The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013424	Burkholderia sp. MSMB0852 chromosome 1, complete sequence	4077888	199732	210968	4077888	integrase	Burkholderia_virus(20.0%)	13	195104:195157	212112:212165
195104:195157	attL	CTGCCCTCCGAAGGCAGGGGTTGCTGGTTCGATCCCAGCCGGGCGCGCCAAGTC	NA	NA	NA	NA
WP_059645382.1|199732_200659_+	AAA family ATPase	NA	A0A077JGB2	Xanthomonas_phage	28.9	1.1e-14
WP_059645385.1|200655_202020_+	type II secretory pathway protein	NA	NA	NA	NA	NA
WP_059645387.1|202784_203564_+	hypothetical protein	NA	A0A1W5LU59	Ralstonia_phage	41.5	3.5e-35
WP_082745134.1|203663_204518_+|integrase	site-specific integrase	integrase	A0A0S2SYQ7	Pseudomonas_phage	46.0	5.0e-59
WP_082745135.1|204531_204903_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2I6TCA4	Escherichia_phage	42.9	6.8e-13
WP_080471805.1|204883_205225_+	helix-turn-helix domain-containing protein	NA	A0A088CD40	Shigella_phage	52.1	1.2e-16
WP_157130939.1|205380_205740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082745147.1|206119_206662_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	56.9	1.0e-49
WP_059645600.1|206919_207372_+	VRR-NUC domain-containing protein	NA	Q8W6S1	Burkholderia_virus	54.7	8.9e-31
WP_059645396.1|207374_208451_+	DUF3396 domain-containing protein	NA	A9YX32	Burkholderia_phage	95.2	4.7e-155
WP_059645603.1|208918_209152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082745137.1|209326_209740_+	DNA mismatch endonuclease Vsr	NA	I6NSG0	Burkholderia_phage	50.0	2.7e-34
WP_059645399.1|209744_210968_+	multidrug DMT transporter	NA	A7XXH6	Thermus_virus	27.1	6.8e-25
212112:212165	attR	CTGCCCTCCGAAGGCAGGGGTTGCTGGTTCGATCCCAGCCGGGCGCGCCAAGTC	NA	NA	NA	NA
>prophage 2
NZ_CP013424	Burkholderia sp. MSMB0852 chromosome 1, complete sequence	4077888	469134	490834	4077888	protease,tail,plate	Pseudomonas_phage(40.0%)	20	NA	NA
WP_081990112.1|469134_469674_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	49.0	2.2e-20
WP_157131023.1|469995_470301_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_082744982.1|470387_470957_+	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_059642481.1|470956_471601_+	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_043277117.1|471600_472677_+	macro domain-containing protein	NA	B0FIJ9	Escherichia_phage	37.6	4.9e-19
WP_156440179.1|473057_473237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059642506.1|473308_474739_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.7	4.7e-17
WP_082744981.1|475389_475683_-|tail	phage tail protein	tail	K4NZQ8	Burkholderia_phage	75.3	6.1e-33
WP_156432552.1|476663_478265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059642478.1|478272_479754_-	MBOAT family protein	NA	A0A125RNP0	Pseudomonas_phage	40.8	2.5e-74
WP_038746362.1|480773_481559_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_038746364.1|481555_482902_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_059642476.1|483010_483625_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_059642473.1|484000_484672_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_038746373.1|484711_485230_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_038746376.1|485246_486737_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_038746378.1|486809_487313_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_082744980.1|487340_487853_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_082717524.1|487943_489770_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_038746387.1|489733_490834_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 3
NZ_CP013424	Burkholderia sp. MSMB0852 chromosome 1, complete sequence	4077888	810049	819703	4077888		Hokovirus(16.67%)	7	NA	NA
WP_038753329.1|810049_811999_+	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	49.6	1.4e-144
WP_038753330.1|812262_813393_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	27.2	1.7e-22
WP_059646128.1|813424_815461_+	bifunctional anthranilate synthase component I family protein/class IV aminotransferase	NA	S4VT78	Pandoravirus	32.1	2.4e-51
WP_059646131.1|816019_816835_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	32.5	7.4e-36
WP_059583442.1|816897_817581_-	deoxynucleoside kinase	NA	A0A249XZR7	Enterococcus_phage	26.0	3.3e-05
WP_038753334.1|817577_818105_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_038753335.1|818140_819703_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	31.3	3.3e-24
>prophage 4
NZ_CP013424	Burkholderia sp. MSMB0852 chromosome 1, complete sequence	4077888	1198999	1207586	4077888		Bacillus_phage(16.67%)	8	NA	NA
WP_038745596.1|1198999_1200403_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.5	9.4e-79
WP_052145031.1|1200368_1201358_+	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	27.7	2.7e-16
WP_038745594.1|1201416_1202409_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	30.6	5.9e-27
WP_038745592.1|1202480_1202798_+	competence protein ComE	NA	NA	NA	NA	NA
WP_038745590.1|1203066_1203969_+	cysteine synthase CysM	NA	A0A1X9I5K7	Streptococcus_phage	40.2	3.9e-54
WP_082745323.1|1204058_1205462_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_059584558.1|1205511_1206435_+	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	35.9	5.4e-43
WP_082745331.1|1206746_1207586_-	alpha/beta hydrolase	NA	A7XCB7	Tanapox_virus	27.6	5.9e-20
>prophage 5
NZ_CP013424	Burkholderia sp. MSMB0852 chromosome 1, complete sequence	4077888	1823587	1835476	4077888		uncultured_Mediterranean_phage(28.57%)	11	NA	NA
WP_059642950.1|1823587_1826092_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	37.0	1.5e-42
WP_006026979.1|1826184_1826511_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_081989624.1|1826542_1827145_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_038749138.1|1827212_1828418_+	CoA transferase	NA	NA	NA	NA	NA
WP_059642947.1|1828523_1829285_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.7	3.3e-62
WP_059580904.1|1829281_1830283_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	48.9	7.7e-35
WP_081989626.1|1830288_1831167_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A0S2SXL7	Bacillus_phage	34.3	3.3e-05
WP_038749147.1|1831178_1832267_+	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	35.4	3.0e-32
WP_059642944.1|1832274_1833051_+	3'-5' exonuclease	NA	R9ZX90	Cellulophaga_phage	31.2	3.8e-05
WP_059580817.1|1833141_1834002_-	endonuclease	NA	NA	NA	NA	NA
WP_038749154.1|1834078_1835476_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	25.4	8.9e-29
>prophage 6
NZ_CP013424	Burkholderia sp. MSMB0852 chromosome 1, complete sequence	4077888	1840776	1901471	4077888	transposase,protease,tail,capsid,tRNA	Moraxella_phage(16.67%)	58	NA	NA
WP_038749169.1|1840776_1842117_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_038749172.1|1842170_1842800_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_059642933.1|1842844_1843990_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_059642931.1|1844266_1845604_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_004192796.1|1845737_1845977_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_059642928.1|1846033_1847212_+	GTPase HflX	NA	NA	NA	NA	NA
WP_052145104.1|1847293_1848625_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_038749188.1|1848640_1849540_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_059580839.1|1849564_1849756_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_038749194.1|1849878_1851027_+	ATP phosphoribosyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_145986764.1|1851005_1851134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038749196.1|1851151_1852498_+	adenylosuccinate synthase	NA	A0A160ER07	Powai_lake_megavirus	36.8	1.2e-70
WP_081989640.1|1852534_1853098_+	phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_081989631.1|1853225_1853420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059580846.1|1853384_1855277_+	potassium transporter Kup	NA	A7J6G4	Paramecium_bursaria_Chlorella_virus	33.4	5.1e-80
WP_059642925.1|1855613_1857947_-	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_038749207.1|1858087_1858837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038749262.1|1858946_1859162_+	YdcH family protein	NA	NA	NA	NA	NA
WP_059642922.1|1859221_1861477_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	30.5	2.2e-77
WP_038749213.1|1861679_1862504_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_038749215.1|1862557_1863745_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_059642919.1|1863751_1864609_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_082745008.1|1865029_1866913_+	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_059642909.1|1867009_1868191_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_038749229.1|1868316_1869057_+	3-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
WP_038749232.1|1869193_1869766_+	polyhydroxyalkanoate synthesis repressor PhaR	NA	NA	NA	NA	NA
WP_059642903.1|1870148_1870463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081989637.1|1870648_1872040_+	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_038749240.1|1872042_1872969_+	sugar kinase	NA	NA	NA	NA	NA
WP_038749243.1|1873117_1874302_+	acetyl-CoA C-acyltransferase family protein	NA	NA	NA	NA	NA
WP_038749245.1|1874318_1874921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059642900.1|1875184_1876369_+	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_059580884.1|1876665_1877511_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_038744270.1|1878322_1878868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038744272.1|1879309_1880128_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_038744275.1|1880124_1880820_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_059642548.1|1880953_1883464_+	AsmA family protein	NA	NA	NA	NA	NA
WP_157130972.1|1883460_1883616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038744280.1|1883972_1885565_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	27.0	8.2e-55
WP_157130973.1|1885726_1886134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157130974.1|1886473_1886887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157130975.1|1886907_1887213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157130976.1|1887263_1887569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059642562.1|1887587_1887929_-	Rha family transcriptional regulator	NA	B5AX29	Iodobacteriophage	58.6	2.6e-19
WP_082744993.1|1887848_1888421_+	hypothetical protein	NA	A0A2K9V3K3	Faecalibacterium_phage	52.6	2.4e-33
WP_082744989.1|1888362_1889001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082744991.1|1889846_1890560_+	hypothetical protein	NA	C7BGD6	Burkholderia_phage	46.4	4.8e-55
WP_082744992.1|1890581_1891025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059642566.1|1891021_1893796_+|tail	phage tail tape measure protein	tail	Q6JIL8	Burkholderia_virus	26.1	9.1e-17
WP_059642568.1|1893880_1895458_+|capsid	major capsid protein	capsid	A0A0R6PCV7	Moraxella_phage	44.8	1.5e-32
WP_157130977.1|1895544_1895721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157130978.1|1896022_1896472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157130979.1|1896468_1896669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157130980.1|1896669_1897179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100185219.1|1897330_1898417_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.4	2.2e-43
WP_082745114.1|1898680_1899082_+	HNH endonuclease	NA	A0A0R6PHK1	Moraxella_phage	38.4	1.4e-08
WP_157130981.1|1899646_1900255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059646893.1|1900211_1901471_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	47.1	1.4e-44
>prophage 7
NZ_CP013424	Burkholderia sp. MSMB0852 chromosome 1, complete sequence	4077888	2210096	2222657	4077888	transposase,integrase,plate	Pseudomonas_phage(22.22%)	16	2203317:2203333	2227850:2227866
2203317:2203333	attL	GTCGCGAGGCCGAGCGC	NA	NA	NA	NA
WP_059641450.1|2210096_2212115_-	acyltransferase	NA	W6MVL2	Pseudomonas_phage	39.3	6.3e-52
WP_059641453.1|2212298_2212703_-	hypothetical protein	NA	A0A1S5NV54	Burkholderia_phage	36.0	3.1e-11
WP_082744913.1|2212705_2214268_-	hypothetical protein	NA	A0A1S5NTG6	Burkholderia_phage	27.2	1.2e-31
WP_004549651.1|2214270_2214843_-	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_017880448.1|2214839_2215907_-|plate	baseplate J/gp47 family protein	plate	A0A0M3LQN4	Mannheimia_phage	43.0	4.3e-68
WP_017880449.1|2215906_2216257_-	hypothetical protein	NA	A0A2H4JDR8	uncultured_Caudovirales_phage	55.7	1.1e-25
WP_059641458.1|2216322_2216925_-|plate	phage baseplate assembly protein V	plate	A0A0M3LPA3	Mannheimia_phage	42.4	1.7e-37
WP_017880479.1|2217159_2217465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038719153.1|2217461_2217899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081989570.1|2217910_2218228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059641502.1|2218282_2218537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059641506.1|2218587_2218920_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_059641508.1|2218906_2219533_-	hypothetical protein	NA	A0A0M3VI82	Ralstonia_phage	52.9	4.9e-19
WP_017880484.1|2219525_2219756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038730309.1|2219763_2220510_-	ATP-binding protein	NA	A0A0U5DWK7	unidentified_phage	65.5	2.3e-84
WP_082744927.1|2220527_2222657_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A125RN39	Pseudomonas_phage	48.9	1.5e-181
2227850:2227866	attR	GTCGCGAGGCCGAGCGC	NA	NA	NA	NA
>prophage 8
NZ_CP013424	Burkholderia sp. MSMB0852 chromosome 1, complete sequence	4077888	2398387	2458739	4077888	transposase,plate,coat,tRNA	uncultured_Caudovirales_phage(33.33%)	42	NA	NA
WP_059641692.1|2398387_2401012_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.5	4.2e-80
WP_059641689.1|2402119_2403340_+	CoA transferase	NA	NA	NA	NA	NA
WP_059583030.1|2404838_2406548_+|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	56.4	4.5e-184
WP_082744932.1|2406872_2407340_-	NUDIX hydrolase	NA	A0A2I6PFL2	Proteus_phage	41.3	2.5e-20
WP_038751339.1|2407367_2407754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059641726.1|2407996_2410036_-	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_038751340.1|2410186_2411047_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_059641683.1|2411089_2412460_-	cytochrome-c peroxidase	NA	NA	NA	NA	NA
WP_059641681.1|2412693_2414277_+	acid phosphatase	NA	NA	NA	NA	NA
WP_038751343.1|2414667_2415861_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_059641676.1|2415957_2416590_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_038751345.1|2416590_2418666_-	response regulator	NA	A0A1V0SGR3	Hokovirus	26.4	1.1e-11
WP_038751346.1|2419080_2420046_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_082744930.1|2420061_2422407_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_059583010.1|2422523_2423363_-	molecular chaperone	NA	NA	NA	NA	NA
WP_038751349.1|2423380_2423914_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_038751350.1|2423995_2424556_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_038751433.1|2424609_2425155_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_059641722.1|2425980_2426874_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_145986777.1|2426894_2427230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038751352.1|2427294_2428560_+	MFS transporter	NA	NA	NA	NA	NA
WP_038751353.1|2428604_2429549_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_038751354.1|2430049_2430331_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_081989910.1|2430812_2431115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085740692.1|2431435_2431672_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_157130990.1|2431839_2432559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157130991.1|2432705_2433017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081989912.1|2432925_2433645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082744925.1|2434363_2435056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082744924.1|2435188_2435908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059641667.1|2435919_2438943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059641664.1|2439968_2442833_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	23.8	8.7e-31
WP_038751363.1|2443358_2443853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059641661.1|2443830_2447172_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_059641658.1|2447280_2449689_-	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_152611762.1|2449685_2450264_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_059641655.1|2450281_2450860_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_059641652.1|2450975_2451812_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_059641649.1|2451814_2454613_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	24.3	9.7e-27
WP_059582968.1|2455134_2455401_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_059641717.1|2455424_2456843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059641645.1|2456888_2458739_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 9
NZ_CP013424	Burkholderia sp. MSMB0852 chromosome 1, complete sequence	4077888	2471547	2566914	4077888	head,transposase,tail,plate,integrase,holin	Burkholderia_virus(39.71%)	102	2500649:2500696	2567135:2567182
WP_059641615.1|2471547_2472612_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_059641613.1|2472611_2474501_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_100185346.1|2474531_2475014_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_059641610.1|2475096_2476095_-	ImpE/SciE family protein	NA	NA	NA	NA	NA
WP_059641607.1|2476091_2476793_-	TagK domain-containing protein	NA	NA	NA	NA	NA
WP_059641604.1|2477312_2480054_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	32.1	1.8e-81
WP_038751399.1|2480087_2480642_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_038751400.1|2480674_2482204_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_059582918.1|2482295_2482781_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_059641601.1|2482870_2483374_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_059641598.1|2483395_2484742_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_082744922.1|2484818_2486108_+	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_059641595.1|2486132_2490251_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_059641589.1|2490751_2496715_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	37.5	1.8e-187
WP_157130994.1|2497079_2497901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059641582.1|2498066_2498465_+	transcriptional regulator	NA	Q6JIH0	Burkholderia_virus	87.8	7.0e-56
WP_082744921.1|2498681_2499815_+	AAA family ATPase	NA	Q7M293	Enterobacteria_phage	32.7	7.7e-23
WP_059641579.1|2499811_2500513_+	RelA/SpoT domain-containing protein	NA	NA	NA	NA	NA
2500649:2500696	attL	TTCTGGCCCGCCCTACACGATTCGAACGTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_059641573.1|2501552_2501873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143282739.1|2501925_2502144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059641712.1|2502461_2503130_-	DUF159 family protein	NA	Q8W6R8	Burkholderia_virus	93.6	1.8e-125
WP_059641570.1|2503215_2503857_+	hypothetical protein	NA	Q8W6R9	Burkholderia_virus	94.8	1.8e-114
WP_009910374.1|2503989_2505081_-	DUF3396 domain-containing protein	NA	Q8W6S0	Burkholderia_virus	99.7	7.2e-212
WP_082744920.1|2505108_2505843_-	VRR-NUC domain-containing protein	NA	Q8W6S1	Burkholderia_virus	98.8	1.5e-136
WP_015984955.1|2505839_2506400_-	PAAR domain-containing protein	NA	A4JX23	Burkholderia_virus	100.0	1.3e-103
WP_080380984.1|2506578_2507478_-	hypothetical protein	NA	A4JX22	Burkholderia_virus	99.7	4.7e-148
WP_059641568.1|2507539_2508082_-	lysozyme	NA	A4JX21	Burkholderia_virus	89.4	2.9e-76
WP_059641565.1|2508081_2508579_-	lysozyme	NA	A4JX20	Burkholderia_virus	78.9	4.5e-68
WP_059641711.1|2508571_2508784_-|holin	holin	holin	A4JX19	Burkholderia_virus	97.1	6.6e-29
WP_082744919.1|2508827_2509544_-	hypothetical protein	NA	A4JX18	Burkholderia_virus	98.3	1.2e-135
WP_059641561.1|2509848_2513160_-|tail	phage tail protein	tail	Q8W6T0	Burkholderia_virus	94.0	0.0e+00
WP_059641559.1|2513156_2513741_-|tail	tail assembly protein	tail	Q6JIL3	Burkholderia_virus	96.4	3.2e-97
WP_082744918.1|2513737_2514355_-	hypothetical protein	NA	Q8W6T2	Burkholderia_virus	98.2	1.4e-63
WP_004549735.1|2514415_2514673_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	Q8W6N1	Burkholderia_virus	100.0	2.4e-41
WP_059641556.1|2514669_2515056_+	helix-turn-helix transcriptional regulator	NA	Q8W6N2	Burkholderia_virus	98.4	4.0e-64
WP_059641552.1|2515243_2515528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059641550.1|2515722_2516247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154234126.1|2516469_2517024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041190477.1|2517020_2518106_-	DUF262 domain-containing protein	NA	A0A0R6PKN1	Moraxella_phage	25.4	1.2e-17
WP_059641548.1|2518373_2519021_-	hypothetical protein	NA	Q6JIF4	Burkholderia_virus	91.2	1.2e-102
WP_059641709.1|2519029_2519245_-	hypothetical protein	NA	Q6JIF5	Burkholderia_virus	100.0	1.3e-35
WP_059641545.1|2519330_2519930_-	DUF1064 domain-containing protein	NA	Q6JIF9	Burkholderia_virus	71.5	5.1e-66
WP_025992354.1|2519926_2520919_-	hypothetical protein	NA	A4JX55	Burkholderia_virus	97.0	5.1e-172
WP_004526650.1|2521072_2521333_-	helix-turn-helix domain-containing protein	NA	Q6JIG2	Burkholderia_virus	100.0	4.2e-41
WP_059641542.1|2521649_2522771_-	site-specific DNA-methyltransferase	NA	Q8W6P4	Burkholderia_virus	93.2	4.7e-206
WP_082744916.1|2522767_2523964_-	DNA cytosine methyltransferase	NA	Q6J1P4	Burkholderia_virus	56.0	2.6e-114
WP_082744929.1|2523974_2524391_-	hypothetical protein	NA	Q8W6P5	Burkholderia_virus	79.2	2.0e-45
WP_059641533.1|2525459_2525885_+	hypothetical protein	NA	A0A2L0HJX5	Mycobacterium_phage	44.0	2.3e-20
WP_059641530.1|2525903_2526959_+	hypothetical protein	NA	Q8W6R3	Burkholderia_virus	44.3	1.7e-61
WP_059641527.1|2527540_2527810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059641706.1|2527809_2528055_-	hypothetical protein	NA	Q6JIJ4	Burkholderia_virus	86.8	1.8e-30
WP_059641524.1|2528063_2528273_-	hypothetical protein	NA	Q6JIJ5	Burkholderia_virus	89.9	1.0e-29
WP_059641518.1|2528865_2529876_+|integrase	site-specific integrase	integrase	K7PKD7	Enterobacteria_phage	35.9	2.0e-54
WP_082744915.1|2530035_2530794_-	helix-turn-helix transcriptional regulator	NA	A5X9F5	Aeromonas_virus	38.5	4.1e-28
WP_082744928.1|2530936_2531254_+	transcriptional regulator	NA	A0A0C4UQU0	Shigella_phage	39.2	5.3e-06
WP_059641515.1|2531315_2531798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082744927.1|2531845_2533975_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A125RN39	Pseudomonas_phage	48.9	1.5e-181
WP_038730309.1|2533992_2534739_+	ATP-binding protein	NA	A0A0U5DWK7	unidentified_phage	65.5	2.3e-84
WP_017880484.1|2534746_2534977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059641508.1|2534969_2535596_+	hypothetical protein	NA	A0A0M3VI82	Ralstonia_phage	52.9	4.9e-19
WP_059641506.1|2535582_2535915_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_059641502.1|2535965_2536220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081989570.1|2536274_2536592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038719153.1|2536603_2537041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017880479.1|2537037_2537343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059641499.1|2537376_2537994_+	DUF3164 family protein	NA	Q5ZR10	Pseudomonas_phage	54.0	6.6e-61
WP_038748599.1|2538007_2538280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059641497.1|2538286_2538985_+	DUF2786 domain-containing protein	NA	L7P7W8	Pseudomonas_phage	36.9	2.8e-31
WP_052145088.1|2539051_2539462_+	regulatory protein GemA	NA	A0A0M5MRZ7	Ralstonia_phage	46.9	6.4e-28
WP_017880474.1|2539458_2539893_+|transposase	transposase	transposase	A0A0A1IWZ1	Pseudomonas_phage	40.7	1.5e-19
WP_059641493.1|2540034_2540556_+	glycoside hydrolase family 104 protein	NA	D5LH07	Escherichia_phage	53.4	2.1e-36
WP_059641490.1|2540573_2540819_+	hypothetical protein	NA	A0A0M4UKB4	Ralstonia_phage	48.6	5.5e-11
WP_059641487.1|2540799_2541420_+	hypothetical protein	NA	Q6QIC6	Burkholderia_phage	35.8	1.5e-07
WP_038730298.1|2541420_2541654_+	conjugal transfer protein TraR	NA	A0A0M4UVB2	Ralstonia_phage	48.4	3.5e-07
WP_038730297.1|2541677_2541947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059641484.1|2541943_2542150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059583899.1|2542155_2542653_+	DUF1804 family protein	NA	A0A0M3VI86	Ralstonia_phage	69.3	8.2e-54
WP_156437474.1|2542662_2542860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059641481.1|2542861_2544649_+	hypothetical protein	NA	A0A0M4U7A1	Ralstonia_phage	73.5	6.2e-253
WP_082744914.1|2544678_2546250_+	DUF935 domain-containing protein	NA	A0A0M5MS00	Ralstonia_phage	52.7	2.0e-146
WP_059641476.1|2546239_2547553_+|head	phage head morphogenesis protein	head	Q6QIB9	Burkholderia_phage	47.3	3.7e-61
WP_038748612.1|2547656_2548241_+	phage virion morphogenesis protein	NA	B7SDZ4	Pseudomonas_virus	39.3	7.2e-09
WP_059641473.1|2548558_2549668_+	hypothetical protein	NA	A0A0M5N0Q6	Ralstonia_phage	45.8	4.8e-70
WP_059641470.1|2549710_2550121_+	hypothetical protein	NA	A0A0M4TU84	Ralstonia_phage	53.7	1.8e-30
WP_059580633.1|2550165_2551059_+	hypothetical protein	NA	A0A0M4UKB9	Ralstonia_phage	62.0	1.4e-107
WP_059580628.1|2551187_2551742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059580625.1|2551748_2552162_+	DUF1320 domain-containing protein	NA	C9DGP4	Escherichia_phage	33.1	2.3e-09
WP_059641467.1|2552166_2552835_+	DUF1834 family protein	NA	B7SDP5	Haemophilus_phage	43.3	1.7e-30
WP_059577772.1|2552831_2553059_+	DUF2635 domain-containing protein	NA	A0A0M3LQM9	Mannheimia_phage	56.5	1.9e-05
WP_059641465.1|2553062_2554484_+|tail	phage tail protein	tail	B7SDP8	Haemophilus_phage	48.0	1.2e-102
WP_020381060.1|2554513_2554891_+	hypothetical protein	NA	A0A0M3LRV6	Mannheimia_phage	42.5	7.4e-23
WP_017880452.1|2554887_2555286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038748621.1|2555416_2557669_+|tail	tail tape measure protein	tail	A0A0M3LPB6	Mannheimia_phage	30.5	2.1e-56
WP_059641462.1|2557670_2558981_+	multidrug DMT transporter permease	NA	A0A2H4JGT4	uncultured_Caudovirales_phage	29.7	2.9e-42
WP_059641460.1|2558964_2560089_+|tail	phage tail protein	tail	A0A2H4J9E6	uncultured_Caudovirales_phage	42.6	3.2e-77
WP_059641458.1|2560085_2560688_+|plate	phage baseplate assembly protein V	plate	A0A0M3LPA3	Mannheimia_phage	42.4	1.7e-37
WP_017880449.1|2560753_2561104_+	hypothetical protein	NA	A0A2H4JDR8	uncultured_Caudovirales_phage	55.7	1.1e-25
WP_017880448.1|2561103_2562171_+|plate	baseplate J/gp47 family protein	plate	A0A0M3LQN4	Mannheimia_phage	43.0	4.3e-68
WP_004549651.1|2562167_2562740_+	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_082744913.1|2562742_2564305_+	hypothetical protein	NA	A0A1S5NTG6	Burkholderia_phage	27.2	1.2e-31
WP_059641453.1|2564307_2564712_+	hypothetical protein	NA	A0A1S5NV54	Burkholderia_phage	36.0	3.1e-11
WP_059641450.1|2564895_2566914_+	acyltransferase	NA	W6MVL2	Pseudomonas_phage	39.3	6.3e-52
2567135:2567182	attR	TTCTGGCCCGCCCTACACGATTCGAACGTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
>prophage 10
NZ_CP013424	Burkholderia sp. MSMB0852 chromosome 1, complete sequence	4077888	2952553	2998600	4077888	head,portal,terminase,protease,tail,plate,integrase,capsid	uncultured_Caudovirales_phage(31.25%)	60	2945984:2946013	2994122:2994151
2945984:2946013	attL	CCGCTCAAACTATCCGCTCCCCGTAGTTCA	NA	NA	NA	NA
WP_059645833.1|2952553_2953225_-	DUF159 family protein	NA	Q8W6R8	Burkholderia_virus	80.2	1.3e-107
WP_038717217.1|2953304_2953772_+	hypothetical protein	NA	C7BGE3	Burkholderia_phage	62.3	2.0e-49
WP_082745164.1|2953768_2954050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059584827.1|2954109_2954535_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	46.0	6.0e-13
WP_082744911.1|2954531_2955041_+	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	36.2	4.4e-18
WP_085740698.1|2955382_2955982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157131002.1|2955978_2956722_+	hypothetical protein	NA	A4PE26	Ralstonia_virus	42.5	4.4e-35
WP_059643804.1|2956757_2957546_-	DNA adenine methylase	NA	Q8W6S4	Burkholderia_virus	96.2	1.1e-150
WP_059643801.1|2957688_2958234_-	lysozyme	NA	Q8W6S5	Burkholderia_virus	89.0	6.4e-76
WP_059643798.1|2958233_2958731_-	lysozyme	NA	A4JX20	Burkholderia_virus	80.0	1.0e-67
WP_004533694.1|2958723_2958918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059643795.1|2958993_2960046_-	late control protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	44.2	2.3e-77
WP_024430935.1|2960055_2960262_-|tail	phage tail protein	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	59.7	6.9e-15
WP_059643792.1|2960236_2961118_-|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	37.7	2.7e-31
WP_059643789.1|2961126_2963535_-|tail	phage tail tape measure protein	tail	A0A2H4JG00	uncultured_Caudovirales_phage	33.3	5.0e-64
WP_038777205.1|2963622_2963925_-|tail	phage tail assembly protein	tail	V5YST8	Pseudomonas_phage	37.2	2.5e-05
WP_059643786.1|2963990_2964494_-|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	50.6	5.6e-42
WP_059643783.1|2964504_2965674_-|tail	phage tail sheath family protein	tail	A0A2H4J869	uncultured_Caudovirales_phage	72.4	2.6e-159
WP_059643781.1|2965737_2966424_-|tail	phage tail protein	tail	E5E3Q6	Burkholderia_phage	58.6	2.0e-58
WP_059643778.1|2966437_2968243_-|tail	tail fiber protein	tail	A4JWS9	Burkholderia_virus	67.9	1.8e-151
WP_059643775.1|2968230_2968806_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	48.4	2.7e-32
WP_059643772.1|2968798_2969692_-|plate	baseplate J protein	plate	A0A1J0I2M3	Salmonella_phage	39.1	2.7e-47
WP_059643770.1|2969688_2970033_-|plate	phage baseplate protein	plate	A0A2H4JA09	uncultured_Caudovirales_phage	49.1	4.0e-23
WP_059643767.1|2970029_2970227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059643764.1|2970291_2970972_-|plate	phage baseplate assembly protein V	plate	Q9JML8	Wolbachia_phage	34.4	1.5e-18
WP_059643762.1|2970974_2971508_-	hypothetical protein	NA	Q9JML9	Wolbachia_phage	41.1	2.3e-22
WP_059643761.1|2971497_2972028_-|tail	phage tail protein	tail	A0A2H4JBV1	uncultured_Caudovirales_phage	28.8	2.7e-10
WP_059643759.1|2972029_2972320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082745039.1|2972323_2973349_-|capsid	major capsid protein	capsid	A0A2H4J890	uncultured_Caudovirales_phage	58.8	6.3e-109
WP_059643752.1|2973382_2973727_-|head	head decoration protein	head	NA	NA	NA	NA
WP_059643747.1|2973753_2974833_-	peptidase S14	NA	A0A2H4JDI2	uncultured_Caudovirales_phage	37.0	8.6e-48
WP_059643744.1|2974829_2976323_-|portal	phage portal protein	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	51.7	6.4e-134
WP_004533700.1|2976319_2976526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082745038.1|2976536_2978528_-|terminase	phage terminase large subunit family protein	terminase	A0A2D1GMT1	Marinobacter_phage	54.1	2.1e-180
WP_082717481.1|2978490_2979060_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_144241902.1|2979211_2979643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004538506.1|2979811_2980660_-	DUF4747 family protein	NA	NA	NA	NA	NA
WP_059643738.1|2981040_2981628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059643736.1|2981845_2984338_-	virulence protein E	NA	A0A2D1GN57	Marinobacter_phage	41.3	1.6e-97
WP_004538503.1|2984457_2984928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059643733.1|2985301_2985760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059643840.1|2985758_2986217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080231289.1|2986224_2986557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059643731.1|2986570_2987098_-	hypothetical protein	NA	C7BGG0	Burkholderia_phage	46.5	7.4e-29
WP_059643729.1|2987485_2987914_+	XRE family transcriptional regulator	NA	A0A0P0J076	Acinetobacter_phage	63.5	3.4e-16
WP_157131003.1|2988357_2988576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059643722.1|2988627_2988963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059643719.1|2988959_2989565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004538495.1|2989561_2990011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059643716.1|2990010_2991330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059643714.1|2991443_2991773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059643837.1|2991781_2992561_+	hypothetical protein	NA	Q6J1P0	Burkholderia_virus	52.3	1.7e-21
WP_009964477.1|2992557_2992788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038741516.1|2992820_2993921_-|integrase	site-specific integrase	integrase	A0A2D1GMX8	Marinobacter_phage	31.0	1.5e-44
WP_082745043.1|2994024_2994147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038753620.1|2995133_2995616_-	hypothetical protein	NA	NA	NA	NA	NA
2994122:2994151	attR	CCGCTCAAACTATCCGCTCCCCGTAGTTCA	NA	NA	NA	NA
WP_157131004.1|2995643_2996411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038753614.1|2996407_2996632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059574719.1|2996811_2997963_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_038753609.1|2998060_2998600_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
>prophage 11
NZ_CP013424	Burkholderia sp. MSMB0852 chromosome 1, complete sequence	4077888	3258186	3319543	4077888	transposase,protease,integrase	Bacillus_phage(22.22%)	57	3296084:3296100	3318954:3318970
WP_059647211.1|3258186_3259674_-|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	32.1	2.0e-26
WP_038751646.1|3260011_3261328_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_038751711.1|3261331_3261994_-	response regulator	NA	NA	NA	NA	NA
WP_081989927.1|3262259_3263717_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_059575169.1|3264117_3265035_+	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_038751650.1|3265138_3266278_+	acylhydrolase	NA	NA	NA	NA	NA
WP_059575171.1|3266563_3267589_-	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	38.4	2.5e-41
WP_059647213.1|3267600_3268797_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_038751659.1|3269154_3269673_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_038751661.1|3269708_3270599_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	37.5	3.3e-53
WP_038751664.1|3270788_3271853_-	fructose-bisphosphate aldolase class II	NA	NA	NA	NA	NA
WP_059647214.1|3272132_3273569_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_038751670.1|3273911_3275105_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_038751672.1|3275356_3275680_-	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_038751675.1|3275676_3276438_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_060821228.1|3276662_3277586_+	branched-chain amino acid transaminase	NA	NA	NA	NA	NA
WP_004197553.1|3277647_3277845_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_038751679.1|3277972_3279013_+	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_038751681.1|3279144_3279591_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_038751684.1|3279610_3280645_+	hydrolase	NA	NA	NA	NA	NA
WP_059647217.1|3280637_3281234_+	DUF2946 family protein	NA	NA	NA	NA	NA
WP_082745275.1|3281532_3283257_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_059647222.1|3283490_3283979_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_059647224.1|3284136_3284502_-	TonB family protein	NA	NA	NA	NA	NA
WP_059647226.1|3284778_3285249_-	DUF2501 domain-containing protein	NA	NA	NA	NA	NA
WP_145986810.1|3285366_3285585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059647228.1|3285753_3287541_-	polymerase	NA	NA	NA	NA	NA
WP_081989928.1|3287781_3288327_-	pilin	NA	NA	NA	NA	NA
WP_038751703.1|3288525_3289239_-	TerC family protein	NA	A0A2R2YAT9	Pseudomonas_phage	47.1	2.0e-37
WP_038713009.1|3289379_3290261_-	succinate--CoA ligase subunit alpha	NA	NA	NA	NA	NA
WP_038751706.1|3290405_3291572_-	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_059647230.1|3291650_3292262_-	DUF2889 domain-containing protein	NA	NA	NA	NA	NA
WP_059647232.1|3292658_3293615_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_059647233.1|3293614_3294685_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	66.2	6.6e-117
WP_038748972.1|3294888_3295629_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_059647235.1|3295650_3297198_+	GHKL domain-containing protein	NA	W8CYF6	Bacillus_phage	25.9	4.0e-14
3296084:3296100	attL	GCGACGACGACCGGCCG	NA	NA	NA	NA
WP_059575191.1|3297419_3299078_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_059647237.1|3299492_3300470_+	hypothetical protein	NA	A0A0P0ZDC5	Stx2-converting_phage	29.8	2.7e-32
WP_059647239.1|3300466_3301063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059646893.1|3301430_3302690_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	47.1	1.4e-44
WP_082745309.1|3302646_3303582_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	39.7	6.5e-52
WP_059647636.1|3303562_3304123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059647639.1|3304237_3304462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085740700.1|3304603_3304918_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_009687316.1|3304956_3305217_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_059641829.1|3305950_3306454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059641827.1|3307459_3308785_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_059641825.1|3308784_3309102_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_157131011.1|3310105_3310870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157131012.1|3311462_3312869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059641821.1|3312922_3313246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059641819.1|3313422_3313764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059641817.1|3314391_3315675_-	DNA primase	NA	NA	NA	NA	NA
WP_082744939.1|3315671_3315866_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_059641816.1|3316231_3317158_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_059641814.1|3317433_3317829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059646534.1|3318451_3319543_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
3318954:3318970	attR	GCGACGACGACCGGCCG	NA	NA	NA	NA
>prophage 1
NZ_CP013425	Burkholderia sp. MSMB0852 chromosome 2, complete sequence	2934072	658349	702491	2934072	plate,holin,transposase	Burkholderia_phage(66.67%)	33	NA	NA
WP_085740689.1|658349_659570_-|transposase	ISL3 family transposase	transposase	A9YX10	Burkholderia_phage	96.6	2.0e-234
WP_059579707.1|659796_660897_-	chitin-binding protein	NA	Q0N444	Clanis_bilineata_nucleopolyhedrovirus	33.5	2.3e-24
WP_038751514.1|661439_661931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059641447.1|662000_662633_-	nitroreductase	NA	NA	NA	NA	NA
WP_038751525.1|663363_664779_+	circularly permuted type 2 ATP-grasp protein	NA	NA	NA	NA	NA
WP_038751509.1|664862_665804_+	alpha-E domain-containing protein	NA	NA	NA	NA	NA
WP_038751506.1|665812_666760_+	transglutaminase family protein	NA	NA	NA	NA	NA
WP_038751504.1|666872_670298_+	transglutaminase family protein	NA	NA	NA	NA	NA
WP_038751523.1|670496_673145_+	circularly permuted type 2 ATP-grasp protein	NA	NA	NA	NA	NA
WP_157131047.1|673141_674164_+	transglutaminase family protein	NA	NA	NA	NA	NA
WP_059646534.1|675055_676147_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_059579648.1|677031_677382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059579651.1|677605_678688_-	tartrate dehydrogenase	NA	NA	NA	NA	NA
WP_059579656.1|678796_679717_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_059643475.1|680068_681142_-	FUSC family protein	NA	NA	NA	NA	NA
WP_059643472.1|681488_682448_-	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_082745031.1|682595_683294_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_085740689.1|683404_684625_+|transposase	ISL3 family transposase	transposase	A9YX10	Burkholderia_phage	96.6	2.0e-234
WP_038751520.1|684697_685765_-	2-aminoethylphosphonate aminotransferase	NA	NA	NA	NA	NA
WP_059579669.1|685767_686976_-	phosphonopyruvate decarboxylase	NA	NA	NA	NA	NA
WP_059579672.1|686972_688661_-	phosphoenolpyruvate mutase	NA	NA	NA	NA	NA
WP_038751478.1|688657_689425_-|holin	phosphocholine cytidylyltransferase family protein	holin	NA	NA	NA	NA
WP_038751476.1|689466_690468_-	HpnL family protein	NA	NA	NA	NA	NA
WP_038751474.1|690464_691238_-	2OG-Fe(II) oxygenase	NA	NA	NA	NA	NA
WP_059641831.1|691234_691924_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_038751469.1|692286_693801_+	acetyl-CoA hydrolase/transferase family protein	NA	NA	NA	NA	NA
WP_038751467.1|695407_696358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059579711.1|696391_696940_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_038751462.1|696936_698448_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004530039.1|698591_699119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059579716.1|699197_699629_+	GPW/gp25 family protein	NA	NA	NA	NA	NA
WP_038751460.1|699642_701505_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_038751457.1|701501_702491_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 2
NZ_CP013425	Burkholderia sp. MSMB0852 chromosome 2, complete sequence	2934072	1305942	1402468	2934072	plate,protease,tail,portal,head,terminase,transposase,capsid,lysis,holin	Burkholderia_virus(51.72%)	102	NA	NA
WP_088611397.1|1305942_1307069_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.8	1.2e-57
WP_059645664.1|1308143_1309493_-	amidase	NA	NA	NA	NA	NA
WP_059645659.1|1310114_1311353_-	MFS transporter	NA	NA	NA	NA	NA
WP_059645662.1|1312946_1313270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059646534.1|1313398_1314490_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_059643879.1|1314637_1316041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059582243.1|1316059_1316551_-	DUF2165 family protein	NA	NA	NA	NA	NA
WP_059581900.1|1316632_1318036_-	MFS transporter	NA	NA	NA	NA	NA
WP_059643882.1|1318070_1318934_-	VOC family protein	NA	NA	NA	NA	NA
WP_059581892.1|1318936_1319989_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_059643884.1|1320050_1321145_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.6	1.3e-27
WP_038745330.1|1321251_1322235_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	31.4	2.3e-15
WP_038745328.1|1322250_1322943_-	1,6-didemethyltoxoflavin N1-methyltransferase	NA	NA	NA	NA	NA
WP_059581881.1|1322939_1324637_-	WD40 repeat domain-containing protein	NA	NA	NA	NA	NA
WP_052145026.1|1324633_1325278_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	44.0	3.0e-32
WP_085740734.1|1325530_1327069_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_038744921.1|1327155_1330266_-	MMPL family transporter	NA	S5VTK5	Leptospira_phage	22.1	5.0e-48
WP_059641333.1|1330262_1331360_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_038744919.1|1331510_1332209_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_059641331.1|1332265_1334020_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_059641356.1|1334739_1335255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059641328.1|1335310_1337278_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	E5EQU5	Bathycoccus_sp._RCC1105_virus	42.7	1.4e-104
WP_038744915.1|1337327_1337927_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_157131076.1|1337913_1338228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038744914.1|1338391_1339228_+	EamA family transporter	NA	NA	NA	NA	NA
WP_059641325.1|1339391_1340555_-	DUF971 domain-containing protein	NA	NA	NA	NA	NA
WP_059641322.1|1340590_1341385_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_038744911.1|1341945_1342425_+	NUDIX hydrolase	NA	A0A0E3JJF3	Streptomyces_phage	42.1	1.4e-13
WP_038744910.1|1342421_1342877_+	nucleoside 2-deoxyribosyltransferase	NA	NA	NA	NA	NA
WP_059641318.1|1342878_1343865_+	thymidylate synthase	NA	NA	NA	NA	NA
WP_038744908.1|1343880_1344621_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_038744907.1|1344857_1345658_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_059641315.1|1345723_1347154_+	thiamine pyridinylase	NA	NA	NA	NA	NA
WP_060819989.1|1347232_1348042_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_038744901.1|1349438_1349858_+	archease	NA	NA	NA	NA	NA
WP_059641354.1|1349871_1351305_+	RtcB family protein	NA	A2RQD0	Archaeal_BJ1_virus	46.0	2.0e-105
WP_038744900.1|1351362_1351623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038744899.1|1351764_1352469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038744898.1|1352663_1352963_+	GYD domain-containing protein	NA	NA	NA	NA	NA
WP_038744936.1|1353098_1354232_+	CapA family protein	NA	S4VS02	Pandoravirus	55.0	4.7e-113
WP_059641304.1|1354298_1357118_-	hsp70 family protein	NA	A0A2H4UU19	Bodo_saltans_virus	27.7	1.2e-08
WP_059641301.1|1357121_1358969_-	Hsp70 family protein	NA	NA	NA	NA	NA
WP_059641298.1|1358965_1359541_-	DUF2760 domain-containing protein	NA	NA	NA	NA	NA
WP_059582815.1|1359957_1360719_-	2-keto-4-pentenoate hydratase	NA	NA	NA	NA	NA
WP_059641296.1|1361285_1361753_+	ProQ/FinO family protein	NA	NA	NA	NA	NA
WP_059641293.1|1361814_1362144_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_059641290.1|1363296_1364397_-	phage late control D family protein	NA	K4PAY4	Burkholderia_phage	97.0	6.0e-198
WP_059641286.1|1364396_1364822_-|tail	phage tail protein	tail	A4JWS2	Burkholderia_virus	98.6	2.8e-71
WP_059641283.1|1364839_1367719_-	hypothetical protein	NA	A4JWS3	Burkholderia_virus	69.8	0.0e+00
WP_009914998.1|1367721_1367838_-|tail	GpE family phage tail protein	tail	A0A089FGX3	Burkholderia_phage	86.8	8.3e-10
WP_059641280.1|1367846_1368191_-|tail	phage tail assembly protein	tail	K4NXA3	Burkholderia_phage	99.1	6.7e-55
WP_014696837.1|1368248_1368758_-|tail	phage major tail tube protein	tail	K4NZR9	Burkholderia_phage	98.8	3.2e-93
WP_059641277.1|1368773_1369946_-|tail	phage tail sheath protein	tail	A4JWS7	Burkholderia_virus	98.2	3.0e-219
WP_059641275.1|1370002_1370671_-|tail	phage tail protein	tail	A4JWS8	Burkholderia_virus	95.8	2.8e-105
WP_082744902.1|1370687_1373030_-|tail	phage tail protein	tail	Q45YG3	Burkholderia_virus	88.4	0.0e+00
WP_059641269.1|1373031_1373586_-|tail	phage tail protein I	tail	A4JWT0	Burkholderia_virus	95.1	4.3e-96
WP_059641267.1|1373578_1374484_-|plate	baseplate assembly protein	plate	K4NZR5	Burkholderia_phage	94.0	1.4e-152
WP_059641264.1|1374480_1374843_-|plate	baseplate assembly protein	plate	A4JWY3	Burkholderia_virus	95.0	1.1e-58
WP_059641262.1|1374839_1375520_-|plate	phage baseplate assembly protein V	plate	K4NXJ5	Burkholderia_phage	92.9	5.1e-115
WP_059641351.1|1375693_1376470_+	site-specific DNA-methyltransferase	NA	K4NZW3	Burkholderia_phage	96.0	2.4e-137
WP_076830964.1|1376630_1377026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082744901.1|1377057_1377525_-	phage virion morphogenesis protein	NA	K4NZQ8	Burkholderia_phage	94.2	2.0e-73
WP_006027252.1|1377521_1377938_-|tail	phage tail protein	tail	A4JWT7	Burkholderia_virus	99.3	1.6e-71
WP_059641257.1|1378042_1378483_-|lysis	LysB family phage lysis regulatory protein	lysis	K4NXJ2	Burkholderia_phage	95.9	1.8e-68
WP_059641255.1|1378479_1379292_-	DUF3380 domain-containing protein	NA	A4JWZ0	Burkholderia_virus	97.0	7.9e-147
WP_004524440.1|1379288_1379561_-|holin	phage holin family protein	holin	K4NX91	Burkholderia_phage	100.0	8.8e-42
WP_004553021.1|1379562_1379907_-	membrane protein	NA	K4NZQ3	Burkholderia_phage	99.1	6.5e-50
WP_010112635.1|1379921_1380128_-|tail	tail protein	tail	K4PAW7	Burkholderia_phage	98.5	1.5e-30
WP_004524437.1|1380124_1380376_-	hypothetical protein	NA	K4NXI9	Burkholderia_phage	100.0	7.6e-40
WP_009979065.1|1380375_1380855_-|head	head completion/stabilization protein	head	K4NZV5	Burkholderia_phage	99.4	1.3e-80
WP_059641251.1|1380954_1381644_-|terminase	terminase endonuclease subunit	terminase	K4NX86	Burkholderia_phage	98.7	4.0e-115
WP_059641249.1|1381640_1382654_-|capsid	phage major capsid protein, P2 family	capsid	A4JWP9	Burkholderia_virus	97.3	1.6e-184
WP_059641246.1|1382687_1383497_-|capsid	GPO family capsid scaffolding protein	capsid	K4PAW2	Burkholderia_phage	95.9	7.7e-142
WP_059641344.1|1383640_1385410_+|terminase	terminase ATPase subunit family protein	terminase	A4JWQ1	Burkholderia_virus	97.5	0.0e+00
WP_059641244.1|1385406_1386462_+|portal	phage portal protein	portal	A4JWQ2	Burkholderia_virus	98.9	3.7e-205
WP_004202809.1|1386505_1386862_-	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	100.0	3.9e-42
WP_011204767.1|1386864_1387188_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A4JWV2	Burkholderia_virus	98.1	1.1e-54
WP_082744900.1|1387806_1388928_-	DUF3396 domain-containing protein	NA	A4JWV3	Burkholderia_virus	97.6	2.7e-214
WP_059641239.1|1388936_1389674_-	VRR-NUC domain-containing protein	NA	A4JWV4	Burkholderia_virus	95.5	5.7e-128
WP_006027265.1|1389670_1390204_-	hypothetical protein	NA	A4JWV5	Burkholderia_virus	97.7	7.9e-95
WP_009914987.1|1390306_1390429_-	hypothetical protein	NA	A4JWV6	Burkholderia_virus	97.5	5.0e-13
WP_080595102.1|1390662_1391319_-	AAA family ATPase	NA	A4JWV7	Burkholderia_virus	100.0	1.4e-114
WP_004532731.1|1391405_1391612_-	ogr/Delta-like zinc finger family protein	NA	A4JWV8	Burkholderia_virus	100.0	8.7e-34
WP_059641237.1|1391608_1391875_-	ogr/Delta-like zinc finger family protein	NA	A4JWV9	Burkholderia_virus	96.5	2.9e-42
WP_059641234.1|1391890_1393684_-	replication endonuclease	NA	A4JWW0	Burkholderia_virus	92.0	0.0e+00
WP_059641232.1|1393683_1393890_-	hypothetical protein	NA	A4JWW1	Burkholderia_virus	97.1	3.1e-31
WP_082744899.1|1395297_1396788_-	DNA cytosine methyltransferase	NA	Q6V7R9	Burkholderia_virus	38.5	7.4e-66
WP_006027273.1|1396959_1397178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006027274.1|1397335_1397473_-	hypothetical protein	NA	A4JWW4	Burkholderia_virus	97.8	6.2e-20
WP_009914980.1|1397481_1397697_-	hypothetical protein	NA	A4JWW5	Burkholderia_virus	95.5	1.3e-27
WP_009897093.1|1397700_1397922_-	hypothetical protein	NA	A4JWW6	Burkholderia_virus	100.0	1.6e-38
WP_006027276.1|1397918_1398104_-	hypothetical protein	NA	A4JWW7	Burkholderia_virus	90.2	1.9e-19
WP_157131077.1|1398134_1398635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059641219.1|1398631_1399501_-	DUF550 domain-containing protein	NA	R4JG80	Burkholderia_phage	71.5	2.3e-104
WP_009914979.1|1399488_1399641_-	hypothetical protein	NA	R4JMC2	Burkholderia_phage	68.0	1.5e-11
WP_059641215.1|1399880_1400219_+	helix-turn-helix domain-containing protein	NA	A4JWW9	Burkholderia_virus	99.1	2.0e-56
WP_059641341.1|1400364_1400619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059641212.1|1400791_1401058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059641210.1|1401057_1401240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059641205.1|1401255_1401627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059641202.1|1401623_1401983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059641339.1|1401979_1402468_-	glycoside hydrolase family 104 protein	NA	Q6J1Q5	Burkholderia_virus	55.0	2.4e-34
>prophage 3
NZ_CP013425	Burkholderia sp. MSMB0852 chromosome 2, complete sequence	2934072	2136845	2179052	2934072	plate,tail,transposase,integrase,tRNA	Burkholderia_phage(44.12%)	43	2150094:2150111	2182959:2182976
WP_059642353.1|2136845_2138807_-|tail	tail fiber protein	tail	Q45YG3	Burkholderia_virus	63.0	1.9e-141
WP_038743439.1|2138806_2139388_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	86.0	6.8e-92
WP_059642355.1|2139380_2140532_-|plate	baseplate protein	plate	A4JWL6	Burkholderia_virus	79.1	5.7e-167
WP_038743435.1|2140528_2140882_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	82.9	1.4e-52
WP_059576374.1|2141081_2141525_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_157131106.1|2141521_2143417_-	hypothetical protein	NA	A4JWL8	Burkholderia_virus	55.4	2.0e-132
WP_038743429.1|2143858_2144461_-|plate	phage baseplate assembly protein V	plate	Q6QIA1	Burkholderia_phage	78.5	1.4e-63
WP_059642360.1|2144457_2145696_-	Cro/Cl family transcriptional regulator	NA	A4JWL3	Burkholderia_virus	66.7	1.2e-130
WP_059642363.1|2145683_2145890_-	hypothetical protein	NA	A4JWL2	Burkholderia_virus	76.8	5.6e-25
WP_038743424.1|2145889_2146792_-|tail	phage tail protein	tail	Q6QIA4	Burkholderia_phage	66.0	3.5e-71
WP_059642366.1|2146793_2149352_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	52.7	1.0e-200
WP_038743850.1|2149842_2150172_-|tail	phage tail assembly protein	tail	Q6QIA8	Burkholderia_phage	70.0	3.7e-26
2150094:2150111	attL	GCTTGCCGCGACGCAGCG	NA	NA	NA	NA
WP_038743421.1|2150607_2151132_-|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	91.4	7.0e-88
WP_038743419.1|2151133_2152567_-|tail	tail protein	tail	A4JWK5	Burkholderia_virus	87.2	4.7e-243
WP_059642369.1|2152571_2152814_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	62.5	8.4e-20
WP_059642397.1|2152810_2153275_-	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	62.1	3.8e-45
WP_059576390.1|2154521_2154854_-	hypothetical protein	NA	Q6QIC3	Burkholderia_phage	83.6	3.3e-51
WP_038743412.1|2154850_2155189_-	hypothetical protein	NA	A4JWP6	Burkholderia_virus	84.5	1.1e-44
WP_038743410.1|2155185_2155788_-	hypothetical protein	NA	A4JWP5	Burkholderia_virus	57.6	2.6e-46
WP_059642399.1|2155784_2156393_-	transglycosylase SLT domain-containing protein	NA	Q6QIC7	Burkholderia_phage	80.1	4.8e-88
WP_059642371.1|2156395_2156743_-	hypothetical protein	NA	Q6QIC8	Burkholderia_phage	77.4	1.3e-42
WP_059642374.1|2157336_2158176_-	hypothetical protein	NA	A4JWN9	Burkholderia_virus	31.7	1.2e-25
WP_038743406.1|2158241_2158685_-	helix-turn-helix transcriptional regulator	NA	A4JWR8	Burkholderia_virus	50.7	6.0e-24
WP_038743404.1|2158800_2159043_+	DNA-binding protein	NA	Q6QID3	Burkholderia_phage	90.0	9.5e-32
WP_156443886.1|2159089_2159548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038743842.1|2159544_2159856_+	helix-turn-helix domain-containing protein	NA	A4JWN4	Burkholderia_virus	81.1	9.1e-35
WP_059642378.1|2160998_2162798_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6QIE0	Burkholderia_phage	80.8	2.4e-284
WP_157131107.1|2162794_2164072_+	AAA family ATPase	NA	Q6QIE1	Burkholderia_phage	69.2	1.2e-157
WP_059642382.1|2164073_2164436_+	hypothetical protein	NA	Q6QIE2	Burkholderia_phage	61.6	4.9e-24
WP_059576413.1|2164509_2165124_+	DUF3164 family protein	NA	Q6QIE4	Burkholderia_phage	81.8	3.2e-92
WP_059642385.1|2165468_2165825_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	76.8	9.4e-44
WP_059646893.1|2166069_2167329_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	47.1	1.4e-44
WP_059645133.1|2167680_2168994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059645131.1|2169055_2169703_+	2OG-Fe(II) oxygenase	NA	NA	NA	NA	NA
WP_038743391.1|2169771_2170386_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_145986859.1|2170573_2170906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038743389.1|2171287_2173330_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.0	4.2e-35
WP_059576423.1|2173388_2173712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059645128.1|2173773_2175654_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	36.9	1.3e-67
WP_038743383.1|2175748_2176195_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	49.3	8.8e-23
WP_004190342.1|2176365_2176578_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_038743381.1|2176657_2177881_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_038743379.1|2178011_2179052_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	53.4	2.2e-93
2182959:2182976	attR	GCTTGCCGCGACGCAGCG	NA	NA	NA	NA
>prophage 4
NZ_CP013425	Burkholderia sp. MSMB0852 chromosome 2, complete sequence	2934072	2657552	2729284	2934072	plate,transposase	Ectocarpus_siliculosus_virus(12.5%)	52	NA	NA
WP_059646534.1|2657552_2658644_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_059576821.1|2658863_2659520_+	DUF1120 domain-containing protein	NA	NA	NA	NA	NA
WP_145986842.1|2659661_2660087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082717459.1|2660282_2660942_+	DUF1120 domain-containing protein	NA	NA	NA	NA	NA
WP_082745101.1|2661574_2662273_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_059644861.1|2662632_2665017_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_038745896.1|2665554_2666217_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_156437372.1|2666288_2666510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081989449.1|2666836_2667031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038745894.1|2667739_2670784_+	response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	29.7	2.9e-40
WP_059644858.1|2671184_2673851_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	32.7	6.3e-92
WP_059644856.1|2674334_2675402_+	TagK domain-containing protein	NA	NA	NA	NA	NA
WP_081989448.1|2675373_2676228_+	ImpE protein superfamily protein	NA	NA	NA	NA	NA
WP_038745886.1|2676214_2676733_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_038745884.1|2676734_2678615_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_059644871.1|2678611_2679661_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_038745882.1|2679679_2680750_+	type VI secretion protein ImpA	NA	NA	NA	NA	NA
WP_157131125.1|2680700_2681828_+	fimbrial protein	NA	NA	NA	NA	NA
WP_038745878.1|2681854_2683222_+	hypothetical protein	NA	A0A292GJ55	Xanthomonas_phage	43.5	1.3e-101
WP_059644852.1|2683114_2686564_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_038745875.1|2686577_2686847_-	PAAR motif protein	NA	NA	NA	NA	NA
WP_082745100.1|2686926_2689563_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.8	2.7e-34
WP_038745871.1|2689630_2690206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059644846.1|2690287_2694196_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_059644843.1|2694210_2695512_-	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_038746267.1|2695508_2696858_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_081989447.1|2696863_2697406_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_038745865.1|2697533_2698016_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_038745863.1|2698215_2699715_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_038745861.1|2699749_2700289_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_059644839.1|2700636_2702313_-	OmpA family protein	NA	NA	NA	NA	NA
WP_059644836.1|2702315_2703005_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_082745098.1|2703036_2703609_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_157131144.1|2703601_2706205_-	fimbria/pilus outer membrane usher protein	NA	NA	NA	NA	NA
WP_082745096.1|2706457_2707198_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_038745851.1|2707265_2707820_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_157131126.1|2708058_2708391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082717466.1|2708470_2708998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059644826.1|2709222_2710707_+	PhoPQ-regulated protein	NA	NA	NA	NA	NA
WP_059644823.1|2710782_2712723_-	hypothetical protein	NA	K4F7R4	Cronobacter_phage	46.1	7.0e-08
WP_156443865.1|2713568_2713925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038747552.1|2716961_2718557_+	cytochrome c oxidase subunit I	NA	R9VX24	Flavobacterium_phage	33.3	1.9e-06
WP_082745095.1|2718496_2719183_+	DUF2244 domain-containing protein	NA	NA	NA	NA	NA
WP_059644819.1|2719265_2719958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038747585.1|2720681_2721008_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_059644816.1|2721029_2721449_+	YjbQ family protein	NA	NA	NA	NA	NA
WP_059576885.1|2721951_2722362_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_082745093.1|2722800_2724459_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.5	6.4e-34
WP_059644866.1|2724478_2725150_+	organomercurial lyase MerB	NA	NA	NA	NA	NA
WP_059644813.1|2725603_2726008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059644811.1|2726358_2727369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088611397.1|2728157_2729284_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.8	1.2e-57
