1|1468071_1468419_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_017377440.1|1468528_1468804_+	hypothetical protein	NA	A0A1B0Z0G5	Vibrio_phage	50.6	6.6e-13
WP_080963600.1|1468965_1469322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036816484.1|1469721_1470057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875990.1|1470261_1471038_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420664.1|1470994_1471867_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.8e-49
WP_017376231.1|1472151_1472439_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_080999985.1|1472522_1473242_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275310.1|1473372_1473981_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|1474786_1475761_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_051929549.1|1475840_1476218_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_047927093.1|1476316_1477420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053856757.1|1479080_1479578_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875992.1|1479722_1480121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420665.1|1480206_1481112_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.5	1.3e-49
WP_047927606.1|1481330_1481651_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	36.6	3.1e-06
WP_036773204.1|1481732_1482506_-	DUF2807 domain-containing protein	NA	NA	NA	NA	NA
WP_062365714.1|1483082_1483628_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_062365717.1|1483627_1483918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420667.1|1485180_1486191_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.5	2.5e-25
WP_017377585.1|1486335_1486593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875994.1|1486706_1487963_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376600.1|1488218_1488398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377584.1|1488891_1489134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377583.1|1489159_1490518_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	37.9	3.1e-71
WP_026063647.1|1490799_1491159_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_017377580.1|1491590_1493225_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.5	1.7e-143
WP_017377579.1|1493231_1494068_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.3	1.7e-51
WP_017377578.1|1494089_1495367_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.9	9.6e-139
WP_017377577.1|1495453_1495771_+	cell division protein FtsB	NA	NA	NA	NA	NA
WP_017377576.1|1495793_1496885_+|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_017377575.1|1497075_1498665_+	APC family permease	NA	NA	NA	NA	NA
WP_017377574.1|1498725_1499499_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.4	6.5e-66
WP_017377573.1|1499669_1500719_+	RNA polymerase sigma factor RpoS	NA	M4SMP8	Cyanophage	30.8	1.7e-29
WP_036816899.1|1501447_1501639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772584.1|1502468_1503245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420668.1|1503445_1503757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875874.1|1503849_1504815_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275315.1|1506025_1506280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420669.1|1506686_1506929_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875996.1|1506941_1507817_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_036816928.1|1508143_1508584_-	universal stress protein	NA	NA	NA	NA	NA
WP_081000007.1|1510168_1510573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377185.1|1512464_1513403_+	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_027242821.1|1513466_1515461_+	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_026063604.1|1515463_1516060_+	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_017377182.1|1516056_1516395_+	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_036774017.1|1516784_1517660_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP013975	Piscirickettsia salmonis strain CGR02, complete genome	3205229	1575995	1591566	3205229	transposase	unidentified_phage(25.0%)	15	NA	NA
WP_048876002.1|1575995_1576979_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.0	4.5e-27
WP_087910642.1|1577778_1578932_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	6.8e-59
WP_048876004.1|1579053_1579746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242833.1|1579754_1580942_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.3	5.2e-22
WP_017376484.1|1581091_1581718_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.3	1.2e-33
WP_017376485.1|1581763_1582993_+	hypothetical protein	NA	B2YG43	Musca_hytrovirus	21.9	2.6e-08
WP_144420789.1|1583187_1583634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376487.1|1583825_1585184_+	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_075275317.1|1585849_1586023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876005.1|1586152_1587070_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.4	4.6e-26
WP_053093673.1|1587411_1588071_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420674.1|1588151_1588655_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.7	3.0e-19
WP_017376491.1|1588627_1588915_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771628.1|1589207_1590329_-	calcium:proton antiporter	NA	NA	NA	NA	NA
WP_036771330.1|1590591_1591566_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 17
NZ_CP013975	Piscirickettsia salmonis strain CGR02, complete genome	3205229	1606553	1719488	3205229	tRNA,protease,transposase,integrase	Staphylococcus_phage(25.93%)	110	1626736:1626795	1654201:1655195
WP_036771330.1|1606553_1607528_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420675.1|1607603_1607921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275321.1|1607924_1608293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243029.1|1609026_1609995_-	threonine/serine dehydratase	NA	NA	NA	NA	NA
WP_027243028.1|1610204_1611617_-	MFS transporter	NA	NA	NA	NA	NA
WP_017375994.1|1611804_1612518_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	1.7e-36
WP_017375995.1|1612538_1612952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375996.1|1613052_1614126_-	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_027243027.1|1614262_1615162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772860.1|1615417_1615669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243025.1|1615717_1616353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772872.1|1616477_1617335_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_048876031.1|1617522_1618926_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_047927520.1|1619101_1619605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377328.1|1619681_1620983_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.3	8.2e-29
WP_027243024.1|1621151_1622252_+	carbohydrate kinase family protein	NA	NA	NA	NA	NA
WP_027243023.1|1622602_1622845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772851.1|1622838_1623156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082300723.1|1624378_1624606_+|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_036774927.1|1625216_1625687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212018.1|1625909_1626209_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_047927838.1|1626205_1626451_-	hypothetical protein	NA	NA	NA	NA	NA
1626736:1626795	attL	TGTTCTGGTCAAGTCATATTGGACACTTTTAATTGAGACTTTTCAAAATTAATAGGCGAT	NA	NA	NA	NA
WP_144420679.1|1626743_1627700_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	3.6e-50
WP_017375591.1|1627984_1628188_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_065653736.1|1628318_1629347_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_047927336.1|1629710_1629956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971648.1|1630318_1631293_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	4.7e-29
WP_075275420.1|1632764_1634471_+	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_036773893.1|1634516_1635368_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_146619459.1|1635570_1638027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420677.1|1638546_1638948_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771639.1|1639534_1640509_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017378512.1|1640549_1641878_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_016211143.1|1642141_1642711_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	39.5	7.3e-30
WP_017378513.1|1642726_1643038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378514.1|1643047_1644016_-	ferrochelatase	NA	NA	NA	NA	NA
WP_016211147.1|1644148_1644502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378515.1|1644505_1645570_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_017378516.1|1645570_1647310_-	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	31.2	5.8e-54
WP_017378517.1|1647316_1647739_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_017378518.1|1647722_1648352_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_075275322.1|1648587_1648686_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_047927346.1|1648718_1650590_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_048876007.1|1650737_1651712_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	2.1e-29
WP_155046591.1|1651791_1651935_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_027243017.1|1652108_1653452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420679.1|1654208_1655165_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	3.6e-50
WP_017375696.1|1655491_1655875_+	hypothetical protein	NA	NA	NA	NA	NA
1654201:1655195	attR	TGTTCTGGTCAAGTCATATTGGACACTTTTAATTGAGACTTTTCAAAATTAATAGGCGATAGGTTACCATTGGCTGTATGCAACCGATCATGATTGTAATATCGAATATAGGCCTCAACATCCTCCTTCATAGTATCACGGGTTAAGTGAATCACATTCAACAGCCATTCGTGCTTTAGGCTGCCAAAAAAACGCTCGACAACCGCATTGTCAACGCAAGCACCGACACTGCTCATAGAAGCGGTGATTTTATGCTTCTTCAACAGTTTTCGATATTTTTTACTGGTATACTGCGAACCACGATCACTGTGAAATAACAAGTGTTCTGTCGGCTGCCGCAAGTGAATCGCCATATCCATTGCACGACAAACTAGATTTTCGCTCATTCTCTTATTCATCGCCCAGCCAATCACTTTTCGAGAGTATAAATCAATAACGACCGCAAGATACAACCAGCCTTCAGCAGTTCTAAGGTAGGTAATGTCACCTGCCCATGAGTGATTTGCAATGACTGGATTAAACTGCTGATTCAATACGTTATCTGCAACAGCGTGATGGTGCTTACGCTTAGTTGTCACTTTATAAGCTTTACGTTGCAGCACCTTTAAACCGAGTTTTTGCATTAGGCTTCTCGCCCGATAACGGCCTACTTGAAAGCCTTCTTCTTGAAGTTTATATGCCATCATTCGTGATCCTAAGCTGCCGCGACTTTCTTTAAAAAGCTCCTTACAGCGCCGATAAAGCTGAAGCTCTTCAATTGAAATCACTTTAGCAGGCCGCTTGTCCCAAGCATAAAAGGCAGAACGGCTTACCTTCATCACTTTACAGGTCAGATTAATAGGATATAACACTTTGTTCTTCCGAATAAAATTAAATTTTACTTCATTTCTTTCGCGAAGAAGGCACTCGCCTTTTTTAAAATTTCTTTCTCCATCTGCAGTTGCTTTACTTTCTTTCGCAGGGATTGAAGCTCAGCCTTTTCATCAGGAGTCAGA	NA	NA	NA	NA
WP_080963603.1|1655890_1656823_-	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_036774017.1|1657126_1658002_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155046590.1|1658003_1658168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774017.1|1658458_1659334_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155046590.1|1659335_1659500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046589.1|1659679_1659829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062365722.1|1659908_1660403_+	helix-turn-helix domain-containing protein	NA	W5R8L2	Staphylococcus_phage	34.9	5.4e-05
WP_144420679.1|1661251_1662208_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	3.6e-50
WP_017375696.1|1662534_1662918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963603.1|1662933_1663866_-	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_036774017.1|1664169_1665045_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155046590.1|1665046_1665211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774017.1|1665501_1666377_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155046590.1|1666378_1666543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046589.1|1666722_1666872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876008.1|1666951_1667926_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	8.1e-29
WP_027242577.1|1667922_1669224_-	ComEC/Rec2 family competence protein	NA	NA	NA	NA	NA
WP_062365724.1|1669241_1669589_+	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_081078116.1|1669835_1670024_+	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_155635850.1|1670123_1670291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376785.1|1670531_1671437_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_144420682.1|1672843_1673005_+	phosphatase	NA	NA	NA	NA	NA
WP_155046588.1|1673539_1673749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243099.1|1674864_1676178_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	7.7e-51
WP_027243098.1|1676413_1677559_+	carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_155049745.1|1677633_1677810_+	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
WP_027243096.1|1677845_1678478_-	MarC family protein	NA	NA	NA	NA	NA
WP_144420683.1|1678654_1679311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243095.1|1679299_1681585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376797.1|1681858_1682218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376798.1|1682499_1683135_+	LysE family translocator	NA	NA	NA	NA	NA
WP_017376801.1|1684322_1685147_+	hypothetical protein	NA	X2KR27	Campylobacter_phage	28.3	6.2e-06
WP_144420791.1|1685202_1686414_-	protein kinase	NA	NA	NA	NA	NA
WP_027243094.1|1687197_1687905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146619422.1|1687967_1688147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062312151.1|1688208_1688541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376807.1|1688638_1689382_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_017376808.1|1689395_1690439_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_017376809.1|1690577_1692347_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	40.7	4.9e-08
WP_048876146.1|1692571_1693705_-	MFS transporter	NA	S4TR35	Salmonella_phage	23.0	2.6e-15
WP_026063564.1|1694554_1697374_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.3	5.2e-312
WP_017376814.1|1697748_1698474_+	single-stranded DNA-binding protein	NA	A0A2I7QWB5	Vibrio_phage	65.6	6.2e-42
WP_081377820.1|1701068_1701629_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	47.2	1.6e-37
WP_051929542.1|1701833_1702166_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376231.1|1702225_1702513_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_048876009.1|1703165_1704191_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1704318_1705293_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_027243041.1|1705487_1706441_-	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_144420684.1|1706610_1706859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420792.1|1707041_1707566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376827.1|1708020_1708848_+	DsbA family protein	NA	NA	NA	NA	NA
WP_144420685.1|1708916_1709102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376828.1|1709302_1709761_+	amino acid permease	NA	NA	NA	NA	NA
WP_017376829.1|1709901_1710129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876010.1|1710293_1711679_-	protein kinase family protein	NA	A0A1M7XTW9	Cedratvirus	27.7	1.4e-05
WP_017376830.1|1711974_1712289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243043.1|1712397_1714023_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	25.3	3.9e-28
WP_017376832.1|1714435_1715425_-	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_016212182.1|1715746_1715932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376833.1|1716321_1718277_+	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	39.7	9.2e-16
WP_080963614.1|1718348_1718471_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1718513_1719488_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 18
NZ_CP013975	Piscirickettsia salmonis strain CGR02, complete genome	3205229	1739252	1861929	3205229	tRNA,transposase	Acinetobacter_phage(13.33%)	103	NA	NA
WP_048876011.1|1739252_1740302_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772296.1|1740501_1740879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243051.1|1741575_1741785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376231.1|1742068_1742356_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_036773200.1|1742415_1742712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420686.1|1742856_1743513_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	46.8	4.7e-41
WP_017377324.1|1743752_1744133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|1744784_1746188_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_087910660.1|1746184_1746466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876013.1|1746860_1747325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927610.1|1747505_1748099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876007.1|1748284_1749259_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	2.1e-29
WP_051929845.1|1749662_1750487_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_027243222.1|1750561_1751710_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_027243221.1|1751725_1753354_-	cytochrome d terminal oxidase subunit I	NA	NA	NA	NA	NA
WP_017375698.1|1753697_1754891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063486.1|1761005_1761506_+	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_155046587.1|1761919_1762060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772592.1|1762182_1763643_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	33.4	2.3e-56
WP_026063485.1|1763720_1764203_-	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_017375881.1|1764361_1765627_+	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	42.8	1.2e-48
WP_027243180.1|1765711_1766971_+	phosphoesterase	NA	NA	NA	NA	NA
WP_017375878.1|1767042_1767315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876014.1|1767652_1767988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375877.1|1768348_1768597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876016.1|1768867_1769278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875984.1|1769422_1769959_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420687.1|1769969_1770155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376772.1|1770590_1771562_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_027243181.1|1771543_1772515_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_144420793.1|1772628_1773402_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017376768.1|1773672_1774002_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876149.1|1774257_1774776_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017377787.1|1774828_1775056_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_144420688.1|1776037_1776913_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_051929549.1|1777104_1777482_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_048876011.1|1778041_1779091_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376108.1|1779404_1780790_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	29.7	3.4e-49
WP_017376107.1|1780796_1782335_-|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L594	Tupanvirus	22.4	2.6e-05
WP_017376106.1|1782377_1783103_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_017376105.1|1783273_1784506_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	27.2	8.9e-33
WP_017376104.1|1784705_1785527_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_017376103.1|1785576_1786386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876018.1|1786541_1790408_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	26.5	1.6e-51
WP_017376100.1|1790573_1791449_+	ParA family protein	NA	NA	NA	NA	NA
WP_155635854.1|1791513_1791681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420689.1|1791937_1792513_+	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_017376099.1|1792561_1792720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929528.1|1793468_1794185_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_026063521.1|1795313_1795730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420690.1|1796644_1797574_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.9	2.2e-60
WP_144420691.1|1797545_1797704_+	phosphatase	NA	NA	NA	NA	NA
WP_017376276.1|1797852_1798167_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.9e-06
WP_026063520.1|1799076_1800060_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	32.7	1.3e-34
WP_017376274.1|1800210_1800558_+	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_017376273.1|1800557_1801157_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_075275328.1|1801531_1801870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963606.1|1801691_1802078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876152.1|1802081_1803026_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420693.1|1803013_1803157_+	phosphatase	NA	NA	NA	NA	NA
WP_036771585.1|1803518_1803851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275332.1|1806743_1807745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376676.1|1807817_1808282_+	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_017376672.1|1810176_1813233_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_027242910.1|1813314_1814769_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_027242911.1|1815203_1816220_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_017376669.1|1816328_1816727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376668.1|1816766_1818590_+	BamA/TamA family outer membrane protein	NA	NA	NA	NA	NA
WP_027242912.1|1818586_1821889_+	DUF490 domain-containing protein	NA	NA	NA	NA	NA
WP_036772026.1|1821993_1822869_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376663.1|1822906_1823821_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_027242913.1|1823885_1824515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376662.1|1824559_1824994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376661.1|1824974_1825715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376660.1|1825728_1827126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242914.1|1827128_1830077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772028.1|1830076_1831798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242917.1|1831812_1832217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376655.1|1832217_1835097_-	DUF4280 domain-containing protein	NA	NA	NA	NA	NA
WP_075275426.1|1835099_1835822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242919.1|1836183_1838076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376650.1|1838107_1840648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242920.1|1840679_1841843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242921.1|1841848_1842472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242922.1|1842486_1843986_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_036772036.1|1844002_1844509_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_075275427.1|1845764_1845836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275333.1|1846018_1846201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971656.1|1847402_1847675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420695.1|1847690_1849124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420696.1|1849268_1850534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242924.1|1850819_1852571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242925.1|1852583_1853747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774095.1|1853750_1854029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|1854086_1854314_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_036771639.1|1856182_1857157_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_081000010.1|1857215_1857479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155635847.1|1857488_1858814_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046586.1|1859006_1859180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420794.1|1859247_1859391_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_027243218.1|1859409_1859607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772025.1|1859624_1860131_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_036772663.1|1861053_1861929_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP013975	Piscirickettsia salmonis strain CGR02, complete genome	3205229	1891684	1941970	3205229	transposase	Staphylococcus_phage(37.5%)	40	NA	NA
WP_048876022.1|1891684_1892536_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_087910645.1|1892948_1894102_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_048876023.1|1894192_1895296_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.0e-25
WP_017375861.1|1895635_1896136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211829.1|1896832_1897186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375862.1|1897486_1899214_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_047927270.1|1899317_1900043_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	38.7	6.4e-31
WP_017375864.1|1900035_1901274_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_017375865.1|1901411_1902449_+	agmatine deiminase family protein	NA	NA	NA	NA	NA
WP_017375866.1|1902503_1903406_+	carbon-nitrogen hydrolase	NA	M1HCD5	Acanthocystis_turfacea_Chlorella_virus	40.7	3.2e-56
WP_017375867.1|1903515_1904769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242968.1|1904826_1908318_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_144420795.1|1908434_1909112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375871.1|1909239_1909788_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_048875857.1|1910012_1910987_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
WP_017375873.1|1911658_1911820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063558.1|1913011_1913578_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	77.8	2.8e-74
WP_087910646.1|1913580_1914705_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_026063557.1|1914789_1915608_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_027242970.1|1915738_1917718_+	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_017376714.1|1917777_1918431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999995.1|1919115_1920486_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376707.1|1922201_1922849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376706.1|1922886_1923279_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017376705.1|1923531_1924278_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027243123.1|1924876_1925782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1925897_1926872_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376701.1|1927017_1927746_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_017376700.1|1927865_1928447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243124.1|1928469_1931310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376696.1|1933352_1934303_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_017376695.1|1934385_1935168_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_027243125.1|1935266_1935560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376693.1|1936082_1936727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376692.1|1936760_1937405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376691.1|1937453_1938308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376690.1|1938445_1938958_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_107517381.1|1939025_1939220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376688.1|1939433_1939787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1940995_1941970_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 20
NZ_CP013975	Piscirickettsia salmonis strain CGR02, complete genome	3205229	1949049	2005185	3205229	tRNA,transposase	Burkholderia_virus(33.33%)	52	NA	NA
WP_017377787.1|1949049_1949277_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_048876026.1|1950559_1950826_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420796.1|1951055_1952174_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036774270.1|1952318_1952654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929523.1|1952664_1953078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375562.1|1954286_1954451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|1954487_1955363_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_051929862.1|1955549_1956062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375899.1|1958493_1959693_-	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_017375900.1|1959946_1960228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927375.1|1960283_1962275_-	TRAP transporter permease	NA	NA	NA	NA	NA
WP_026063491.1|1962348_1963326_-	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_027242984.1|1963461_1964244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774087.1|1964400_1964724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876030.1|1964791_1965895_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036772169.1|1965964_1966840_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_047927184.1|1966836_1967181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963581.1|1967190_1967652_+	murein L,D-transpeptidase catalytic domain family protein	NA	NA	NA	NA	NA
WP_027242985.1|1967665_1969057_-	flagellar hook-associated protein 3	NA	NA	NA	NA	NA
WP_027242986.1|1969098_1972086_-	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_027242987.1|1972155_1972989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910648.1|1973043_1974231_-	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
WP_027242989.1|1974218_1974923_-	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_027242990.1|1974968_1975754_-	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_027242991.1|1975781_1976519_-	flagellar basal body rod protein FlgF	NA	NA	NA	NA	NA
WP_016210285.1|1976623_1978819_-	flagellar hook-basal body complex protein	NA	NA	NA	NA	NA
WP_027242992.1|1978893_1979577_-	flagellar hook assembly protein FlgD	NA	NA	NA	NA	NA
WP_027242993.1|1979587_1980019_-	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_027242994.1|1980064_1980463_-	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_027242995.1|1980839_1981547_+	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_027242996.1|1981611_1981908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242997.1|1981949_1982426_+	flagellar protein FlgN	NA	NA	NA	NA	NA
WP_027242998.1|1982479_1983001_-	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	53.4	3.8e-25
WP_027242999.1|1983082_1984177_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_048876031.1|1985143_1986547_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375890.1|1986716_1987280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375891.1|1987415_1988891_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_017375892.1|1988897_1989104_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_017375893.1|1989161_1990232_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_027243001.1|1990429_1992400_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	36.9	7.2e-77
WP_017375757.1|1992760_1994320_+	APC family permease	NA	NA	NA	NA	NA
WP_017375758.1|1994613_1994820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420701.1|1994916_1995273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243002.1|1996113_1996773_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_027243003.1|1996868_1998230_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_017377787.1|1998371_1998599_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017375762.1|1999650_2000991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963648.1|2001641_2001803_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036815628.1|2001902_2002730_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420702.1|2003083_2003959_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.3	1.4e-19
WP_036771330.1|2004002_2004977_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_047927692.1|2004996_2005185_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 21
NZ_CP013975	Piscirickettsia salmonis strain CGR02, complete genome	3205229	2022687	2084777	3205229	transposase	Staphylococcus_phage(22.22%)	44	NA	NA
WP_062365727.1|2022687_2023380_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375561.1|2023376_2023520_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|2024863_2025091_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017375766.1|2026397_2028428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062365729.1|2029424_2029808_-	FUSC family protein	NA	NA	NA	NA	NA
WP_027242772.1|2029800_2030847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771312.1|2030987_2031983_+	glycosyl hydrolase family 17	NA	NA	NA	NA	NA
WP_048876036.1|2032280_2032919_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	2.1e-09
WP_017375978.1|2033632_2034820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375977.1|2034985_2035939_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036771316.1|2035961_2037980_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_017375975.1|2038068_2038392_-	YqcC family protein	NA	NA	NA	NA	NA
WP_155046584.1|2038640_2038817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053093677.1|2039044_2039764_+|transposase	IS982-like element ISPsa1 family transposase	transposase	NA	NA	NA	NA
WP_016209463.1|2040379_2040763_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_048876037.1|2041407_2041881_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_027242774.1|2041986_2043357_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_048876038.1|2043472_2044204_+	hypothetical protein	NA	M1IDP9	Pelagibacter_phage	35.8	9.1e-09
WP_027242775.1|2044228_2045326_-	alanine racemase	NA	NA	NA	NA	NA
WP_048876039.1|2045361_2046780_-	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	62.1	2.0e-153
WP_027242777.1|2046989_2047442_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_016209480.1|2047453_2047681_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_027242778.1|2047730_2048057_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_027242779.1|2048260_2048950_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_036771340.1|2049098_2049587_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_036771342.1|2049627_2050728_-	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_027242782.1|2050773_2051856_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	42.4	4.5e-73
WP_080963651.1|2051848_2052409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771345.1|2052399_2053704_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_027242784.1|2053757_2054306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|2054358_2055336_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_146619549.1|2056427_2059595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929877.1|2059946_2060570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378208.1|2061352_2062903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378207.1|2063197_2063953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|2064661_2065636_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017378201.1|2068544_2069216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875961.1|2070294_2071698_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242788.1|2073285_2076687_-	AAA family ATPase	NA	S5M596	Bacillus_phage	23.3	4.5e-10
WP_017378193.1|2076683_2079377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378192.1|2079680_2081180_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	28.1	2.2e-33
WP_027242789.1|2081846_2082668_-	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
WP_146619408.1|2082739_2083225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|2083373_2084777_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 22
NZ_CP013975	Piscirickettsia salmonis strain CGR02, complete genome	3205229	2089281	2214407	3205229	tRNA,protease,transposase	Staphylococcus_phage(19.05%)	111	NA	NA
WP_017377787.1|2089281_2089509_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_048876044.1|2090587_2091088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420799.1|2091577_2091751_+	phosphatase	NA	NA	NA	NA	NA
WP_144420800.1|2092048_2092750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375730.1|2092901_2094149_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	72.2	1.4e-14
WP_017375729.1|2094527_2095139_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_017375728.1|2095224_2096091_-	OmpA family protein	NA	NA	NA	NA	NA
WP_016211119.1|2096094_2096856_-	flagellar motor protein PomA	NA	NA	NA	NA	NA
WP_017375727.1|2097019_2097925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963658.1|2098147_2098963_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_017375724.1|2099148_2099538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375723.1|2099816_2100275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275340.1|2100545_2101154_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875904.1|2101684_2102560_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_051929548.1|2102800_2103475_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080999996.1|2103503_2103992_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	30.9	7.4e-15
WP_080999997.1|2105037_2105472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420717.1|2105677_2106760_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875941.1|2106756_2107068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927811.1|2107315_2108827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876046.1|2109787_2110081_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.4	4.1e-05
WP_144420706.1|2110038_2110617_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.8	1.1e-28
WP_048876047.1|2110702_2111578_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378015.1|2111570_2111927_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	52.0	3.5e-22
WP_017378014.1|2111935_2112331_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_082300708.1|2113655_2114216_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046583.1|2115338_2117240_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_027243106.1|2117262_2118468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420707.1|2118470_2119769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155051397.1|2119749_2120889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243103.1|2121022_2121823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377848.1|2121819_2122218_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_027243102.1|2122214_2122523_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_017377694.1|2122916_2123645_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_017377851.1|2123685_2124330_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_017377852.1|2124342_2124810_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_036771330.1|2124864_2125839_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080963625.1|2125868_2126486_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_017377855.1|2126464_2126926_-	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_017377856.1|2126969_2127905_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_017377857.1|2127932_2128928_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_017377858.1|2129141_2130104_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377694.1|2131243_2131972_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_080963626.1|2132022_2133657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377862.1|2133927_2135115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377863.1|2135716_2136154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377865.1|2138687_2138960_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_036772457.1|2139035_2139344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772454.1|2141819_2142137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2142293_2143268_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420708.1|2143264_2143654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876052.1|2143734_2144481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|2144449_2145178_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_017377223.1|2145922_2146210_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_155046582.1|2146269_2146434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876053.1|2146430_2147834_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420658.1|2147866_2148628_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.3	6.9e-44
WP_017376296.1|2148913_2149630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876055.1|2150407_2151313_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376294.1|2151799_2153092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146619460.1|2153327_2156111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420709.1|2157764_2158184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376289.1|2158184_2158886_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144420801.1|2159147_2159330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773579.1|2159583_2159958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420802.1|2160067_2162059_-	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_016211518.1|2162048_2163095_-	glutathione synthase	NA	NA	NA	NA	NA
WP_017376284.1|2163535_2164387_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	2.7e-12
WP_017376283.1|2164387_2165305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046581.1|2165700_2165874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771957.1|2166476_2167448_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080963609.1|2169635_2170802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377033.1|2171141_2171453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046580.1|2171930_2172173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242870.1|2172557_2173088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377031.1|2173534_2174464_-	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	30.6	2.2e-31
WP_144420711.1|2174620_2175046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375625.1|2175162_2175390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2175543_2176518_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080999998.1|2176784_2177054_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420803.1|2177198_2178155_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080963583.1|2178315_2179242_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_062365733.1|2179694_2180300_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211971.1|2180501_2181113_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_051929560.1|2181133_2182333_-	site-specific DNA-methyltransferase	NA	A0A2L1IZ21	Streptomyces_phage	33.2	2.7e-42
WP_017377024.1|2182427_2182568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377023.1|2182580_2182985_-	SufE family protein	NA	NA	NA	NA	NA
WP_017377022.1|2183215_2183785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377021.1|2183851_2184892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|2184918_2185146_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_027242872.1|2186196_2187054_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_144420712.1|2187050_2187812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242873.1|2187896_2190626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875904.1|2190759_2191635_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027242874.1|2191899_2192874_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_016209885.1|2193302_2194016_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_027242875.1|2194184_2194676_+	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
WP_017377014.1|2194815_2195307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242876.1|2195509_2196400_+	Rossmann-like and DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_026063591.1|2196784_2197369_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_027242877.1|2197449_2198388_-	signal peptide peptidase SppA	NA	A0A2I6UGK8	Salinibacter_virus	30.1	4.9e-15
WP_036771855.1|2198439_2199534_-	fusaric acid resistance family protein	NA	NA	NA	NA	NA
WP_047927528.1|2199658_2200981_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	39.9	7.3e-65
WP_017377008.1|2201028_2205915_-	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_017377007.1|2206009_2206312_-	DUF2835 family protein	NA	NA	NA	NA	NA
WP_027242879.1|2206422_2208345_+	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_027242880.1|2208366_2209662_+	YeaH/YhbH family protein	NA	A0A219UQP6	Bacillus_phage	32.8	1.2e-06
WP_017377006.1|2209658_2211269_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_052106204.1|2211375_2212269_-	thiol:disulfide interchange protein DsbG	NA	NA	NA	NA	NA
WP_017377003.1|2212378_2213002_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_017377001.1|2213708_2214407_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
>prophage 23
NZ_CP013975	Piscirickettsia salmonis strain CGR02, complete genome	3205229	2226218	2281544	3205229	transposase	Staphylococcus_phage(41.67%)	48	NA	NA
WP_048876012.1|2226218_2227622_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376989.1|2227781_2228330_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_016210338.1|2228449_2228587_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|2228654_2228882_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_144420713.1|2230581_2231283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774751.1|2231512_2232436_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_047927028.1|2232449_2233373_+	PAS and helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_027243112.1|2233320_2233977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243113.1|2234279_2235107_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_017376518.1|2235257_2235629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927029.1|2235857_2237348_+	nuclease	NA	NA	NA	NA	NA
WP_017376516.1|2237415_2238753_-	N-succinylarginine dihydrolase	NA	NA	NA	NA	NA
WP_017376515.1|2238895_2240362_-	succinylglutamate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_017376514.1|2240358_2241408_-	arginine N-succinyltransferase	NA	NA	NA	NA	NA
WP_027243115.1|2241531_2243640_-	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_016210305.1|2243802_2244207_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016210308.1|2244268_2244994_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_017376511.1|2245079_2245973_+	YicC family protein	NA	NA	NA	NA	NA
WP_017376510.1|2246013_2246634_+	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	34.5	1.4e-18
WP_016210310.1|2246694_2246901_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_017376509.1|2246922_2249067_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	37.1	1.0e-12
WP_017376506.1|2251262_2252186_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	40.4	4.3e-24
WP_017376505.1|2252252_2253536_+	MFS transporter	NA	NA	NA	NA	NA
WP_036771330.1|2253776_2254751_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155046579.1|2255066_2255228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|2255224_2256628_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377823.1|2256741_2257509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062365735.1|2257867_2259271_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080963604.1|2260091_2260292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377826.1|2260532_2261978_+	MFS transporter	NA	NA	NA	NA	NA
WP_048875904.1|2263173_2264049_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027243174.1|2265500_2265782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046578.1|2266000_2266180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927196.1|2266339_2267359_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_017376520.1|2267345_2267768_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_017376521.1|2267769_2268243_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	43.4	2.4e-26
WP_017376522.1|2268368_2269025_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.2	6.8e-40
WP_017376523.1|2269021_2269696_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.7	6.0e-31
WP_017376524.1|2269701_2270850_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.8	4.7e-44
WP_017376525.1|2270846_2271308_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_017376526.1|2271383_2272634_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.4	2.4e-102
WP_017376527.1|2272760_2274440_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.6	3.0e-39
WP_027243172.1|2274551_2275433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772261.1|2276677_2277271_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_075275347.1|2277632_2278148_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375618.1|2279087_2279372_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420804.1|2279921_2280197_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|2280569_2281544_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 24
NZ_CP013975	Piscirickettsia salmonis strain CGR02, complete genome	3205229	2353420	2400135	3205229	tRNA,transposase	Synechococcus_phage(20.0%)	40	NA	NA
WP_048875859.1|2353420_2354215_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_036773621.1|2354504_2355428_-	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_017377984.1|2355695_2355989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377983.1|2357191_2358115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377982.1|2358250_2359093_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_017377981.1|2359180_2359831_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	34.6	2.7e-20
WP_017377980.1|2359844_2360885_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SR00	Cyanophage	45.3	2.9e-69
WP_036773623.1|2361007_2362093_+	DUF2066 domain-containing protein	NA	NA	NA	NA	NA
WP_027243121.1|2362119_2363229_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_017377976.1|2363533_2363851_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_017377975.1|2363847_2364207_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_017377974.1|2364309_2367042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081000000.1|2368537_2369215_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_144420807.1|2369461_2369680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155048033.1|2369824_2371033_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_065653755.1|2371460_2372918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375695.1|2373753_2374029_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036773050.1|2376732_2376912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063690.1|2376908_2377280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420717.1|2377290_2378373_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155635851.1|2378369_2378603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275437.1|2379576_2379795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212534.1|2380285_2380552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420719.1|2380810_2381131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062365739.1|2382516_2383767_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_017377905.1|2383755_2384637_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_017377906.1|2384629_2385715_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.2	4.3e-07
WP_017377908.1|2387140_2387800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065653730.1|2387970_2388633_+	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_026063691.1|2388979_2389927_+	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.3	3.4e-40
WP_017377911.1|2390023_2390650_+	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_017377912.1|2390655_2391237_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_017377913.1|2391308_2392400_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_017377914.1|2392489_2393203_+	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_027243155.1|2393296_2394121_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_144420808.1|2394354_2395032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377920.1|2396709_2396967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|2397367_2398342_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_048876067.1|2398516_2399161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046574.1|2399340_2400135_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 25
NZ_CP013975	Piscirickettsia salmonis strain CGR02, complete genome	3205229	2405830	2442109	3205229	protease,transposase	Acinetobacter_phage(25.0%)	34	NA	NA
WP_087910651.1|2405830_2406007_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	46.2	5.5e-05
WP_053856762.1|2406302_2406737_-	hypothetical protein	NA	A0A0P0IY73	Acinetobacter_phage	38.0	7.7e-16
WP_017377929.1|2406930_2408400_-	glycine dehydrogenase subunit 2	NA	M4QFZ1	Prochlorococcus_phage	41.7	2.7e-84
WP_027243054.1|2408393_2409770_-	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	34.6	4.2e-47
WP_017377930.1|2409782_2410175_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_017377931.1|2410171_2411275_-	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_144420809.1|2411453_2412746_-	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_017377933.1|2412756_2413704_-	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	37.6	3.5e-37
WP_027243055.1|2413715_2414528_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_087910662.1|2414530_2415310_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_017377934.1|2415324_2416383_-	lipopolysaccharide heptosyltransferase I	NA	NA	NA	NA	NA
WP_017377935.1|2416379_2417390_-	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_016209904.1|2417396_2417594_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_048876070.1|2417654_2420561_-	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_017377937.1|2420602_2421454_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_144420810.1|2421536_2422082_-	chorismate lyase	NA	NA	NA	NA	NA
WP_027243057.1|2422179_2423040_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_155046572.1|2423125_2423548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377942.1|2423629_2424136_+|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_027243059.1|2424181_2427133_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_017377945.1|2427154_2427487_+	GIY-YIG nuclease family protein	NA	D7F5V9	Apocheima_cinerarium_nucleopolyhedrovirus	34.2	4.7e-05
WP_047927125.1|2427604_2428114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046571.1|2428647_2428803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774650.1|2429877_2431044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377687.1|2431188_2431941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2432296_2433271_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_016209908.1|2433403_2434114_+	response regulator	NA	W8CYM9	Bacillus_phage	34.8	2.2e-31
WP_017377690.1|2434110_2435145_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	34.2	1.3e-32
WP_146619455.1|2435248_2435506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876071.1|2436100_2437261_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.0	3.8e-25
WP_069971647.1|2437229_2437826_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046570.1|2438794_2438965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2438961_2439936_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_087910645.1|2440955_2442109_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
>prophage 26
NZ_CP013975	Piscirickettsia salmonis strain CGR02, complete genome	3205229	2487211	2553112	3205229	tRNA,plate,transposase	Staphylococcus_phage(18.18%)	56	NA	NA
WP_027242858.1|2487211_2488519_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_027242859.1|2488523_2489234_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_027242860.1|2489246_2492417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242861.1|2492483_2493620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376336.1|2494482_2495340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376335.1|2495481_2496282_-	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_017376334.1|2496380_2496956_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	50.0	3.2e-57
WP_027242862.1|2497038_2497710_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_027242863.1|2497755_2498655_+	DUF3530 family protein	NA	NA	NA	NA	NA
WP_017376331.1|2498689_2499073_-	response regulator	NA	NA	NA	NA	NA
WP_080963653.1|2499222_2500053_-	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_017376328.1|2500686_2501712_-	phosphotransferase	NA	NA	NA	NA	NA
WP_048876074.1|2501842_2504347_+	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_017376325.1|2504353_2505622_+	peptidyl-prolyl cis-trans isomerase SurA	NA	NA	NA	NA	NA
WP_017376324.1|2505623_2506607_+	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_017376323.1|2506619_2507441_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_017376322.1|2507485_2507878_+	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_017376321.1|2507952_2508759_+	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	NA	NA	NA	NA
WP_036774104.1|2508946_2509375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2509433_2510408_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017375660.1|2510431_2510869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|2510903_2512307_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376011.1|2512887_2513049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376015.1|2514269_2514641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242569.1|2514748_2516299_-	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_017376017.1|2516331_2517171_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_017376018.1|2517167_2517683_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_017376019.1|2517686_2518679_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.1	9.3e-49
WP_017376020.1|2519057_2520428_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_027242570.1|2520636_2521776_+	hypothetical protein	NA	A0A0F6YPT7	Sinorhizobium_phage	41.7	9.3e-61
WP_062365741.1|2521989_2522592_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	3.0e-10
WP_036816881.1|2523275_2523494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376024.1|2523571_2523820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772149.1|2529475_2530156_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017376634.1|2530220_2531507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376633.1|2532108_2532378_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_144420813.1|2532561_2533533_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.3	3.0e-15
WP_017376631.1|2533600_2534575_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.3	7.3e-14
WP_017376630.1|2534672_2535749_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_144420721.1|2535829_2536822_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_036772145.1|2536826_2538629_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_027243119.1|2538646_2539948_-	aspartate kinase	NA	NA	NA	NA	NA
WP_027243118.1|2539963_2541247_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_017376625.1|2541379_2541772_+	RidA family protein	NA	NA	NA	NA	NA
WP_017376624.1|2541878_2542964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376623.1|2543179_2544196_-	bifunctional UDP-4-keto-pentose/UDP-xylose synthase	NA	D5GW02	Campylobacter_virus	28.7	1.9e-12
WP_017376622.1|2544198_2545206_-	glycosyltransferase	NA	B9UDL7	Salmonella_phage	34.4	2.2e-37
WP_026063550.1|2545209_2546364_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2K9L0G1	Tupanvirus	33.0	3.9e-38
WP_016209558.1|2546378_2546741_-	small Multidrug Resistance family protein	NA	NA	NA	NA	NA
WP_027243117.1|2546737_2548453_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_026063546.1|2548552_2549227_+|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_017376619.1|2549255_2549660_+	RidA family protein	NA	NA	NA	NA	NA
WP_027243116.1|2549684_2550644_-	response regulator	NA	NA	NA	NA	NA
WP_017376616.1|2550776_2551559_-	MFS transporter	NA	NA	NA	NA	NA
WP_075275357.1|2551660_2552620_+|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	34.3	1.2e-13
WP_017376613.1|2552764_2553112_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 27
NZ_CP013975	Piscirickettsia salmonis strain CGR02, complete genome	3205229	2557113	2620914	3205229	transposase	Planktothrix_phage(10.0%)	51	NA	NA
WP_144420814.1|2557113_2558031_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875984.1|2558175_2558712_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_051929685.1|2558971_2559874_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_017376607.1|2560863_2561853_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G9BWD6	Planktothrix_phage	32.4	4.5e-19
WP_017376606.1|2562021_2562360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376605.1|2562356_2562932_+	ribonuclease HI	NA	M4QMN0	Micromonas_pusilla_virus	55.1	1.1e-33
WP_017376604.1|2562980_2563196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376603.1|2563382_2564222_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	1.4e-45
WP_017376601.1|2567918_2568827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875882.1|2568957_2569614_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_053856764.1|2569722_2570649_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036772137.1|2570967_2571528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377036.1|2571997_2573317_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_017377037.1|2573384_2574251_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	6.3e-25
WP_036772169.1|2574243_2575119_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377039.1|2575177_2575396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377041.1|2576796_2577126_-	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_017377043.1|2578044_2580273_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	34.8	1.7e-82
WP_017377044.1|2580535_2581549_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_017377045.1|2581657_2581879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377046.1|2581883_2583521_-	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	37.8	3.4e-88
WP_017377047.1|2583659_2584193_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_062365742.1|2584313_2585426_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_062365744.1|2585425_2586694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377052.1|2588129_2588555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242609.1|2591884_2592238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|2592272_2593148_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_051929903.1|2593304_2593709_-	heavy metal-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_051929897.1|2593856_2595032_-	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_027242610.1|2595291_2595795_-	peptide deformylase	NA	A0A1D8KUY1	Synechococcus_phage	33.1	2.1e-09
WP_017377059.1|2595834_2597319_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.0	8.5e-46
WP_017377060.1|2597542_2598496_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	27.9	2.9e-31
WP_027242611.1|2598476_2599568_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_027242612.1|2599870_2600113_-	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_155046568.1|2601013_2601172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377064.1|2601180_2601756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420722.1|2601872_2602055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377065.1|2602630_2602903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377066.1|2603055_2603310_-	DUF493 domain-containing protein	NA	NA	NA	NA	NA
WP_027242613.1|2603424_2604828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377069.1|2604912_2605419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377070.1|2605983_2607804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242614.1|2607870_2608401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774569.1|2609947_2610664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774567.1|2610706_2611144_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017377073.1|2611181_2612561_-	MFS transporter	NA	NA	NA	NA	NA
WP_017377074.1|2612955_2614950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377075.1|2615414_2616227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420815.1|2616410_2617874_-	nuclease	NA	NA	NA	NA	NA
WP_017377077.1|2618233_2619613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772726.1|2620365_2620914_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.3	1.1e-06
>prophage 28
NZ_CP013975	Piscirickettsia salmonis strain CGR02, complete genome	3205229	2652707	2696067	3205229	transposase	Staphylococcus_phage(22.22%)	42	NA	NA
WP_036773116.1|2652707_2653682_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_069971661.1|2653678_2654116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875878.1|2654290_2655694_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377105.1|2655704_2655980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377106.1|2656257_2656728_-	Hsp20 family protein	NA	A0A1B1IW69	uncultured_Mediterranean_phage	36.6	6.0e-22
WP_017377107.1|2657030_2658401_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.1	1.5e-110
WP_075275363.1|2658730_2659198_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_017377110.1|2659210_2660221_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_053856766.1|2660422_2661826_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242632.1|2662252_2663041_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_047927448.1|2663027_2664056_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.0	1.4e-15
WP_017377113.1|2664033_2664438_-	glycine-rich domain-containing protein-like	NA	NA	NA	NA	NA
WP_017377115.1|2664665_2666633_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_017377116.1|2666828_2667320_+	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_026063598.1|2667354_2668197_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_017377118.1|2668242_2668695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377119.1|2668984_2669617_+	LysE family translocator	NA	NA	NA	NA	NA
WP_017377120.1|2669617_2670868_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.4	2.7e-93
WP_027242633.1|2670901_2671999_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	34.9	3.5e-49
WP_144420723.1|2672328_2673714_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036774495.1|2673753_2674011_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_053856767.1|2676426_2677830_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375801.1|2677826_2678867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927106.1|2679259_2679655_+	YchJ family protein	NA	NA	NA	NA	NA
WP_144420816.1|2679651_2680440_-	DUF45 domain-containing protein	NA	NA	NA	NA	NA
WP_017375804.1|2680625_2681351_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_017375805.1|2681595_2682783_+	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_017375806.1|2683075_2683618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375807.1|2683614_2684301_-	acireductone synthase	NA	NA	NA	NA	NA
WP_017375808.1|2684304_2684916_-	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_017375809.1|2684962_2685982_-	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_017375810.1|2686084_2686879_-	thymidylate synthase	NA	A0A2R4A1R4	Microbacterium_phage	69.0	1.1e-103
WP_017375811.1|2686892_2687693_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_017375812.1|2687771_2688821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063478.1|2688996_2690277_+	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	34.7	4.6e-24
WP_027242634.1|2690322_2691000_+	TIGR00153 family protein	NA	NA	NA	NA	NA
WP_017375815.1|2691085_2691367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275366.1|2691458_2692313_-	MFS transporter	NA	NA	NA	NA	NA
WP_026063480.1|2692252_2692651_-	MFS transporter	NA	S4TR35	Salmonella_phage	31.4	1.2e-07
WP_027242636.1|2693178_2694120_+	DMT family transporter	NA	NA	NA	NA	NA
WP_017375821.1|2694838_2695060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420724.1|2695056_2696067_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 29
NZ_CP013975	Piscirickettsia salmonis strain CGR02, complete genome	3205229	2749048	2784988	3205229	transposase	Staphylococcus_phage(16.67%)	31	NA	NA
WP_053856766.1|2749048_2750452_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377364.1|2750571_2751408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774259.1|2751557_2752532_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_027242659.1|2752840_2753866_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	76.9	2.0e-17
WP_087910663.1|2753973_2755176_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	26.6	1.7e-36
WP_017377360.1|2755413_2755827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377358.1|2756328_2756898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377357.1|2756900_2757239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377356.1|2757231_2757765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377355.1|2757783_2758074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242660.1|2758160_2759792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377353.1|2760344_2760848_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A167R6J9	Powai_lake_megavirus	41.2	1.9e-13
WP_017377352.1|2760810_2761518_-	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_017377351.1|2761582_2762443_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_017377350.1|2762423_2763197_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017377349.1|2763227_2764466_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_036773024.1|2764465_2765428_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_017377348.1|2765471_2766224_+	ComF family protein	NA	NA	NA	NA	NA
WP_017377345.1|2768752_2768989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420819.1|2769007_2769457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377343.1|2769677_2771102_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	M4QSA2	Synechococcus_phage	42.3	1.0e-16
WP_052106221.1|2771166_2772216_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_036818827.1|2772506_2773238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420730.1|2773268_2774159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377336.1|2775501_2778312_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_048875864.1|2778604_2779630_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_080963630.1|2780013_2780871_+	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_017377694.1|2781040_2781769_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_048876012.1|2781969_2783373_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376920.1|2783518_2784016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875863.1|2784085_2784988_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 30
NZ_CP013975	Piscirickettsia salmonis strain CGR02, complete genome	3205229	2808197	2848413	3205229	tRNA,protease,transposase	Staphylococcus_phage(42.86%)	45	NA	NA
WP_069971662.1|2808197_2809172_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	9.5e-30
WP_027242664.1|2809455_2810658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929598.1|2810954_2811212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275367.1|2811169_2811610_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_053856769.1|2811715_2812282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875862.1|2812426_2812681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875861.1|2812825_2813695_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036774534.1|2813699_2814125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063584.1|2814216_2815176_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_017376953.1|2815172_2815820_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_017376954.1|2815848_2816700_-	D-amino acid aminotransferase	NA	NA	NA	NA	NA
WP_017376955.1|2816714_2817992_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	39.0	2.8e-66
WP_017376956.1|2818032_2818548_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_017376957.1|2818625_2819687_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_036818645.1|2819708_2820797_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_017376959.1|2820841_2822677_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_016210381.1|2822719_2823190_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_016210374.1|2823226_2823562_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_080963574.1|2823574_2824291_-	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_036772771.1|2824227_2825268_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_017376963.1|2825240_2825720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376964.1|2825806_2828287_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	43.8	3.8e-192
WP_036772765.1|2828349_2828781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376966.1|2828981_2829272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242666.1|2829331_2830930_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.1	7.1e-06
WP_017376969.1|2831094_2831430_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_017376970.1|2831458_2833123_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5ERK4	Ostreococcus_lucimarinus_virus	28.8	6.4e-34
WP_027242667.1|2833122_2833764_-	lipoprotein	NA	NA	NA	NA	NA
WP_017376972.1|2833763_2834507_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_017376973.1|2834565_2834802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376974.1|2834952_2836320_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	29.9	1.6e-43
WP_017376975.1|2836330_2836882_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_065653729.1|2836962_2838066_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_017376977.1|2838067_2839825_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_062312189.1|2840047_2840671_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_016210574.1|2840725_2841145_-	prokaryotic dksA/traR C4-type zinc finger family protein	NA	NA	NA	NA	NA
WP_047927116.1|2841285_2841900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242668.1|2841957_2842743_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017376980.1|2843374_2844391_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_144420820.1|2844393_2844906_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_017376982.1|2844947_2845421_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_048875860.1|2845476_2846262_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
WP_036771653.1|2846305_2847046_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	1.9e-09
WP_017376985.1|2847135_2847384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910654.1|2847759_2848413_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 31
NZ_CP013975	Piscirickettsia salmonis strain CGR02, complete genome	3205229	2935810	3047890	3205229	tRNA,protease,transposase	Staphylococcus_phage(12.5%)	102	NA	NA
WP_017378106.1|2935810_2936755_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_017378107.1|2936754_2937108_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_017378108.1|2937156_2939832_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.1	1.3e-25
WP_017378109.1|2939848_2941366_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_016209273.1|2941442_2941895_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_017378110.1|2942113_2943553_-	NADH-quinone oxidoreductase subunit NuoN	NA	NA	NA	NA	NA
WP_017378111.1|2943552_2945091_-	NADH-quinone oxidoreductase subunit M	NA	NA	NA	NA	NA
WP_017378112.1|2945105_2947076_-	NADH-quinone oxidoreductase subunit L	NA	NA	NA	NA	NA
WP_016209309.1|2947079_2947385_-	NADH-quinone oxidoreductase subunit NuoK	NA	NA	NA	NA	NA
WP_017378113.1|2947408_2948032_-	NADH-quinone oxidoreductase subunit J	NA	NA	NA	NA	NA
WP_017378114.1|2948051_2948540_-	NADH-quinone oxidoreductase subunit NuoI	NA	NA	NA	NA	NA
WP_027242679.1|2948553_2949579_-	NADH-quinone oxidoreductase subunit NuoH	NA	NA	NA	NA	NA
WP_017378117.1|2949583_2951977_-	NADH-quinone oxidoreductase subunit G	NA	NA	NA	NA	NA
WP_016209307.1|2952026_2953316_-	NADH-quinone oxidoreductase subunit NuoF	NA	NA	NA	NA	NA
WP_017378118.1|2953322_2953823_-	NAD(P)H-dependent oxidoreductase subunit E	NA	NA	NA	NA	NA
WP_017378119.1|2953822_2955076_-	NADH-quinone oxidoreductase subunit D	NA	NA	NA	NA	NA
WP_017378120.1|2955077_2955755_-	NADH-quinone oxidoreductase subunit C	NA	NA	NA	NA	NA
WP_016209262.1|2955772_2956258_-	NADH-quinone oxidoreductase subunit B	NA	NA	NA	NA	NA
WP_016209283.1|2956248_2956617_-	NADH-ubiquinone/plastoquinone oxidoreductase chain 3	NA	NA	NA	NA	NA
WP_017378122.1|2957295_2957658_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_017378123.1|2957671_2958433_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_017378124.1|2958734_2960081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771461.1|2960177_2960720_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	NA	NA	NA	NA
WP_017378126.1|2960835_2961669_+	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_027242680.1|2961690_2962284_+	thymidine kinase	NA	A0A0B7MRR0	Enterobacteria_phage	53.6	6.4e-53
WP_048875856.1|2962459_2963479_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375571.1|2963749_2964151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378129.1|2964161_2964485_-	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_065653735.1|2964508_2965519_-	lipase	NA	NA	NA	NA	NA
WP_017378132.1|2965585_2966434_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_026063707.1|2966550_2967462_-	Nudix family hydrolase	NA	NA	NA	NA	NA
WP_036772169.1|2968228_2969104_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_026063708.1|2969162_2969543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063709.1|2969689_2969926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378135.1|2970222_2970693_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_017378136.1|2970747_2971602_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_017378137.1|2972073_2972292_+	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_017378138.1|2972394_2973645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242681.1|2973700_2974183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242682.1|2974419_2974848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|2975183_2976158_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017378141.1|2976216_2977269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378142.1|2977587_2978553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378143.1|2978855_2979680_-	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_017378144.1|2979881_2980958_+	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_017378145.1|2981042_2982029_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_017378146.1|2982047_2982692_+	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_027242684.1|2982703_2983813_+	histidinol-phosphate transaminase	NA	A0A142C026	Faustovirus	23.5	1.6e-17
WP_027242685.1|2983879_2984542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242686.1|2984801_2986685_-	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_017378149.1|2986998_2988498_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_017378150.1|2988588_2989371_+	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	33.0	1.8e-31
WP_017378151.1|2989498_2990419_+	SPFH/Band 7/PHB domain protein	NA	J3IZE5	Acanthamoeba_polyphaga_lentillevirus	27.5	2.2e-20
WP_017378152.1|2990442_2990901_+	NfeD family protein	NA	NA	NA	NA	NA
WP_048875854.1|2991022_2991898_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378154.1|2991931_2993197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|2993384_2994260_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048875853.1|2994458_2994650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875852.1|2994854_2996150_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275379.1|2996469_2996688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375941.1|2996724_2998104_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	30.9	3.0e-53
WP_017375942.1|2998131_2998590_-	dUTP diphosphatase	NA	G0YQD9	Erwinia_phage	68.0	3.5e-51
WP_036773720.1|2998567_2999785_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.3	6.3e-39
WP_017375944.1|2999977_3000214_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_016210730.1|3000227_3000383_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_017375945.1|3000463_3001426_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017375947.1|3001585_3002902_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_017375948.1|3002911_3003580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375949.1|3003990_3005805_+	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	45.1	3.8e-24
WP_144420736.1|3006520_3006706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375951.1|3006887_3007346_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081078121.1|3008064_3008865_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377787.1|3008896_3009124_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_144420737.1|3010404_3010803_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081000012.1|3010806_3011049_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375794.1|3011938_3013690_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_017375795.1|3013700_3014501_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.1	3.4e-33
WP_017375796.1|3014603_3015092_-	dihydrofolate reductase	NA	A0A1B2IDT7	Erwinia_phage	43.1	4.5e-28
WP_047927156.1|3015591_3016515_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017375799.1|3016611_3016956_+	DMT family protein	NA	NA	NA	NA	NA
WP_017377528.1|3022650_3023613_-	hypothetical protein	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	28.1	7.0e-17
WP_036772663.1|3023651_3024527_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_026063646.1|3024786_3026046_-	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_016210045.1|3026268_3026595_-	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	46.2	1.5e-16
WP_048875850.1|3026789_3027740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242725.1|3027797_3029864_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_017377534.1|3029869_3030865_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_027242724.1|3031622_3033203_+	APC family permease	NA	NA	NA	NA	NA
WP_016210041.1|3033350_3034760_-	glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_017377536.1|3034819_3035953_-	cation transporter	NA	NA	NA	NA	NA
WP_017377537.1|3036091_3036916_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_017377539.1|3037439_3037652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046561.1|3037665_3037803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377540.1|3037940_3038174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210044.1|3039225_3039597_-	isochorismatase	NA	NA	NA	NA	NA
WP_017377542.1|3039907_3040195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377543.1|3040346_3041195_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_048875849.1|3041317_3042289_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377545.1|3042391_3043432_+	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_017377550.1|3045970_3046261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377551.1|3046528_3046789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|3046915_3047890_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 32
NZ_CP013975	Piscirickettsia salmonis strain CGR02, complete genome	3205229	3080884	3142291	3205229	tRNA,transposase	Acinetobacter_phage(33.33%)	57	NA	NA
WP_053093682.1|3080884_3081628_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377392.1|3082794_3083391_+	biotin/lipoyl-binding protein	NA	NA	NA	NA	NA
WP_017377391.1|3083661_3084240_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017377386.1|3089050_3090556_-	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_017377385.1|3090583_3090865_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_016209709.1|3091013_3091355_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_017377384.1|3091475_3093380_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_047927397.1|3093512_3095084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062365751.1|3095101_3096295_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_017377379.1|3096416_3097415_-	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_144420826.1|3097418_3098177_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_017377377.1|3098178_3099378_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_036771983.1|3099361_3100033_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_017377375.1|3100054_3100831_-	indole-3-glycerol-phosphate synthase	NA	A0A0P0IR83	Acinetobacter_phage	31.1	2.0e-22
WP_017377374.1|3100834_3101833_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	32.4	2.7e-40
WP_017377373.1|3101834_3102413_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	44.5	1.1e-44
WP_017377372.1|3102409_3103879_-	anthranilate synthase component I family protein	NA	NA	NA	NA	NA
WP_016209719.1|3103922_3104210_-	trp operon repressor	NA	NA	NA	NA	NA
WP_026063627.1|3104410_3105331_+	DMT family transporter	NA	NA	NA	NA	NA
WP_017377369.1|3105446_3106001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377368.1|3106116_3106542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771981.1|3106812_3107163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242711.1|3107356_3107896_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_017377365.1|3107980_3108517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242710.1|3109176_3109479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242709.1|3109927_3110497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771979.1|3110589_3110910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376171.1|3111088_3112063_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155046560.1|3112329_3112503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875961.1|3112608_3114012_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875844.1|3114016_3115036_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275373.1|3115652_3115982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378398.1|3116207_3116606_-	DUF3135 domain-containing protein	NA	NA	NA	NA	NA
WP_017378399.1|3117473_3118424_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_017378400.1|3118423_3120502_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_017378401.1|3120643_3121159_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_017378402.1|3121167_3121731_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_017378403.1|3121711_3122458_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_017378404.1|3122596_3123049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927132.1|3123184_3124021_+	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_027242707.1|3124017_3124914_+	DMT family transporter	NA	NA	NA	NA	NA
WP_017378407.1|3124946_3126014_+	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_016210352.1|3126032_3126401_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_080963575.1|3126426_3127878_-	potassium transporter	NA	NA	NA	NA	NA
WP_017378410.1|3127884_3129264_-	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_036773239.1|3129304_3130618_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_026063734.1|3130607_3131582_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	1.3e-10
WP_017378413.1|3131675_3132179_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.1	5.4e-13
WP_017378414.1|3132313_3133465_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_016210342.1|3133461_3133941_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_027242705.1|3134087_3136409_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	35.9	7.9e-99
WP_080963576.1|3136353_3136980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378416.1|3136984_3137884_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_036773242.1|3138064_3138619_+	DUF4823 domain-containing protein	NA	NA	NA	NA	NA
WP_036773116.1|3138986_3139961_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017378420.1|3140204_3140582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|3141316_3142291_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 1
NZ_CP013976	Piscirickettsia salmonis strain CGR02 plasmid pPSCRG02-1, complete sequence	115926	4907	54774	115926	terminase,portal,transposase	Streptococcus_phage(31.82%)	56	NA	NA
WP_062365762.1|4907_5366_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.9	3.5e-19
WP_032126795.1|7333_7594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772441.1|7597_7870_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_017375910.1|7945_8674_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_048876229.1|9242_10214_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_048876208.1|11078_11906_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.1	1.2e-17
WP_036771289.1|12759_13230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046633.1|14123_14267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212068.1|15246_15450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242940.1|15473_16073_-	DUF1353 domain-containing protein	NA	NA	NA	NA	NA
WP_017375850.1|16426_17203_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_036771279.1|17563_18292_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_155046634.1|18361_18562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876229.1|18480_19452_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_027242938.1|19865_20234_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_017375972.1|20235_20544_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017375841.1|20988_21198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242937.1|21504_21723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242936.1|21719_22172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242935.1|22314_22530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876207.1|23035_24511_-	response regulator	NA	NA	NA	NA	NA
WP_017375966.1|24511_25078_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_146619519.1|25222_25660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375964.1|25691_26117_-	hypothetical protein	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	43.9	5.1e-12
WP_036817204.1|26387_27383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036817201.1|27686_28094_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_017375960.1|28201_29245_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	44.0	2.2e-77
WP_017375959.1|29546_29780_+	hypothetical protein	NA	A0A0M3LQB1	Mannheimia_phage	45.2	5.1e-06
WP_146619517.1|29917_30070_-	phosphatase	NA	NA	NA	NA	NA
WP_081078123.1|30099_30462_+	HigA family addiction module antidote protein	NA	A0A2I7RIN6	Vibrio_phage	46.6	3.5e-06
WP_026063496.1|31340_31706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242932.1|31838_32066_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027242931.1|32074_32482_+	DUF4411 family protein	NA	NA	NA	NA	NA
WP_027242930.1|32627_34010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375952.1|34199_34403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242929.1|34598_34982_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	45.5	9.5e-26
WP_075278733.1|35068_35551_+|terminase	P27 family phage terminase small subunit	terminase	Q9B019	Phage_GMSE-1	33.3	8.1e-14
WP_048876205.1|35553_36885_+|terminase	terminase large subunit	terminase	A0A1W6JP18	Morganella_phage	46.3	6.1e-112
WP_048876204.1|37077_37524_+	hypothetical protein	NA	E4ZFM0	Streptococcus_phage	45.8	1.3e-26
WP_087910668.1|37610_37997_+|portal	phage portal protein	portal	Q6DMU2	Streptococcus_phage	50.0	2.1e-25
WP_036771649.1|38034_38769_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.9e-38
WP_048876202.1|38815_39529_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.2	3.2e-11
WP_144420848.1|40910_41096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243190.1|41099_44444_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_017377509.1|44624_45353_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
WP_075275482.1|45446_46421_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.8e-28
WP_027242596.1|46734_47097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242595.1|47136_47646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420849.1|47877_48858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|49323_50301_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_062365770.1|50382_50616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|50634_51612_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_027243211.1|52005_52260_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_027243212.1|52249_52537_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	50.5	9.6e-15
WP_036771347.1|53031_54009_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_051929558.1|54090_54774_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	33.3	5.1e-22
>prophage 2
NZ_CP013976	Piscirickettsia salmonis strain CGR02 plasmid pPSCRG02-1, complete sequence	115926	61826	70300	115926	transposase	Staphylococcus_phage(28.57%)	12	NA	NA
WP_075275474.1|61826_62939_-	replication initiation protein	NA	A0A218MNI2	uncultured_virus	29.8	2.1e-25
WP_017375840.1|63907_64126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052133264.1|64170_64575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243184.1|64588_64927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420841.1|64919_65144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046641.1|65170_65335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036815979.1|65515_66124_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.6	8.9e-10
WP_017375910.1|66126_66855_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_051929563.1|66877_67267_+	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	40.0	1.1e-10
WP_036772541.1|67296_68025_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_048876211.1|68036_68741_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.7	7.9e-10
WP_036771347.1|69322_70300_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
>prophage 1
NZ_CP013977	Piscirickettsia salmonis strain CGR02 plasmid pPSCRG02-2, complete sequence	33498	0	29171	33498	terminase,capsid,tail,head,integrase,transposase	unidentified_phage(38.89%)	33	4301:4360	26438:26729
WP_146619546.1|1474_1627_-	phosphatase	NA	NA	NA	NA	NA
WP_036771330.1|2005_2980_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_155046645.1|2999_3161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242941.1|3160_3814_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_048876242.1|3825_4203_-	hypothetical protein	NA	NA	NA	NA	NA
4301:4360	attL	AAACGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTT	NA	NA	NA	NA
WP_036773116.1|4687_5662_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	3.7e-26
WP_027242942.1|5681_6359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062365785.1|6358_7414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876241.1|7558_9535_-	host specificity protein J	NA	C7BGD4	Burkholderia_phage	37.8	3.7e-89
WP_027242943.1|9805_10222_-	hypothetical protein	NA	A0A2R3UA88	Siphoviridae_environmental_samples	41.7	2.2e-20
WP_027242944.1|10218_10776_-|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	36.2	7.9e-21
WP_027242945.1|11121_11637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420855.1|12440_12656_-|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_036771330.1|12729_13704_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_027242946.1|14084_14666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275490.1|14701_15094_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	45.0	7.0e-24
WP_036771330.1|15190_16165_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_027242948.1|16184_16370_-	hypothetical protein	NA	A0A1J0GUY5	Halomonas_phage	47.3	9.0e-06
WP_027242949.1|16372_16855_-|terminase	P27 family phage terminase small subunit	terminase	Q9B019	Phage_GMSE-1	34.0	3.6e-14
WP_027242950.1|16941_17325_-	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	46.3	4.3e-26
WP_027242951.1|17537_18404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|19029_20004_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_080963620.1|20101_20458_-	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	36.4	1.7e-16
WP_048876240.1|20441_20633_-	addiction module toxin, HicA family	NA	NA	NA	NA	NA
WP_027242954.1|20840_21206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971681.1|21738_22713_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	1.7e-26
WP_016211078.1|22889_23243_-	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	34.8	6.5e-13
WP_027242955.1|23235_23496_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_016212329.1|23726_24317_+|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	35.3	3.2e-20
WP_075278739.1|24382_24739_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|24852_25827_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_016211499.1|27194_28178_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
26438:26729	attR	AACCCGAACCTACCTCGGCCTACTCACCCCGTGCTTAGCACTCCATGGCTCGCAGCGTTTGTTTACTTCTATGCTTATCTAAAACTGTATCATCAACGACAAGTAAGCAAGGCTCTTCTGTATTAATTAGATCTTTTACAATATGCCAGATGTCTCTAGGGCGGTACTGCTGTGACTGAAGCCATCTGCTCACACTGTCATGAGAAAGAGGTTTCGGAGAAACTTCTGATAGAGCCAGCCCTGAATAACGTACGCTACTTGCCTGGAGAAATGCTTTATAAATCTCTTTTGT	NA	NA	NA	NA
WP_027242956.1|28193_29171_-	AAA family ATPase	NA	Q7M293	Enterobacteria_phage	32.7	7.8e-16
