The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013427	Burkholderia sp. MSMB0856 chromosome 1, complete sequence	3467548	384085	419906	3467548	plate,transposase,protease	uncultured_Caudovirales_phage(60.0%)	28	NA	NA
WP_059449799.1|384085_384607_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	52.0	9.6e-21
WP_059820897.1|385278_385482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059820898.1|385563_386364_-	cystine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_059820899.1|386701_389881_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	28.4	4.6e-57
WP_059820900.1|394556_395099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082750781.1|395959_396448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059820901.1|396973_397357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082750782.1|397419_397953_+	RHS repeat-associated core domain-containing protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	63.0	1.7e-20
WP_159085630.1|397921_398425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107938100.1|398610_399195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059820903.1|399407_399734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059820904.1|399818_400601_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_059532826.1|400597_401944_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_059532823.1|402047_402659_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_059532820.1|403036_403669_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_044845930.1|403713_404229_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_039320274.1|404244_405735_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_006477093.1|405805_406309_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_059465243.1|406553_407039_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_059532816.1|407118_408954_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_059820905.1|408917_410018_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_059820906.1|410062_412732_+	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	31.6	3.2e-88
WP_059820907.1|412776_413898_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_059820908.1|413963_416645_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	28.7	2.9e-52
WP_059820909.1|416647_418060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059820910.1|418056_418833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159085631.1|418847_419330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059531437.1|419363_419906_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP013427	Burkholderia sp. MSMB0856 chromosome 1, complete sequence	3467548	714031	723090	3467548		Hokovirus(16.67%)	7	NA	NA
WP_059535415.1|714031_715984_+	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	49.6	3.5e-148
WP_059820479.1|716237_717374_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	38.4	1.0e-22
WP_059820480.1|717378_719298_+	bifunctional anthranilate synthase component I family protein/class IV aminotransferase	NA	S4VT78	Pandoravirus	37.1	3.6e-57
WP_059820481.1|719433_720249_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	34.2	5.1e-37
WP_059820482.1|720293_720980_-	deoxynucleoside kinase	NA	A0A249XZR7	Enterococcus_phage	24.4	1.2e-05
WP_059535422.1|720976_721519_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_059820483.1|721554_723090_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	30.3	4.0e-22
>prophage 3
NZ_CP013427	Burkholderia sp. MSMB0856 chromosome 1, complete sequence	3467548	1640542	1646523	3467548		Pseudomonas_phage(66.67%)	7	NA	NA
WP_059817398.1|1640542_1640812_-	hypothetical protein	NA	Q3HQV5	Burkholderia_phage	69.9	1.6e-24
WP_059817400.1|1640808_1641159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059817403.1|1641155_1641605_-	hypothetical protein	NA	A9YX19	Burkholderia_phage	81.9	1.2e-67
WP_059817405.1|1641755_1643507_-	AAA family ATPase	NA	J7HXJ7	Pseudomonas_phage	36.6	9.6e-81
WP_059817499.1|1643503_1644355_-	DNA translocase FtsK	NA	J7I0T4	Pseudomonas_phage	35.2	7.5e-31
WP_059817408.1|1644418_1645699_-	hypothetical protein	NA	J7HXB6	Pseudomonas_phage	53.3	7.3e-62
WP_059817410.1|1645713_1646523_-	PD-(D/E)XK nuclease family protein	NA	J7HXJ4	Pseudomonas_phage	60.5	6.1e-91
>prophage 4
NZ_CP013427	Burkholderia sp. MSMB0856 chromosome 1, complete sequence	3467548	1649612	1683751	3467548	holin,plate,capsid,transposase,terminase	Burkholderia_phage(21.21%)	45	NA	NA
WP_082750605.1|1649612_1649894_+	hypothetical protein	NA	E5E3P2	Burkholderia_phage	50.6	6.1e-14
WP_159085645.1|1649895_1650063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059817432.1|1650056_1651730_+	DNA cytosine methyltransferase	NA	Q9ZXI4	Pseudomonas_virus	66.3	1.3e-196
WP_159085646.1|1651651_1652347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082750596.1|1652432_1653410_+	YdaU family protein	NA	A0A2I7QS92	Vibrio_phage	38.4	4.2e-09
WP_059817436.1|1653399_1653876_+	RusA family crossover junction endodeoxyribonuclease	NA	A9YWY9	Burkholderia_phage	70.8	6.6e-61
WP_059817438.1|1653887_1654067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059817440.1|1654069_1654660_+	hypothetical protein	NA	A9YWZ1	Burkholderia_phage	74.6	2.1e-80
WP_059817443.1|1655205_1655406_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_059817445.1|1655540_1657010_+	hypothetical protein	NA	A0A1P8VV91	Erythrobacter_phage	33.5	4.4e-103
WP_059817447.1|1657006_1657231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059817449.1|1657296_1657692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059817451.1|1657642_1659187_+|terminase	phage terminase large subunit	terminase	A0A291LBL3	Klebsiella_phage	46.5	3.6e-108
WP_059817454.1|1659190_1660624_+	DUF1073 domain-containing protein	NA	N0DQN3	Edwardsiella_phage	36.3	8.4e-67
WP_059817456.1|1660643_1661369_+|capsid	minor capsid protein	capsid	A0A2H4N7C8	Pectobacterium_phage	48.6	5.3e-25
WP_059817458.1|1661365_1662583_+	DUF2213 domain-containing protein	NA	A0A2D2W200	Sinorhizobium_phage	36.5	1.3e-39
WP_059817460.1|1662613_1663105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059817461.1|1663124_1664084_+	DUF2184 domain-containing protein	NA	M4SQD1	Psychrobacter_phage	31.8	1.4e-28
WP_059817463.1|1664093_1664513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059817465.1|1664509_1664899_+	DUF4054 domain-containing protein	NA	Q7Y5T9	Haemophilus_phage	33.6	8.8e-11
WP_059817466.1|1664895_1665366_+	hypothetical protein	NA	A0A291LCI6	Klebsiella_phage	37.6	3.3e-12
WP_059817468.1|1665349_1665721_+	hypothetical protein	NA	M4T3S0	Psychrobacter_phage	29.3	1.1e-05
WP_159085648.1|1665728_1666187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059817472.1|1666187_1667687_+	DUF3383 domain-containing protein	NA	Q7Y5T5	Haemophilus_phage	49.1	3.6e-129
WP_059817474.1|1667748_1668183_+	DUF3277 family protein	NA	Q7Y5T4	Haemophilus_phage	59.2	3.7e-42
WP_082750600.1|1668125_1668671_+	hypothetical protein	NA	Q776V6	Haemophilus_phage	39.1	5.9e-21
WP_159085649.1|1668804_1670556_+	hypothetical protein	NA	Q7Y5T2	Haemophilus_phage	35.3	8.2e-32
WP_059817478.1|1670568_1671354_+	hypothetical protein	NA	Q7Y5T0	Haemophilus_phage	40.1	1.4e-34
WP_082750606.1|1671392_1671698_+	hypothetical protein	NA	D0UII0	Aggregatibacter_phage	38.6	7.6e-10
WP_179952340.1|1671912_1672071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059817481.1|1672081_1672966_+	hypothetical protein	NA	D0UIH8	Aggregatibacter_phage	52.1	2.2e-81
WP_159085650.1|1673006_1673657_+	hypothetical protein	NA	D0UIH7	Aggregatibacter_phage	41.7	1.0e-32
WP_059817485.1|1673653_1674013_+	hypothetical protein	NA	Q7Y5S5	Haemophilus_phage	49.5	4.4e-25
WP_059817487.1|1674054_1675200_+|plate	baseplate J/gp47 family protein	plate	D0UIH5	Aggregatibacter_phage	46.0	5.1e-83
WP_059817488.1|1675196_1675850_+	DUF2612 domain-containing protein	NA	D0UIH4	Aggregatibacter_phage	47.8	4.3e-42
WP_059817490.1|1675846_1676953_+	hypothetical protein	NA	R4JJY3	Burkholderia_phage	48.1	8.8e-32
WP_082750601.1|1676962_1677382_+	hypothetical protein	NA	U3PCK9	Burkholderia_phage	38.8	5.7e-24
WP_159085651.1|1677741_1678431_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_059817495.1|1678723_1679176_+	peptidase M15	NA	C7BGD8	Burkholderia_phage	62.3	9.4e-49
WP_059817497.1|1679185_1679494_+|holin	holin	holin	A0A0M5M1H1	Salmonella_phage	40.9	2.4e-11
WP_082750603.1|1679483_1679954_+	DUF2514 family protein	NA	C7BGD9	Burkholderia_phage	61.7	1.2e-38
WP_059531437.1|1680056_1680599_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_059531434.1|1680574_1680925_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	38.5	3.7e-16
WP_059820731.1|1680956_1682522_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	33.6	4.1e-67
WP_059814472.1|1683043_1683751_+	SOS response-associated peptidase family protein	NA	Q8W6R8	Burkholderia_virus	75.3	3.4e-101
>prophage 5
NZ_CP013427	Burkholderia sp. MSMB0856 chromosome 1, complete sequence	3467548	2489522	2497804	3467548		Acanthocystis_turfacea_Chlorella_virus(16.67%)	8	NA	NA
WP_059816179.1|2489522_2490446_+	alpha/beta hydrolase	NA	M1IA82	Acanthocystis_turfacea_Chlorella_virus	24.5	4.2e-11
WP_059816182.1|2490468_2491392_-	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	33.8	6.7e-41
WP_082750561.1|2491435_2492785_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_059816187.1|2492861_2493764_-	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	39.5	1.4e-51
WP_059816190.1|2493970_2494315_-	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_059816193.1|2494388_2495381_-	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	31.5	5.3e-28
WP_107938158.1|2495445_2496396_-	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	28.1	1.2e-16
WP_059816196.1|2496403_2497804_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.4	3.7e-75
>prophage 6
NZ_CP013427	Burkholderia sp. MSMB0856 chromosome 1, complete sequence	3467548	2758400	2812983	3467548	transposase,protease,tRNA	Leptospira_phage(23.08%)	43	NA	NA
WP_059820925.1|2758400_2761238_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	26.5	6.7e-84
WP_059527727.1|2761240_2761741_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_059820926.1|2761808_2763020_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	32.2	2.1e-42
WP_059468295.1|2763075_2763522_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	63.7	1.8e-47
WP_059820927.1|2763576_2764347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059820933.1|2764472_2765852_-	amino acid permease	NA	NA	NA	NA	NA
WP_059527738.1|2765955_2768256_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	40.3	1.9e-161
WP_006398529.1|2768252_2768567_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	44.6	4.4e-13
WP_004196460.1|2769115_2769319_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	81.8	6.8e-23
WP_059820934.1|2769498_2771106_-	multicopper oxidase family protein	NA	NA	NA	NA	NA
WP_006490888.1|2771781_2772006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059820928.1|2772135_2774364_-	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_044845581.1|2774644_2775901_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	63.0	1.5e-11
WP_059527744.1|2776174_2776753_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_072444916.1|2777034_2777253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059820929.1|2777413_2777914_+	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	41.2	4.1e-13
WP_059820930.1|2778139_2780251_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.7	4.4e-56
WP_059820931.1|2780435_2781446_+	HoxN/HupN/NixA family nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_179952335.1|2782273_2782762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_179952336.1|2782946_2783270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059820853.1|2783280_2784126_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_059528318.1|2784294_2785041_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_059820854.1|2785062_2786454_-	CoA transferase	NA	NA	NA	NA	NA
WP_059820855.1|2786593_2787826_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_059820856.1|2787798_2788125_-	DUF2917 domain-containing protein	NA	NA	NA	NA	NA
WP_059690565.1|2788326_2789766_+	multidrug transporter subunit MdtD	NA	NA	NA	NA	NA
WP_059527773.1|2789950_2791225_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_059820857.1|2791240_2791855_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_059820858.1|2792028_2792553_-	DUF962 domain-containing protein	NA	NA	NA	NA	NA
WP_059820859.1|2792634_2793342_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_059820860.1|2793442_2794654_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_059820861.1|2795372_2795879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059820862.1|2795992_2797252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159085685.1|2797248_2801016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107938141.1|2801832_2802956_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.7	6.0e-44
WP_059820731.1|2803190_2804756_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	33.6	4.1e-67
WP_059531434.1|2804787_2805138_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	38.5	3.7e-16
WP_059531437.1|2805113_2805656_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_159085686.1|2806944_2809305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063901412.1|2809594_2810455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155674615.1|2810451_2811453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159085687.1|2811455_2812169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107938028.1|2812165_2812983_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	35.9	5.0e-08
>prophage 1
NZ_CP013428	Burkholderia sp. MSMB0856 chromosome 2, complete sequence	2473077	1191695	1255873	2473077	plate	Acanthocystis_turfacea_Chlorella_virus(20.0%)	37	NA	NA
WP_059819093.1|1191695_1193078_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_059525491.1|1193093_1194413_+	DotU family type VI secretion system protein	NA	NA	NA	NA	NA
WP_059819094.1|1194414_1198044_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_107938194.1|1198025_1198721_+	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_059819096.1|1198786_1201168_+	serine/threonine protein kinase	NA	M1I231	Acanthocystis_turfacea_Chlorella_virus	26.2	1.2e-09
WP_082750651.1|1201154_1202279_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_059525499.1|1202338_1202893_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_059690091.1|1202885_1204403_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_059525502.1|1204462_1204954_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_059525734.1|1204970_1205519_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_059819097.1|1205523_1207395_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_059819098.1|1207391_1208516_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_059819099.1|1208528_1211201_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	28.9	5.2e-78
WP_059819100.1|1211197_1213402_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	29.4	4.8e-45
WP_059819101.1|1213417_1214683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059819664.1|1214704_1219453_+	RHS domain-containing protein	NA	NA	NA	NA	NA
WP_059819102.1|1220170_1232509_-	LWXIA domain-containing protein	NA	NA	NA	NA	NA
WP_059819103.1|1233087_1234344_+	porin	NA	NA	NA	NA	NA
WP_059468012.1|1234675_1235167_+	peptidoglycan-associated lipoprotein Pal	NA	NA	NA	NA	NA
WP_175906937.1|1235395_1235566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059819104.1|1235658_1236921_-	cytochrome c	NA	NA	NA	NA	NA
WP_059819105.1|1236917_1237613_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_059819106.1|1237609_1240486_-	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	NA	NA	NA	NA
WP_059819107.1|1240988_1242539_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	37.8	2.6e-21
WP_059819108.1|1242807_1243086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059819109.1|1243317_1244352_+	succinylglutamate desuccinylase/aspartoacylase family protein	NA	NA	NA	NA	NA
WP_059819110.1|1244461_1244758_+	type II toxin-antitoxin system MqsR family toxin	NA	NA	NA	NA	NA
WP_059525531.1|1244760_1245162_+	type II toxin-antitoxin system MqsA family antitoxin	NA	NA	NA	NA	NA
WP_059819111.1|1245459_1246020_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_059819112.1|1246083_1247025_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_059819113.1|1247063_1248113_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_059819114.1|1248120_1249479_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_082750652.1|1249538_1251320_+	amino acid ABC transporter permease/ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.0	3.5e-30
WP_059819115.1|1251354_1252284_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_059819116.1|1252400_1252928_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_059819666.1|1252940_1254062_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_059819117.1|1254058_1255873_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 1
NZ_CP013429	Burkholderia sp. MSMB0856 chromosome 3, complete sequence	1059546	431770	457440	1059546	transposase,plate	Leptospira_phage(80.0%)	21	NA	NA
WP_107938004.1|431770_432894_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.7	4.6e-44
WP_107938255.1|432992_434112_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.3	1.2e-49
WP_107938256.1|434140_435568_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_059820553.1|435778_435967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059820552.1|436087_436384_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_059820550.1|436627_436831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_179952358.1|436895_437360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082750749.1|438857_439418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059820548.1|439424_443663_-	RHS domain-containing protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	47.1	2.1e-25
WP_059820547.1|443684_444143_-	DUF1795 domain-containing protein	NA	NA	NA	NA	NA
WP_059820546.1|444207_444651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059820545.1|444694_445564_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_059820544.1|445563_448563_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_059820543.1|448710_450591_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_059820542.1|451169_451625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159085723.1|452034_452247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059820540.1|452328_452679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159085724.1|453825_454143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059820731.1|454974_456540_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	33.6	4.1e-67
WP_059531434.1|456571_456922_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	38.5	3.7e-16
WP_059531437.1|456897_457440_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP013429	Burkholderia sp. MSMB0856 chromosome 3, complete sequence	1059546	478459	546127	1059546	transposase	Leptospira_phage(15.38%)	58	NA	NA
WP_059815287.1|478459_479968_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	55.1	1.9e-154
WP_159085726.1|480171_480540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059815295.1|480740_482279_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	37.2	2.7e-47
WP_082750540.1|482433_485376_-	response regulator	NA	A0A1V0SGX0	Hokovirus	30.2	3.6e-40
WP_059452495.1|485459_486122_-	response regulator	NA	NA	NA	NA	NA
WP_059815303.1|486265_486556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082750542.1|486717_486822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059815306.1|486938_487616_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_059815310.1|488162_489533_+	MHS family MFS transporter	NA	Q6JIH2	Burkholderia_virus	34.1	1.5e-44
WP_107938234.1|490755_491572_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_059815319.1|491716_493147_-	UvrD-helicase domain-containing protein	NA	NA	NA	NA	NA
WP_059815322.1|493139_494843_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_059815325.1|495323_496157_+	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	37.7	9.0e-45
WP_082750543.1|499150_500548_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	30.5	3.7e-35
WP_081070138.1|501415_501877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059815329.1|502938_503370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082750544.1|503531_504542_-	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_059815335.1|504543_505080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082750551.1|505088_506612_-	DNA primase	NA	NA	NA	NA	NA
WP_059815344.1|506669_508526_-	PriCT-2 domain-containing protein	NA	M4QC51	Vibrio_phage	34.5	4.6e-09
WP_059815346.1|508522_510238_-	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_059815349.1|510234_510609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059815354.1|510617_511736_-	P-type DNA transfer ATPase VirB11	NA	NA	NA	NA	NA
WP_059815358.1|511732_512968_-	type IV secretion system protein VirB10	NA	NA	NA	NA	NA
WP_059815363.1|512960_513785_-	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_059676217.1|513781_514480_-	type IV secretion system protein	NA	NA	NA	NA	NA
WP_059815366.1|514689_515385_-	P-type DNA transfer protein VirB5	NA	NA	NA	NA	NA
WP_059815369.1|515401_516571_-	type IV secretion system protein	NA	NA	NA	NA	NA
WP_059815371.1|516570_519036_-	VirB4 family type IV secretion/conjugal transfer ATPase	NA	NA	NA	NA	NA
WP_059493347.1|519037_519358_-	VirB3 family type IV secretion system protein	NA	NA	NA	NA	NA
WP_059815374.1|519376_519718_-	TrbC/VirB2 family protein	NA	NA	NA	NA	NA
WP_107938235.1|519766_520438_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_082750546.1|520434_520983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159085727.1|520975_521818_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_081052594.1|522573_522825_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_059815381.1|523105_523558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059815385.1|523712_524750_-	porin	NA	NA	NA	NA	NA
WP_059815389.1|524811_525366_-	amino acid synthesis family protein	NA	NA	NA	NA	NA
WP_059815392.1|525362_526775_-	amidase	NA	NA	NA	NA	NA
WP_059815441.1|526827_528006_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_059815395.1|528014_528785_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.9	1.6e-16
WP_059815398.1|528771_529506_-	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	29.3	2.7e-08
WP_059815400.1|529505_530579_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_059815403.1|530582_531458_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_059815406.1|531816_532203_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_059815409.1|532708_534139_+	amidase	NA	NA	NA	NA	NA
WP_059815445.1|534183_535023_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_059815412.1|535254_536514_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_059815416.1|536545_536815_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_159085728.1|536936_537836_+	3-oxoacyl-ACP synthase	NA	NA	NA	NA	NA
WP_059815419.1|537832_538780_+	3-oxoacyl-ACP synthase	NA	NA	NA	NA	NA
WP_059815422.1|538830_540450_+	acyl-CoA ligase (AMP-forming), exosortase A system-associated	NA	Q75ZG1	Hepacivirus	23.5	5.1e-20
WP_059815426.1|540446_541655_+	pyridoxal-dependent decarboxylase, exosortase A system-associated	NA	A0A2K9L0W9	Tupanvirus	23.5	1.6e-18
WP_059815429.1|541683_542802_+	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_082750549.1|542798_543392_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_059820731.1|543661_545227_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	33.6	4.1e-67
WP_059531434.1|545258_545609_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	38.5	3.7e-16
WP_059531437.1|545584_546127_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP013426	Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence	249331	0	68787	249331	transposase,integrase	Burkholderia_phage(20.0%)	49	18893:18910	60476:60493
WP_107937952.1|0_930_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_107937953.1|1000_1480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159085599.1|1690_2149_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_107937955.1|2132_2411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159085600.1|2662_2854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107938080.1|3000_4803_-	phosphoadenosine phosphosulfate reductase family protein	NA	NA	NA	NA	NA
WP_107937956.1|4874_5438_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	31.4	3.7e-18
WP_107937957.1|5987_6182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_179952331.1|6204_6381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107937958.1|6944_8483_+|transposase	IS3-like element ISBmu11 family transposase	transposase	A0A1B1P773	Bacillus_phage	35.2	2.8e-44
WP_096506425.1|9170_9764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107937959.1|9775_10909_-	type II secretion system protein	NA	NA	NA	NA	NA
WP_107937960.1|10905_13197_-	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
WP_107937961.1|13193_13778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107938081.1|13764_15087_-	type 4b pilus protein PilO2	NA	NA	NA	NA	NA
WP_107937962.1|15092_16697_-	type II secretory pathway protein	NA	NA	NA	NA	NA
WP_107937963.1|16702_17245_-	toxin co-regulated pilus biosynthesis Q family protein	NA	NA	NA	NA	NA
WP_107938082.1|17247_17640_-	lytic transglycosylase domain-containing protein	NA	A0A0K2QQJ4	Ralstonia_phage	36.5	3.4e-10
WP_107937964.1|17669_18935_-	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
18893:18910	attL	TCGCCGACGCGGCGCACG	NA	NA	NA	NA
WP_107937965.1|18931_19738_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_107937966.1|19734_21012_-	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_107937967.1|21019_21895_-	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_096506415.1|21891_22608_-	type IV secretion system protein	NA	NA	NA	NA	NA
WP_096506413.1|24669_25551_+	replication initiation protein	NA	E5FFJ0	Burkholderia_phage	38.1	3.4e-34
WP_060320187.1|25667_26699_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_107937969.1|26695_27355_-	AAA family ATPase	NA	A2I303	Vibrio_virus	32.9	6.2e-17
WP_107937970.1|28543_30679_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_107937971.1|31293_32529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159085601.1|33245_33569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107938083.1|33616_34033_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_107937972.1|34029_34344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059820731.1|34884_36450_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	33.6	4.1e-67
WP_059531434.1|36481_36832_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	38.5	3.7e-16
WP_059531437.1|36807_37350_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_179952332.1|37383_38594_-|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	64.8	8.0e-103
WP_159085602.1|38990_39230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107937976.1|39216_49644_-	insecticidal toxin complex protein	NA	NA	NA	NA	NA
WP_107937977.1|49752_57714_-	VCBS repeat-containing protein	NA	NA	NA	NA	NA
WP_159085603.1|57924_58143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159085604.1|58484_59450_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_107937979.1|59596_59902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107937980.1|59931_61587_+	asparagine synthase	NA	NA	NA	NA	NA
60476:60493	attR	TCGCCGACGCGGCGCACG	NA	NA	NA	NA
WP_107937981.1|61602_62691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107937982.1|62679_63522_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_107937983.1|63594_64452_+	transketolase	NA	NA	NA	NA	NA
WP_107937984.1|64464_65373_+	transketolase	NA	NA	NA	NA	NA
WP_159085605.1|65369_66257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159085606.1|66271_67174_+	hypothetical protein	NA	A0A0E3HCL0	Synechococcus_phage	44.4	3.1e-06
WP_059816369.1|67794_68787_+|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	87.0	4.1e-161
>prophage 2
NZ_CP013426	Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence	249331	88378	162129	249331	transposase,integrase	Leptospira_phage(27.78%)	56	111423:111474	170234:170285
WP_107937958.1|88378_89917_+|transposase	IS3-like element ISBmu11 family transposase	transposase	A0A1B1P773	Bacillus_phage	35.2	2.8e-44
WP_159085610.1|89961_90135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107937997.1|90475_91638_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	53.2	7.3e-85
WP_107937998.1|91712_92009_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_107938002.1|93153_94197_+	DUF1016 family protein	NA	Q9JMP5	Wolbachia_phage	53.5	2.1e-107
WP_159085611.1|94531_95014_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	26.7	4.7e-06
WP_107938004.1|95057_96181_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.7	4.6e-44
WP_107938005.1|96689_97208_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_107938085.1|97252_98599_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	41.8	9.3e-76
WP_107938006.1|98570_99767_-	amidohydrolase	NA	NA	NA	NA	NA
WP_107938007.1|99781_100867_-	porin	NA	NA	NA	NA	NA
WP_059820731.1|102180_103746_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	33.6	4.1e-67
WP_059531434.1|103777_104128_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	38.5	3.7e-16
WP_059531437.1|104103_104646_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_107938008.1|104739_105585_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_107938009.1|105698_108047_+	cytochrome P450/oxidoreductase	NA	NA	NA	NA	NA
WP_107938010.1|108129_109485_+	aromatic acid/H+ symport family MFS transporter	NA	NA	NA	NA	NA
WP_107938011.1|109647_109911_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_107938012.1|109951_110137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107938004.1|110316_111439_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.7	4.6e-44
111423:111474	attL	CAGAACGCCGAAGACTAACATTGCCTTTGGCACTGAAAACCGGGACCGTTCA	NA	NA	NA	NA
WP_107938013.1|111564_112365_-	2,4-dihydroxyhept-2-ene-1,7-dioic acid aldolase	NA	NA	NA	NA	NA
WP_107938014.1|112420_113314_-	2-hydroxy-3-oxopropionate reductase	NA	A0A077SLF7	Escherichia_phage	28.2	3.6e-23
WP_107938015.1|113354_114296_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_107938016.1|114292_115126_-	NAD(P)-dependent oxidoreductase	NA	A0A1V0SKV4	Klosneuvirus	28.6	8.8e-08
WP_107938017.1|115162_116317_-	PD40 domain-containing protein	NA	NA	NA	NA	NA
WP_107938018.1|116387_118184_-	transporter	NA	A0A219Y9P9	Aeromonas_phage	24.2	1.1e-07
WP_159085612.1|118244_119435_-	porin	NA	NA	NA	NA	NA
WP_107938020.1|119641_120796_-	enolase	NA	NA	NA	NA	NA
WP_107938021.1|120995_121730_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_159085613.1|123817_124021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107938022.1|124725_126879_-	endopolygalacturonase	NA	NA	NA	NA	NA
WP_107938023.1|127455_128442_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_059540303.1|128438_129017_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_107938024.1|129021_130374_+	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_107938025.1|131570_131876_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_107938026.1|134906_136280_+	hypothetical protein	NA	A0A076FMJ8	Aureococcus_anophage	29.8	6.9e-10
WP_159085614.1|136641_136902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107938028.1|137740_138558_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_107938029.1|138830_139508_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_107938086.1|139627_140431_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_107938030.1|140444_141212_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_107938031.1|141213_142026_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.7	2.9e-32
WP_107938032.1|142198_143791_+	gamma-glutamyltransferase family protein	NA	NA	NA	NA	NA
WP_107938033.1|144340_144601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159085615.1|145782_146496_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_107938035.1|146574_146868_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_107938088.1|147731_153578_+	hemagglutinin	NA	NA	NA	NA	NA
WP_159085616.1|154143_154497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107938036.1|157476_158226_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	60.8	1.8e-81
WP_107938037.1|158240_159791_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	55.6	2.3e-158
WP_017924734.1|159839_159977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107938038.1|160053_160392_-	reverse transcriptase N-terminal domain-containing protein	NA	A0A0U4J920	Pseudomonas_phage	52.0	1.9e-22
WP_159085617.1|160931_161264_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_107938039.1|161299_161674_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_107938040.1|161667_161928_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	46.5	1.8e-15
WP_159085618.1|161943_162129_+|transposase	transposase	transposase	NA	NA	NA	NA
170234:170285	attR	CAGAACGCCGAAGACTAACATTGCCTTTGGCACTGAAAACCGGGACCGTTCA	NA	NA	NA	NA
