The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013417	Burkholderia sp. MSMB0266 chromosome 1, complete sequence	4228278	200990	260334	4228278	head,tail,plate,protease,integrase,transposase	Ralstonia_phage(25.0%)	68	219326:219342	254617:254633
WP_081990112.1|200990_201530_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	49.0	2.2e-20
WP_082717423.1|201802_203821_-	acyltransferase	NA	W6MVL2	Pseudomonas_phage	39.3	6.3e-52
WP_059577323.1|204004_204409_-	hypothetical protein	NA	A0A1S5NV54	Burkholderia_phage	35.3	4.1e-11
WP_082717421.1|204411_205974_-	hypothetical protein	NA	A0A1S5NTG6	Burkholderia_phage	38.7	9.6e-32
WP_004549651.1|205976_206549_-	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_059577314.1|206545_207613_-|plate	baseplate J/gp47 family protein	plate	A0A0M3LQN4	Mannheimia_phage	43.3	1.1e-68
WP_038730277.1|207612_207963_-	phage GP46 family protein	NA	A0A2H4JDR8	uncultured_Caudovirales_phage	57.4	5.4e-28
WP_006025666.1|208028_208631_-|plate	phage baseplate assembly protein V	plate	A0A0M3LPA3	Mannheimia_phage	42.4	1.3e-37
WP_059579172.1|208627_209752_-|tail	phage tail protein	tail	A0A2H4J9E6	uncultured_Caudovirales_phage	42.3	1.8e-77
WP_038748622.1|209735_211046_-	multidrug DMT transporter permease	NA	A0A2H4JGT4	uncultured_Caudovirales_phage	30.1	2.0e-43
WP_038748621.1|211047_213300_-|tail	tail tape measure protein	tail	A0A0M3LPB6	Mannheimia_phage	30.5	2.1e-56
WP_017880452.1|213430_213829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059577766.1|213825_214203_-	hypothetical protein	NA	A0A0M3LRV6	Mannheimia_phage	42.5	4.3e-23
WP_059577769.1|214232_215654_-|tail	phage tail protein	tail	B7SDP8	Haemophilus_phage	48.0	7.2e-103
WP_059577772.1|215657_215885_-	DUF2635 domain-containing protein	NA	A0A0M3LQM9	Mannheimia_phage	56.5	1.9e-05
WP_059580620.1|215881_216550_-	DUF1834 family protein	NA	B7SDP5	Haemophilus_phage	43.3	1.0e-30
WP_059580625.1|216554_216968_-	DUF1320 domain-containing protein	NA	C9DGP4	Escherichia_phage	33.1	2.3e-09
WP_059580628.1|216974_217529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059580633.1|217657_218551_-	hypothetical protein	NA	A0A0M4UKB9	Ralstonia_phage	62.0	1.4e-107
WP_038748614.1|218595_219006_-	hypothetical protein	NA	A0A0M4TU84	Ralstonia_phage	52.9	1.5e-29
WP_038748613.1|219048_220158_-	hypothetical protein	NA	A0A0M5N0Q6	Ralstonia_phage	46.1	2.8e-70
219326:219342	attL	TCGTTGCCGGCGAGCTT	NA	NA	NA	NA
WP_059608733.1|220475_221060_-	phage virion morphogenesis protein	NA	B7SDZ4	Pseudomonas_virus	39.3	7.2e-09
WP_059580643.1|221163_222477_-|head	phage head morphogenesis protein	head	Q6QIB9	Burkholderia_phage	46.9	1.8e-60
WP_085701498.1|222466_224038_-	DUF935 domain-containing protein	NA	A0A0M5MS00	Ralstonia_phage	53.3	1.6e-148
WP_085701499.1|224067_225855_-	hypothetical protein	NA	A0A0M4U7A1	Ralstonia_phage	73.8	1.1e-254
WP_156437474.1|225856_226054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059583899.1|226063_226561_-	DUF1804 family protein	NA	A0A0M3VI86	Ralstonia_phage	69.3	8.2e-54
WP_017880468.1|226566_226776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059583902.1|226772_227042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082717426.1|227065_227299_-	conjugal transfer protein TraR	NA	A0A0M4UVB2	Ralstonia_phage	46.9	1.3e-06
WP_038748603.1|227299_227920_-	hypothetical protein	NA	Q6QIC6	Burkholderia_phage	35.4	2.2e-08
WP_038748602.1|227900_228146_-	hypothetical protein	NA	A0A0M4UKB4	Ralstonia_phage	43.5	1.8e-09
WP_017880473.1|228150_228639_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	48.8	8.7e-32
WP_038748601.1|228766_229201_-|transposase	transposase	transposase	A0A0A1IWZ1	Pseudomonas_phage	40.0	3.4e-19
WP_059582605.1|229197_229608_-	regulatory protein GemA	NA	A0A0M5MRZ7	Ralstonia_phage	46.9	4.9e-28
WP_156432295.1|229674_230133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059582598.1|230142_230700_-	hypothetical protein	NA	A0A1S5NV61	Burkholderia_phage	80.0	4.5e-08
WP_017880478.1|230713_231331_-	DUF3164 family protein	NA	Q5ZR10	Pseudomonas_phage	53.5	1.1e-60
WP_059582595.1|231364_231670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038719153.1|231666_232104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080109822.1|232115_232433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059582590.1|232487_232742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059582586.1|232792_233125_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_038719151.1|233111_233738_-	hypothetical protein	NA	A0A0M3VI82	Ralstonia_phage	51.9	3.7e-19
WP_017880484.1|233730_233961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038730309.1|233968_234715_-	ATP-binding protein	NA	A0A0U5DWK7	unidentified_phage	65.5	2.3e-84
WP_085701500.1|234732_236916_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A125RN39	Pseudomonas_phage	48.5	1.2e-181
WP_038748598.1|236915_237398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081989580.1|237459_237780_-	transcriptional regulator	NA	F6MII4	Haemophilus_phage	59.2	1.8e-17
WP_052145086.1|237939_238707_+	helix-turn-helix transcriptional regulator	NA	A5X9F5	Aeromonas_virus	35.2	3.7e-21
WP_059581661.1|238960_239965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063889464.1|239961_241080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156437473.1|241138_241774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082717525.1|241820_242219_-|integrase	tyrosine-type recombinase/integrase	integrase	C8CLF4	Xylella_phage	61.9	1.3e-33
WP_059581678.1|242808_244239_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.7	6.1e-17
WP_082717522.1|244889_245183_-|tail	phage tail protein	tail	K4NZQ8	Burkholderia_phage	76.3	1.6e-33
WP_156432552.1|246163_247765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059581649.1|247772_249254_-	MBOAT family protein	NA	A0A125RNP0	Pseudomonas_phage	40.8	2.5e-74
WP_038746362.1|250273_251059_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_038746364.1|251055_252402_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_038746367.1|252510_253125_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_059581641.1|253500_254172_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_038746373.1|254211_254730_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
254617:254633	attR	AAGCTCGCCGGCAACGA	NA	NA	NA	NA
WP_038746376.1|254746_256237_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_038746378.1|256309_256813_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_081989470.1|256840_257353_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_082717524.1|257443_259270_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_059581633.1|259233_260334_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 2
NZ_CP013417	Burkholderia sp. MSMB0266 chromosome 1, complete sequence	4228278	578148	587802	4228278		Hokovirus(16.67%)	7	NA	NA
WP_038753329.1|578148_580098_+	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	49.6	1.4e-144
WP_038753330.1|580361_581492_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	27.2	1.7e-22
WP_059583438.1|581523_583560_+	bifunctional anthranilate synthase component I family protein/class IV aminotransferase	NA	S4VT78	Pandoravirus	32.3	1.9e-51
WP_038753332.1|584118_584934_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	32.9	7.4e-36
WP_059583442.1|584996_585680_-	deoxynucleoside kinase	NA	A0A249XZR7	Enterococcus_phage	26.0	3.3e-05
WP_038753334.1|585676_586204_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_038753335.1|586239_587802_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	31.3	3.3e-24
>prophage 3
NZ_CP013417	Burkholderia sp. MSMB0266 chromosome 1, complete sequence	4228278	991145	999724	4228278		Bacillus_phage(16.67%)	8	NA	NA
WP_059584551.1|991145_992549_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.5	9.4e-79
WP_059584553.1|992514_993504_+	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	27.7	2.7e-16
WP_038745594.1|993562_994555_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	30.6	5.9e-27
WP_038745592.1|994626_994944_+	competence protein ComE	NA	NA	NA	NA	NA
WP_038745590.1|995212_996115_+	cysteine synthase CysM	NA	A0A1X9I5K7	Streptococcus_phage	40.2	3.9e-54
WP_082717745.1|996204_997614_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_059584558.1|997663_998587_+	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	35.9	5.4e-43
WP_082717753.1|998884_999724_-	alpha/beta hydrolase	NA	A7XCB7	Tanapox_virus	27.6	5.9e-20
>prophage 4
NZ_CP013417	Burkholderia sp. MSMB0266 chromosome 1, complete sequence	4228278	1313317	1410806	4228278	head,tail,plate,portal,tRNA,terminase,protease,integrase,transposase,capsid	uncultured_Caudovirales_phage(19.23%)	104	1307193:1307217	1379612:1379636
1307193:1307217	attL	ACGTGCTGCGCGCGCTCGGCCGCAA	NA	NA	NA	NA
WP_038750493.1|1313317_1314844_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	35.6	3.1e-83
WP_156432255.1|1314935_1316040_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	37.1	2.2e-06
WP_059577184.1|1316616_1318311_-	single-stranded-DNA-specific exonuclease RecJ	NA	A0A0K2FM92	Brevibacillus_phage	27.5	9.7e-30
WP_082717338.1|1318326_1319403_-	regulator	NA	NA	NA	NA	NA
WP_038750474.1|1320003_1321257_+	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_038750469.1|1321276_1321999_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	38.2	5.2e-33
WP_038750467.1|1322003_1322792_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_059577246.1|1322844_1325376_+	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_059577194.1|1325412_1326243_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_038750462.1|1326520_1328182_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.0	5.4e-150
WP_038750459.1|1328178_1329033_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.9	2.0e-47
WP_006478406.1|1329137_1330421_+	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	62.4	3.8e-151
WP_059577197.1|1330515_1330947_+	cell division protein FtsB	NA	NA	NA	NA	NA
WP_059577200.1|1331142_1331487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038750451.1|1331563_1332514_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_059577204.1|1332553_1333078_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_082717339.1|1333221_1334073_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_059577210.1|1334575_1335466_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_156437452.1|1335678_1336518_+	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_038750439.1|1336584_1337214_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_038750436.1|1337312_1337978_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_059577212.1|1337986_1339189_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_038750431.1|1339185_1339803_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_038750428.1|1339847_1340750_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_059577215.1|1340859_1342005_+	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_038750423.1|1342009_1342786_+	MBL fold metallo-hydrolase	NA	U5PVD0	Bacillus_phage	27.9	1.6e-08
WP_081989776.1|1342956_1343211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082717344.1|1343442_1344606_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_059577221.1|1344698_1345250_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_059577254.1|1345229_1346516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156437453.1|1346502_1349172_-	DNA mismatch repair protein MutS	NA	A0A1V0SDQ0	Indivirus	24.0	9.3e-27
WP_059577227.1|1349343_1350645_+|integrase	integrase family protein	integrase	C7BGE7	Burkholderia_phage	58.1	1.7e-146
WP_082716535.1|1350595_1350838_-	AlpA family phage regulatory protein	NA	C7BGF0	Burkholderia_phage	60.5	4.2e-19
WP_059577256.1|1350846_1351320_-	hypothetical protein	NA	B5TA88	Burkholderia_phage	70.6	3.9e-05
WP_059627740.1|1351328_1351658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085701508.1|1351771_1353091_-	pyridoxal phosphate biosynthetic protein PdxJ	NA	NA	NA	NA	NA
WP_085701509.1|1353090_1353540_-	ACP synthase	NA	NA	NA	NA	NA
WP_059583872.1|1353536_1354142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085701510.1|1354138_1354474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156437577.1|1354528_1354747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059584690.1|1355281_1355767_-	helix-turn-helix transcriptional regulator	NA	A0A193GYL7	Enterobacter_phage	40.2	3.8e-11
WP_060821736.1|1355915_1356143_+	hypothetical protein	NA	B5WZX6	Pseudomonas_phage	49.0	7.1e-05
WP_059710783.1|1356235_1356763_+	hypothetical protein	NA	C7BGG0	Burkholderia_phage	47.3	2.6e-29
WP_059710784.1|1356838_1358206_+	replicative DNA helicase	NA	C7BGG1	Burkholderia_phage	69.0	3.6e-176
WP_082717480.1|1358247_1359258_+	helix-turn-helix domain-containing protein	NA	C7BGG2	Burkholderia_phage	48.8	4.1e-84
WP_059584694.1|1359271_1359679_+	hypothetical protein	NA	C7BGG3	Burkholderia_phage	52.0	6.5e-33
WP_082717481.1|1360104_1360674_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_082717482.1|1360636_1362625_+|terminase	phage terminase large subunit family protein	terminase	A0A2D1GMT1	Marinobacter_phage	53.3	7.1e-181
WP_004533700.1|1362635_1362842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059584700.1|1362838_1364332_+|portal	phage portal protein	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	51.0	4.9e-134
WP_059584703.1|1364328_1365402_+|protease	Clp protease ClpP	protease	A0A2H4JDI2	uncultured_Caudovirales_phage	38.1	1.9e-47
WP_059584705.1|1365428_1365773_+|head	head decoration protein	head	NA	NA	NA	NA
WP_082717483.1|1365806_1366832_+|capsid	major capsid protein	capsid	A0A2H4J890	uncultured_Caudovirales_phage	59.1	2.8e-109
WP_059584710.1|1366835_1367126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059584713.1|1367127_1367658_+|tail	phage tail protein	tail	A0A2H4JBV1	uncultured_Caudovirales_phage	28.8	1.6e-10
WP_059584715.1|1367647_1368181_+	hypothetical protein	NA	Q9JML9	Wolbachia_phage	41.1	1.1e-22
WP_059584717.1|1368183_1368864_+|plate	phage baseplate assembly protein V	plate	Q9JML8	Wolbachia_phage	34.4	3.4e-18
WP_156437578.1|1368972_1370373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082717484.1|1370465_1370663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038717482.1|1370659_1371004_+|plate	phage baseplate protein	plate	A0A2H4JA09	uncultured_Caudovirales_phage	50.9	6.1e-24
WP_059584722.1|1371000_1371894_+|plate	baseplate J protein	plate	D5LGZ3	Escherichia_phage	41.0	8.4e-49
WP_059584724.1|1371886_1372462_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	43.8	2.7e-32
WP_059584727.1|1372449_1374255_+|tail	tail fiber protein	tail	A4JWS9	Burkholderia_virus	67.7	1.4e-151
WP_059584729.1|1374268_1374955_+|tail	phage tail protein	tail	E5E3Q6	Burkholderia_phage	58.6	2.0e-58
WP_059584732.1|1375018_1376188_+|tail	phage tail sheath family protein	tail	A0A2H4J869	uncultured_Caudovirales_phage	72.7	3.4e-159
WP_059584735.1|1376198_1376702_+|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	50.6	4.3e-42
WP_038777205.1|1376767_1377070_+|tail	phage tail assembly protein	tail	V5YST8	Pseudomonas_phage	37.2	2.5e-05
WP_059584738.1|1377157_1379557_+|tail	phage tail tape measure protein	tail	A0A2H4JG00	uncultured_Caudovirales_phage	34.0	3.4e-68
WP_059584740.1|1379565_1380447_+|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	37.5	1.6e-31
1379612:1379636	attR	TTGCGGCCGAGCGCGCGCAGCACGT	NA	NA	NA	NA
WP_024430935.1|1380421_1380628_+|tail	phage tail protein	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	59.7	6.9e-15
WP_059584742.1|1380637_1381690_+	late control protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	43.9	1.3e-77
WP_059584744.1|1381765_1381960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059584747.1|1381952_1382450_+	lysozyme	NA	A4JX20	Burkholderia_virus	79.4	3.8e-67
WP_059584749.1|1382449_1382998_+	lysozyme	NA	A4JX21	Burkholderia_virus	84.4	1.3e-71
WP_085701511.1|1383141_1383930_+	DNA adenine methylase	NA	Q8W6S4	Burkholderia_virus	96.9	1.4e-151
WP_156437472.1|1383965_1384547_-	LysR family transcriptional regulator	NA	A4PE26	Ralstonia_virus	45.4	1.4e-33
WP_082717547.1|1384675_1385278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082758377.1|1385619_1386129_-	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	39.9	6.1e-20
WP_059584022.1|1386125_1386551_-	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	50.6	3.4e-16
WP_156437593.1|1387186_1387921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157131148.1|1388008_1388735_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	34.2	6.5e-07
WP_156437553.1|1389031_1390135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059574446.1|1390481_1390742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059670996.1|1390751_1392374_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	30.5	1.3e-55
WP_082717279.1|1392473_1392887_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	38.5	1.9e-16
WP_059584105.1|1392826_1393288_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_156437539.1|1393398_1394283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059576509.1|1394874_1395336_+	excisionase family DNA-binding protein	NA	K4ICM4	Acidithiobacillus_phage	66.7	2.5e-49
WP_059576511.1|1395340_1395916_+	PIN domain-containing protein	NA	K4HZX4	Acidithiobacillus_phage	68.8	8.6e-71
WP_156432330.1|1396230_1397365_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	31.4	9.4e-21
WP_082717298.1|1397521_1397740_-	DNA mismatch repair protein	NA	NA	NA	NA	NA
WP_156437435.1|1398434_1398764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038750414.1|1399033_1399306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038750411.1|1399572_1400376_-	inositol monophosphatase	NA	NA	NA	NA	NA
WP_082717294.1|1400665_1401592_+	RNA methyltransferase	NA	NA	NA	NA	NA
WP_059574469.1|1401776_1402559_+	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_038750403.1|1402859_1403660_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_038750400.1|1403683_1404175_-	peptidyl-prolyl cis-trans isomerase	NA	A0A2H4UTF4	Bodo_saltans_virus	29.8	8.2e-06
WP_038750397.1|1404255_1404831_-	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	40.0	1.8e-12
WP_081989787.1|1404875_1405541_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_038750392.1|1405831_1407229_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	33.1	4.8e-43
WP_038750389.1|1407276_1408218_+	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_038750386.1|1408321_1409293_+	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_059574471.1|1409336_1410806_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP013417	Burkholderia sp. MSMB0266 chromosome 1, complete sequence	4228278	1523861	1626264	4228278	head,tail,plate,portal,tRNA,protease,integrase,transposase,capsid	uncultured_Caudovirales_phage(28.57%)	107	1511226:1511246	1638690:1638710
1511226:1511246	attL	AATGGCTCGCCGCGCGGCTCG	NA	NA	NA	NA
WP_082717630.1|1523861_1524440_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	31.8	6.7e-07
WP_059574558.1|1524496_1525438_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_038745067.1|1525774_1526470_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038745070.1|1526582_1528118_+	NCS1 family nucleobase:cation symporter-1	NA	NA	NA	NA	NA
WP_038745072.1|1528128_1529058_+	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_038745073.1|1529203_1530154_+	allantoinase PuuE	NA	NA	NA	NA	NA
WP_081989399.1|1530150_1530675_+	2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase	NA	NA	NA	NA	NA
WP_038745139.1|1530916_1531930_+	allantoicase	NA	NA	NA	NA	NA
WP_038745075.1|1531926_1532439_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_038745077.1|1533191_1534385_-	urate hydroxylase PuuD	NA	NA	NA	NA	NA
WP_100185261.1|1534434_1534794_-	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_038745082.1|1535335_1536748_+	8-oxoguanine deaminase	NA	NA	NA	NA	NA
WP_010104452.1|1536935_1537865_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_157131149.1|1537880_1538231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038745088.1|1538537_1538747_-	dodecin domain-containing protein	NA	NA	NA	NA	NA
WP_082717632.1|1538889_1539777_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_038745092.1|1539916_1540405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038745095.1|1540730_1541162_-	large conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_059574564.1|1541346_1542549_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_038745099.1|1542662_1543343_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_100185264.1|1543847_1546385_+	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_038744680.1|1546882_1547338_-	DUF3574 domain-containing protein	NA	NA	NA	NA	NA
WP_038744679.1|1547863_1548895_-	threonine/serine dehydratase	NA	NA	NA	NA	NA
WP_038744677.1|1548962_1550180_-	acetylornithine deacetylase	NA	NA	NA	NA	NA
WP_157131150.1|1550223_1550838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059574570.1|1550887_1551844_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_059574590.1|1552301_1555775_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_038744672.1|1555891_1556602_+	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_038744671.1|1556642_1557131_+	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_038744668.1|1557645_1558173_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_038744667.1|1558250_1558799_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_038744665.1|1558997_1560356_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_004199523.1|1560423_1561149_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	36.7	8.1e-34
WP_009904927.1|1561236_1561419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081989357.1|1561370_1561715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059574591.1|1561923_1563336_+	DUF1800 domain-containing protein	NA	NA	NA	NA	NA
WP_059574593.1|1563418_1564666_+	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_038744661.1|1564682_1565519_-	presqualene diphosphate synthase HpnD	NA	NA	NA	NA	NA
WP_043036221.1|1565984_1567007_+|integrase	integrase	integrase	A0A1B1P9F9	Acinetobacter_phage	46.0	1.3e-66
WP_043037115.1|1567003_1567306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059627740.1|1567856_1568186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085701512.1|1568299_1569619_-	pyridoxal phosphate biosynthetic protein PdxJ	NA	NA	NA	NA	NA
WP_004538495.1|1569618_1570068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059608763.1|1570064_1570670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004538497.1|1570666_1571002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059577261.1|1571056_1571245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059581319.1|1571380_1572586_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_082717526.1|1572834_1573323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082717527.1|1573276_1573777_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_059584220.1|1573894_1574104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082742035.1|1574189_1574717_+	hypothetical protein	NA	C7BGG0	Burkholderia_phage	47.3	7.4e-29
WP_059584693.1|1574792_1576160_+	replicative DNA helicase	NA	C7BGG1	Burkholderia_phage	68.8	8.0e-176
WP_082717480.1|1576201_1577212_+	helix-turn-helix domain-containing protein	NA	C7BGG2	Burkholderia_phage	48.8	4.1e-84
WP_059584694.1|1577225_1577633_+	hypothetical protein	NA	C7BGG3	Burkholderia_phage	52.0	6.5e-33
WP_082717481.1|1578058_1578628_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004533700.1|1580588_1580795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059584700.1|1580791_1582285_+|portal	phage portal protein	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	51.0	4.9e-134
WP_059584703.1|1582281_1583355_+|protease	Clp protease ClpP	protease	A0A2H4JDI2	uncultured_Caudovirales_phage	38.1	1.9e-47
WP_059584705.1|1583381_1583726_+|head	head decoration protein	head	NA	NA	NA	NA
WP_082717483.1|1583759_1584785_+|capsid	major capsid protein	capsid	A0A2H4J890	uncultured_Caudovirales_phage	59.1	2.8e-109
WP_059584710.1|1584788_1585079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059584713.1|1585080_1585611_+|tail	phage tail protein	tail	A0A2H4JBV1	uncultured_Caudovirales_phage	28.8	1.6e-10
WP_059584715.1|1585600_1586134_+	hypothetical protein	NA	Q9JML9	Wolbachia_phage	41.1	1.1e-22
WP_059584717.1|1586136_1586817_+|plate	phage baseplate assembly protein V	plate	Q9JML8	Wolbachia_phage	34.4	3.4e-18
WP_085701513.1|1586925_1587642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157131151.1|1587686_1588325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082717484.1|1588417_1588615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038717482.1|1588611_1588956_+|plate	phage baseplate protein	plate	A0A2H4JA09	uncultured_Caudovirales_phage	50.9	6.1e-24
WP_059584722.1|1588952_1589846_+|plate	baseplate J protein	plate	D5LGZ3	Escherichia_phage	41.0	8.4e-49
WP_157131152.1|1589838_1590654_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	43.7	1.5e-31
WP_059584729.1|1592219_1592906_+|tail	phage tail protein	tail	E5E3Q6	Burkholderia_phage	58.6	2.0e-58
WP_059584732.1|1592969_1594139_+|tail	phage tail sheath family protein	tail	A0A2H4J869	uncultured_Caudovirales_phage	72.7	3.4e-159
WP_059584735.1|1594149_1594653_+|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	50.6	4.3e-42
WP_038777205.1|1594718_1595021_+|tail	phage tail assembly protein	tail	V5YST8	Pseudomonas_phage	37.2	2.5e-05
WP_059584738.1|1595108_1597508_+|tail	phage tail tape measure protein	tail	A0A2H4JG00	uncultured_Caudovirales_phage	34.0	3.4e-68
WP_059584740.1|1597516_1598398_+|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	37.5	1.6e-31
WP_024430935.1|1598372_1598579_+|tail	phage tail protein	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	59.7	6.9e-15
WP_059584742.1|1598588_1599641_+	late control protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	43.9	1.3e-77
WP_059584744.1|1599716_1599911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059584747.1|1599903_1600401_+	lysozyme	NA	A4JX20	Burkholderia_virus	79.4	3.8e-67
WP_059608752.1|1600400_1600946_+	lysozyme	NA	A4JX21	Burkholderia_virus	83.9	7.3e-72
WP_059643804.1|1601089_1601878_+	DNA adenine methylase	NA	Q8W6S4	Burkholderia_virus	96.2	1.1e-150
WP_059580656.1|1601913_1602615_-	LysR family transcriptional regulator	NA	A4PE26	Ralstonia_virus	42.8	2.1e-34
WP_082717550.1|1602617_1603220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082717551.1|1603561_1604071_-	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	38.8	4.7e-20
WP_059580669.1|1604067_1604493_-	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	43.6	2.7e-13
WP_076823392.1|1604552_1604834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059580888.1|1604830_1605298_-	hypothetical protein	NA	C7BGE3	Burkholderia_phage	62.3	1.2e-49
WP_059580673.1|1605377_1606049_+	DUF159 family protein	NA	Q8W6R8	Burkholderia_virus	85.6	2.1e-116
WP_156437499.1|1606420_1606993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156437500.1|1607223_1608579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059580676.1|1609708_1611640_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_152611629.1|1612092_1612284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038744660.1|1612522_1612984_+	MEKHLA domain-containing protein	NA	NA	NA	NA	NA
WP_059580679.1|1613263_1613887_-	phospholipase D family protein	NA	NA	NA	NA	NA
WP_059580680.1|1614077_1615187_-	class II histone deacetylase	NA	A0A2K9L2T7	Tupanvirus	30.6	2.7e-36
WP_059580686.1|1615233_1616421_-	MFS transporter	NA	NA	NA	NA	NA
WP_038744653.1|1616451_1617507_-	porin	NA	NA	NA	NA	NA
WP_081989356.1|1617839_1618988_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_059580690.1|1619082_1620072_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_156437501.1|1620248_1620419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038744647.1|1620538_1620988_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_100185339.1|1621081_1622245_-	glycerate kinase	NA	NA	NA	NA	NA
WP_156432540.1|1622523_1622676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038744644.1|1622695_1624042_+	trigger factor	NA	NA	NA	NA	NA
WP_038744642.1|1624178_1624832_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.5	6.3e-54
WP_038744641.1|1624992_1626264_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.0	5.4e-134
1638690:1638710	attR	CGAGCCGCGCGGCGAGCCATT	NA	NA	NA	NA
>prophage 6
NZ_CP013417	Burkholderia sp. MSMB0266 chromosome 1, complete sequence	4228278	1728774	1740645	4228278		uncultured_Mediterranean_phage(28.57%)	11	NA	NA
WP_038749136.1|1728774_1731261_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	37.0	1.5e-42
WP_006026979.1|1731353_1731680_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_081989624.1|1731711_1732314_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_038749138.1|1732381_1733587_+	CoA transferase	NA	NA	NA	NA	NA
WP_038749141.1|1733692_1734454_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.3	2.8e-61
WP_059580904.1|1734450_1735452_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	48.9	7.7e-35
WP_081989626.1|1735457_1736336_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A0S2SXL7	Bacillus_phage	34.3	3.3e-05
WP_038749147.1|1736347_1737436_+	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	35.4	3.0e-32
WP_059580814.1|1737443_1738220_+	3'-5' exonuclease	NA	R9ZX90	Cellulophaga_phage	31.2	2.2e-05
WP_059580817.1|1738310_1739171_-	endonuclease	NA	NA	NA	NA	NA
WP_038749154.1|1739247_1740645_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	25.4	8.9e-29
>prophage 7
NZ_CP013417	Burkholderia sp. MSMB0266 chromosome 1, complete sequence	4228278	2230109	2303761	4228278	tRNA,transposase,coat	Klosneuvirus(18.18%)	59	NA	NA
WP_059583093.1|2230109_2232977_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	38.6	2.0e-144
WP_038751293.1|2233063_2233945_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.9	1.9e-69
WP_038751295.1|2234016_2234631_-	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_059583089.1|2234720_2237114_-	CHASE2 domain-containing protein	NA	NA	NA	NA	NA
WP_059583086.1|2237124_2238495_-	peptidase M23	NA	NA	NA	NA	NA
WP_004193573.1|2238491_2239196_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_038751300.1|2239520_2239907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004193727.1|2240238_2240469_-	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_059583083.1|2240612_2241650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038751304.1|2241662_2242697_-	inositol 2-dehydrogenase	NA	NA	NA	NA	NA
WP_059583195.1|2242689_2243571_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_059583081.1|2243812_2244862_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_059583078.1|2244962_2246108_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_059583075.1|2246120_2246921_+	sugar ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.4	2.3e-13
WP_059583072.1|2246934_2248953_+	5-dehydro-2-deoxygluconokinase	NA	NA	NA	NA	NA
WP_059583192.1|2248949_2250965_+	3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing)	NA	NA	NA	NA	NA
WP_052145134.1|2250961_2251915_+	myo-inosose-2 dehydratase	NA	NA	NA	NA	NA
WP_059583069.1|2251915_2252719_+	5-deoxy-glucuronate isomerase	NA	NA	NA	NA	NA
WP_059583064.1|2252942_2253647_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	2.3e-09
WP_059583060.1|2253643_2255860_-	branched-chain amino acid ABC transporter ATP-binding protein/permease	NA	A0A2R8FFL6	Cedratvirus	26.9	3.6e-08
WP_038751321.1|2255852_2256788_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_059583054.1|2256792_2257245_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_038751325.1|2257450_2258599_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_038751326.1|2258814_2259150_+	YbjQ family protein	NA	NA	NA	NA	NA
WP_038751328.1|2259283_2259820_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_059583051.1|2259974_2261555_-	PDZ domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	23.8	1.5e-08
WP_059627728.1|2262201_2263863_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_156437581.1|2265043_2265394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038751334.1|2265365_2267990_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.5	9.3e-80
WP_059583034.1|2269109_2270330_+	CoA transferase	NA	NA	NA	NA	NA
WP_156437582.1|2270563_2270920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059583030.1|2271797_2273507_+|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	56.4	4.5e-184
WP_081989902.1|2273831_2274299_-	NUDIX hydrolase	NA	A0A2I6PFL2	Proteus_phage	42.0	5.0e-21
WP_038751339.1|2274326_2274713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059583189.1|2274955_2277001_-	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_059583026.1|2277151_2278012_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_059583022.1|2278054_2279425_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_038751342.1|2279658_2281242_+	acid phosphatase	NA	NA	NA	NA	NA
WP_038751343.1|2281643_2282837_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_038751344.1|2282933_2283566_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_038751345.1|2283566_2285642_-	response regulator	NA	A0A1V0SGR3	Hokovirus	26.4	1.1e-11
WP_059583019.1|2286056_2287022_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_082717362.1|2287037_2289383_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_059583010.1|2289499_2290339_-	molecular chaperone	NA	NA	NA	NA	NA
WP_059583007.1|2290356_2290890_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_038751350.1|2290971_2291532_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_059583186.1|2291585_2292131_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_038751435.1|2292958_2293852_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_145986777.1|2293872_2294208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038751352.1|2294272_2295538_+	MFS transporter	NA	NA	NA	NA	NA
WP_059583002.1|2295582_2296527_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_038751354.1|2297027_2297309_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_081989910.1|2297776_2298079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085701528.1|2298399_2298540_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_156437563.1|2298495_2298981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082717361.1|2299104_2299824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082717352.1|2300543_2301236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081989914.1|2302098_2302359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059582999.1|2302525_2303761_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	40.0	2.3e-36
>prophage 8
NZ_CP013417	Burkholderia sp. MSMB0266 chromosome 1, complete sequence	4228278	2326949	2462708	4228278	head,tail,plate,terminase,integrase,transposase	Ralstonia_phage(42.47%)	137	2323472:2323492	2423207:2423227
2323472:2323492	attL	CTGCTCGCGCGGCACGGCGTC	NA	NA	NA	NA
WP_059582965.1|2326949_2328800_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_156437564.1|2328907_2329516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059583179.1|2330026_2330317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052145136.1|2332608_2333478_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_059582959.1|2333657_2333873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060820863.1|2334244_2334634_-	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_038751380.1|2334646_2335309_-	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_059582951.1|2335354_2336437_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_059582946.1|2336433_2338911_-	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_059582943.1|2338942_2341249_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	24.5	2.3e-26
WP_059582938.1|2341320_2342373_-	type VI secretion protein ImpA	NA	NA	NA	NA	NA
WP_038751388.1|2342446_2343511_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_038751390.1|2343510_2345400_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_100185346.1|2345430_2345913_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_059582934.1|2345995_2347075_-	ImpE/SciE family protein	NA	NA	NA	NA	NA
WP_059582930.1|2347071_2347773_-	TagK domain-containing protein	NA	NA	NA	NA	NA
WP_059582926.1|2348292_2351034_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	32.0	6.7e-81
WP_038751399.1|2351067_2351622_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_059582918.1|2353326_2353812_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_059582915.1|2353901_2354405_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_038751408.1|2354426_2355773_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_082717349.1|2355849_2357139_+	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_059582907.1|2357163_2361282_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_059582900.1|2361770_2367710_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	37.8	2.1e-188
WP_156437565.1|2368251_2368896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059582890.1|2369061_2369460_+	hypothetical protein	NA	Q6JIH0	Burkholderia_virus	89.3	4.9e-57
WP_156437566.1|2369758_2370469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059584105.1|2370850_2371312_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_082717279.1|2371251_2371665_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	38.5	1.9e-16
WP_059670996.1|2371764_2373387_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	30.5	1.3e-55
WP_059574446.1|2373396_2373657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059580591.1|2373933_2374200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059580587.1|2374299_2375067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059580616.1|2375440_2376460_+|integrase	site-specific integrase	integrase	W6MYA3	Pseudomonas_phage	39.0	6.2e-48
WP_059580584.1|2376516_2377536_+|integrase	site-specific integrase	integrase	A0A1L7DQ84	Ralstonia_phage	48.1	2.2e-77
WP_156437469.1|2377654_2377999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059580577.1|2377986_2378442_-	lysozyme	NA	A0A1S6L191	Ralstonia_phage	52.0	2.8e-32
WP_006026405.1|2378441_2378660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059580574.1|2378663_2380460_-|terminase	phage terminase large subunit	terminase	A0A1L7DQE6	Ralstonia_phage	77.8	7.3e-278
WP_059580570.1|2380449_2380764_-	hypothetical protein	NA	A0A1S6L1A7	Ralstonia_phage	45.3	1.0e-09
WP_043282551.1|2380760_2380949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099975900.1|2380958_2381387_-	hypothetical protein	NA	A0A1S5NV54	Burkholderia_phage	33.8	1.2e-13
WP_059580568.1|2381362_2382928_-	hypothetical protein	NA	A0A1S6L1B3	Ralstonia_phage	49.4	7.6e-37
WP_059580565.1|2383007_2387906_-	transglycosylase SLT domain-containing protein	NA	A0A1L7DQA5	Ralstonia_phage	37.2	2.3e-241
WP_082717637.1|2387973_2390079_-	hypothetical protein	NA	A0A0A1I5M8	Burkholderia_phage	34.3	1.7e-79
WP_059580556.1|2390268_2391174_-	hypothetical protein	NA	B5BTX1	Ralstonia_phage	37.7	4.3e-16
WP_082717638.1|2391173_2393327_-|tail	phage tail protein	tail	A0A0A1I627	Burkholderia_phage	51.0	1.9e-211
WP_080595030.1|2393734_2394346_-|tail	phage tail protein	tail	A0A0A1I5V9	Burkholderia_phage	47.3	6.3e-48
WP_006026396.1|2394403_2395417_-	hypothetical protein	NA	A0A1L7DQF3	Ralstonia_phage	70.2	9.0e-132
WP_059580547.1|2395553_2396408_-	hypothetical protein	NA	A0A0A1I5M7	Burkholderia_phage	51.5	5.2e-48
WP_059580543.1|2396414_2397974_-|tail	phage tail protein	tail	A0A1L7DQD6	Ralstonia_phage	63.7	5.7e-178
WP_009916611.1|2397973_2398417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059580540.1|2398426_2399029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059580611.1|2399029_2399461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059580537.1|2399468_2399690_-	hypothetical protein	NA	A0A1S6L1E2	Ralstonia_phage	56.9	2.1e-09
WP_059580532.1|2399718_2402178_-	DNA-directed RNA polymerase	NA	A0A0A8KWP2	Burkholderia_phage	55.7	8.3e-264
WP_059580528.1|2402177_2403101_-	hypothetical protein	NA	A0A1S6L1C1	Ralstonia_phage	45.5	2.1e-66
WP_059580524.1|2403114_2403825_-	hypothetical protein	NA	A0A0A1I625	Burkholderia_phage	42.5	6.1e-34
WP_059580521.1|2403817_2404045_-	hypothetical protein	NA	A0A1S6L1D4	Ralstonia_phage	54.7	2.9e-14
WP_059580516.1|2404044_2405244_-	hypothetical protein	NA	F1ADQ5	Caulobacter_phage	56.7	1.6e-119
WP_059580512.1|2405243_2405645_-	hypothetical protein	NA	A0A1L7DQG2	Ralstonia_phage	51.0	2.0e-18
WP_059580509.1|2405622_2406570_-	hypothetical protein	NA	A0A1L7DQH5	Ralstonia_phage	50.0	9.1e-78
WP_156437468.1|2406569_2407490_-	hypothetical protein	NA	A0A1L7DQE1	Ralstonia_phage	55.0	4.0e-70
WP_059580606.1|2407501_2409913_-	DNA polymerase A family protein	NA	A0A1L7DQB7	Ralstonia_phage	61.9	1.6e-280
WP_059580502.1|2409936_2410173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059580599.1|2410174_2411389_-	AAA family ATPase	NA	A0A1S6L1C9	Ralstonia_phage	65.2	1.2e-151
WP_082717634.1|2411421_2412228_-	hypothetical protein	NA	A0A1L7DQD5	Ralstonia_phage	47.0	3.2e-63
WP_059580498.1|2412227_2412473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059608760.1|2412469_2412922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059580491.1|2412921_2413203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059580487.1|2413282_2413492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059580484.1|2413488_2413707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059580481.1|2413703_2413937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059580473.1|2414061_2414388_-	hypothetical protein	NA	U3TJY1	Ralstonia_phage	46.9	5.8e-08
WP_059580470.1|2414384_2414594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059580469.1|2414590_2414776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059580466.1|2414772_2415120_-	hypothetical protein	NA	A0A0A1I5U1	Burkholderia_phage	45.9	2.4e-15
WP_059580595.1|2415193_2415670_-	hypothetical protein	NA	A0A1L7DQL1	Ralstonia_phage	46.5	2.2e-27
WP_156437467.1|2415804_2415981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059580464.1|2416128_2416347_-	hypothetical protein	NA	A0A0K2QIZ6	Achromobacter_phage	56.5	1.1e-15
WP_063889461.1|2416722_2416989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038749841.1|2418819_2419650_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_059580459.1|2420192_2421101_+	aldose epimerase	NA	NA	NA	NA	NA
WP_038749837.1|2421324_2422026_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A292GJG6	Xanthomonas_phage	42.7	8.4e-12
WP_082717635.1|2422339_2424007_+	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	34.8	5.2e-68
2423207:2423227	attR	CTGCTCGCGCGGCACGGCGTC	NA	NA	NA	NA
WP_081989693.1|2424280_2424634_+	DUF2288 domain-containing protein	NA	NA	NA	NA	NA
WP_059580446.1|2424641_2426036_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_038749822.1|2426246_2426438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082717636.1|2426555_2426777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038749817.1|2427189_2428008_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_038749814.1|2428158_2428617_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_059580443.1|2429254_2430040_+	glycosyltransferase family 25 protein	NA	A0A1S5NQ44	Burkholderia_phage	50.4	1.3e-64
WP_017880445.1|2430144_2430939_-	DNA adenine methylase	NA	Q8W6S4	Burkholderia_virus	67.2	3.1e-103
WP_038719145.1|2431087_2431480_-	hypothetical protein	NA	A0A0U1ZGY3	Ralstonia_phage	35.3	9.8e-10
WP_059580434.1|2432655_2433228_-	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_059580431.1|2433224_2434292_-|plate	baseplate J/gp47 family protein	plate	A0A0M3LQN4	Mannheimia_phage	42.8	4.3e-68
WP_059580426.1|2434291_2434642_-	hypothetical protein	NA	A0A2H4JDR8	uncultured_Caudovirales_phage	56.5	1.9e-25
WP_006025666.1|2434707_2435310_-|plate	phage baseplate assembly protein V	plate	A0A0M3LPA3	Mannheimia_phage	42.4	1.3e-37
WP_059641460.1|2435306_2436431_-|tail	phage tail protein	tail	A0A2H4J9E6	uncultured_Caudovirales_phage	42.6	3.2e-77
WP_085701515.1|2436414_2437725_-	multidrug DMT transporter permease	NA	A0A2H4JGT4	uncultured_Caudovirales_phage	29.9	5.9e-43
WP_038748621.1|2437726_2439979_-|tail	tail tape measure protein	tail	A0A0M3LPB6	Mannheimia_phage	30.5	2.1e-56
WP_017880452.1|2440109_2440508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059582709.1|2440504_2440882_-	hypothetical protein	NA	A0A0M3LRV6	Mannheimia_phage	42.5	2.8e-22
WP_059582712.1|2440911_2442333_-|tail	phage tail protein	tail	B7SDP8	Haemophilus_phage	45.4	1.7e-96
WP_059582717.1|2442336_2442564_-	DUF2635 domain-containing protein	NA	A0A0M3LQM9	Mannheimia_phage	53.6	8.4e-06
WP_059608732.1|2442560_2443229_-	DUF1834 family protein	NA	B7SDP5	Haemophilus_phage	43.9	5.9e-31
WP_059580625.1|2443233_2443647_-	DUF1320 domain-containing protein	NA	C9DGP4	Escherichia_phage	33.1	2.3e-09
WP_059580628.1|2443653_2444208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059580633.1|2444336_2445230_-	hypothetical protein	NA	A0A0M4UKB9	Ralstonia_phage	62.0	1.4e-107
WP_059641470.1|2445274_2445685_-	hypothetical protein	NA	A0A0M4TU84	Ralstonia_phage	53.7	1.8e-30
WP_038748613.1|2445727_2446837_-	hypothetical protein	NA	A0A0M5N0Q6	Ralstonia_phage	46.1	2.8e-70
WP_059580639.1|2447154_2447739_-	phage virion morphogenesis protein	NA	B7SDZ4	Pseudomonas_virus	39.3	7.2e-09
WP_085701516.1|2447842_2449156_-|head	phage head morphogenesis protein	head	Q6QIB9	Burkholderia_phage	46.9	1.8e-60
WP_085701517.1|2449145_2450717_-	DUF935 domain-containing protein	NA	A0A0M5MS00	Ralstonia_phage	52.9	1.8e-147
WP_085701518.1|2450746_2452534_-	hypothetical protein	NA	A0A0M4U7A1	Ralstonia_phage	73.1	5.3e-252
WP_038748608.1|2452533_2452761_-	hypothetical protein	NA	K4F774	Cronobacter_phage	47.3	3.1e-16
WP_038748607.1|2452772_2453270_-	DUF1804 family protein	NA	A0A0M3VI86	Ralstonia_phage	68.7	1.8e-53
WP_038748606.1|2453275_2453482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081989582.1|2453478_2453751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038748604.1|2453771_2454005_-	conjugal transfer protein TraR	NA	A0A0M4UVB2	Ralstonia_phage	45.9	8.7e-06
WP_038748603.1|2454005_2454626_-	hypothetical protein	NA	Q6QIC6	Burkholderia_phage	35.4	2.2e-08
WP_038748602.1|2454606_2454852_-	hypothetical protein	NA	A0A0M4UKB4	Ralstonia_phage	43.5	1.8e-09
WP_085701529.1|2454856_2455303_-	lysozyme	NA	A0A088FRS5	Escherichia_phage	51.4	1.4e-28
WP_156432330.1|2455372_2456507_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	31.4	9.4e-21
WP_038748601.1|2456759_2457194_-|transposase	transposase	transposase	A0A0A1IWZ1	Pseudomonas_phage	40.0	3.4e-19
WP_059582605.1|2457190_2457601_-	regulatory protein GemA	NA	A0A0M5MRZ7	Ralstonia_phage	46.9	4.9e-28
WP_156432295.1|2457667_2458126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059582598.1|2458135_2458693_-	hypothetical protein	NA	A0A1S5NV61	Burkholderia_phage	80.0	4.5e-08
WP_017880478.1|2458706_2459324_-	DUF3164 family protein	NA	Q5ZR10	Pseudomonas_phage	53.5	1.1e-60
WP_059582595.1|2459357_2459663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038719153.1|2459659_2460097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080109822.1|2460108_2460426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059582590.1|2460480_2460735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059582586.1|2460785_2461118_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_038719151.1|2461104_2461731_-	hypothetical protein	NA	A0A0M3VI82	Ralstonia_phage	51.9	3.7e-19
WP_017880484.1|2461723_2461954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038730309.1|2461961_2462708_-	ATP-binding protein	NA	A0A0U5DWK7	unidentified_phage	65.5	2.3e-84
>prophage 9
NZ_CP013417	Burkholderia sp. MSMB0266 chromosome 1, complete sequence	4228278	2566815	2592676	4228278	integrase	Burkholderia_phage(33.33%)	37	2585991:2586008	2594578:2594595
WP_059575415.1|2566815_2567841_-	hypothetical protein	NA	A0A0U2QQI2	Escherichia_phage	46.5	2.7e-75
WP_059575413.1|2567853_2568450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059575411.1|2568453_2570301_-	NUDIX domain-containing protein	NA	A0A0U2QW61	Escherichia_phage	37.4	4.0e-45
WP_059575409.1|2570302_2571139_-	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	44.7	2.4e-61
WP_082717585.1|2571142_2572468_-	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	38.9	1.7e-90
WP_059575407.1|2572600_2573875_-	hypothetical protein	NA	A0A0U2JTW9	Escherichia_phage	40.2	7.4e-83
WP_059575405.1|2573871_2574342_-	hypothetical protein	NA	A0A2P1MXF5	Escherichia_phage	50.0	1.1e-34
WP_059575403.1|2574628_2575216_-	hypothetical protein	NA	A9YWZ1	Burkholderia_phage	77.4	3.5e-80
WP_059575401.1|2575226_2575697_-	RusA family crossover junction endodeoxyribonuclease	NA	A9YWY9	Burkholderia_phage	71.2	2.0e-54
WP_156437407.1|2575693_2575867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059575400.1|2575863_2576484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059575398.1|2576452_2577274_-	hypothetical protein	NA	A0A2H4J0Z7	uncultured_Caudovirales_phage	35.0	2.6e-12
WP_082717579.1|2577359_2577626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059575393.1|2577622_2577946_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_059575474.1|2577942_2578197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156437408.1|2578291_2579047_+	LexA family transcriptional repressor	NA	H2BDH4	Pseudomonas_virus	26.2	3.9e-15
WP_059575390.1|2579062_2579263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059575472.1|2580321_2580699_+	DUF1566 domain-containing protein	NA	NA	NA	NA	NA
WP_059575388.1|2580730_2581051_+	hypothetical protein	NA	Q3HQW8	Burkholderia_phage	75.7	1.0e-36
WP_059575387.1|2581047_2581443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059575385.1|2581439_2581619_+	hypothetical protein	NA	A9YWW6	Burkholderia_phage	86.2	1.4e-19
WP_059575383.1|2581954_2582239_+	KTSC domain-containing protein	NA	A9YWW2	Burkholderia_phage	72.7	1.0e-29
WP_059575381.1|2582278_2583319_+	hypothetical protein	NA	H2BD49	Pseudomonas_phage	47.5	3.6e-59
WP_059575379.1|2583318_2583936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059575377.1|2583892_2584699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059575375.1|2584732_2585407_+	hypothetical protein	NA	J7I0T4	Pseudomonas_phage	44.4	3.2e-24
WP_157131153.1|2585334_2586135_+	1-pyrroline-5-carboxylate dehydrogenase	NA	A9YX18	Burkholderia_phage	60.4	2.4e-07
2585991:2586008	attL	CGAAGCGAAGCCGAAGCG	NA	NA	NA	NA
WP_059575372.1|2586324_2586681_+	DUF1566 domain-containing protein	NA	NA	NA	NA	NA
WP_059575370.1|2586711_2587176_+	DUF1566 domain-containing protein	NA	NA	NA	NA	NA
WP_059575368.1|2587190_2587568_+	four helix bundle protein	NA	NA	NA	NA	NA
WP_059575469.1|2587902_2588898_+	RNA-directed DNA polymerase	NA	A0A0N7AE80	Bacillus_phage	34.6	1.5e-43
WP_059575470.1|2588910_2590146_+	phosphoadenosine phosphosulfate reductase family protein	NA	R9TRT5	Rhizobium_phage	71.1	2.2e-172
WP_059575366.1|2590142_2590841_+	hypothetical protein	NA	Q8W6Q9	Burkholderia_virus	49.6	4.1e-27
WP_059575364.1|2590837_2591080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059575361.1|2591076_2591409_+	hypothetical protein	NA	A9YWU9	Burkholderia_phage	62.9	3.2e-14
WP_059575359.1|2591405_2591654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059575356.1|2591638_2592676_-|integrase	site-specific integrase	integrase	Q19US1	Mannheimia_phage	42.4	1.3e-64
2594578:2594595	attR	CGCTTCGGCTTCGCTTCG	NA	NA	NA	NA
>prophage 10
NZ_CP013417	Burkholderia sp. MSMB0266 chromosome 1, complete sequence	4228278	3044800	3055696	4228278	protease	Agrobacterium_phage(16.67%)	9	NA	NA
WP_038745286.1|3044800_3047101_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.1	3.3e-166
WP_009892611.1|3047097_3047412_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	44.6	2.6e-13
WP_004196460.1|3047943_3048147_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	81.8	6.8e-23
WP_059581499.1|3048273_3049869_-	multicopper oxidase family protein	NA	NA	NA	NA	NA
WP_038745290.1|3050036_3051296_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	63.0	5.2e-12
WP_038745292.1|3051560_3052139_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_081463944.1|3052400_3052616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038745294.1|3052810_3053320_+	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	43.1	6.5e-14
WP_059581496.1|3053581_3055696_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.6	3.4e-56
>prophage 1
NZ_CP013418	Burkholderia sp. MSMB0266 chromosome 2, complete sequence	2824254	7272	48988	2824254	plate,integrase,transposase,tRNA,tail	Burkholderia_phage(47.06%)	44	3349:3366	35057:35074
3349:3366	attL	CGCTGCGTCGCGGCAAGC	NA	NA	NA	NA
WP_059576426.1|7272_8313_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	53.4	2.9e-93
WP_038743381.1|8443_9667_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004190342.1|9746_9959_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_038743383.1|10129_10576_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	49.3	8.8e-23
WP_038743385.1|10670_12551_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	36.9	1.3e-67
WP_059576423.1|12612_12936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038743389.1|12994_15037_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.0	4.2e-35
WP_145986859.1|15418_15751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038743391.1|15938_16553_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_059576419.1|16621_17269_-	2OG-Fe(II) oxygenase	NA	NA	NA	NA	NA
WP_059576416.1|17330_18638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038743397.1|19130_19487_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	77.7	3.2e-44
WP_059576413.1|19671_20286_-	DUF3164 family protein	NA	Q6QIE4	Burkholderia_phage	81.8	3.2e-92
WP_059576410.1|20359_20722_-	hypothetical protein	NA	Q6QIE2	Burkholderia_phage	61.6	6.4e-24
WP_063889428.1|20723_22025_-	AAA family ATPase	NA	Q6QIE1	Burkholderia_phage	67.7	1.4e-156
WP_059576407.1|22021_23821_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6QIE0	Burkholderia_phage	80.8	1.2e-283
WP_038743842.1|24963_25275_-	helix-turn-helix domain-containing protein	NA	A4JWN4	Burkholderia_virus	81.1	9.1e-35
WP_156432513.1|25271_25730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038743404.1|25776_26019_-	DNA-binding protein	NA	Q6QID3	Burkholderia_phage	90.0	9.5e-32
WP_038743406.1|26134_26578_+	helix-turn-helix transcriptional regulator	NA	A4JWR8	Burkholderia_virus	50.7	6.0e-24
WP_059576401.1|26643_27459_+	hypothetical protein	NA	A4JWN9	Burkholderia_virus	32.6	4.1e-26
WP_059576395.1|28064_28412_+	hypothetical protein	NA	Q6QIC8	Burkholderia_phage	79.1	3.5e-43
WP_059576497.1|28414_29023_+	transglycosylase SLT domain-containing protein	NA	Q6QIC7	Burkholderia_phage	79.6	3.1e-87
WP_059576392.1|29019_29622_+	hypothetical protein	NA	A4JWP5	Burkholderia_virus	57.6	2.6e-46
WP_038743412.1|29618_29957_+	hypothetical protein	NA	A4JWP6	Burkholderia_virus	84.5	1.1e-44
WP_059576390.1|29953_30286_+	hypothetical protein	NA	Q6QIC3	Burkholderia_phage	83.6	3.3e-51
WP_038743848.1|31891_32356_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	62.1	3.8e-45
WP_038743417.1|32352_32595_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	62.5	4.9e-20
WP_038743419.1|32599_34033_+|tail	tail protein	tail	A4JWK5	Burkholderia_virus	87.2	4.7e-243
WP_059576387.1|34034_34559_+|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	90.8	2.0e-87
WP_038743850.1|34995_35325_+|tail	phage tail assembly protein	tail	Q6QIA8	Burkholderia_phage	70.0	3.7e-26
35057:35074	attR	CGCTGCGTCGCGGCAAGC	NA	NA	NA	NA
WP_059576494.1|35731_38290_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	53.1	1.0e-200
WP_059576384.1|38291_39194_+|tail	phage tail protein	tail	Q6QIA4	Burkholderia_phage	64.8	1.8e-70
WP_038743426.1|39193_39400_+	membrane protein	NA	A4JWL2	Burkholderia_virus	75.4	9.6e-25
WP_059576380.1|39387_40608_+	Cro/Cl family transcriptional regulator	NA	A4JWL3	Burkholderia_virus	67.8	2.4e-131
WP_038743429.1|40604_41207_+|plate	phage baseplate assembly protein V	plate	Q6QIA1	Burkholderia_phage	78.5	1.4e-63
WP_156437461.1|41657_41846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156437460.1|41924_43544_+	hypothetical protein	NA	A4JWL8	Burkholderia_virus	50.7	2.1e-90
WP_059576374.1|43540_43984_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_038743435.1|44183_44537_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	82.9	1.4e-52
WP_059576372.1|44533_45685_+|plate	baseplate protein	plate	A4JWL6	Burkholderia_virus	79.4	1.2e-167
WP_059576370.1|45677_46259_+|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	86.5	2.3e-92
WP_059576367.1|46258_48217_+|tail	tail fiber protein	tail	Q45YG3	Burkholderia_virus	62.2	1.2e-140
WP_082717709.1|48232_48988_+|tail	phage tail protein	tail	E5E3Q6	Burkholderia_phage	59.7	7.6e-59
>prophage 2
NZ_CP013418	Burkholderia sp. MSMB0266 chromosome 2, complete sequence	2824254	1570089	1634944	2824254	terminase,tail,integrase,transposase	Stx2-converting_phage(17.65%)	59	1623119:1623143	1629140:1629164
WP_157131168.1|1570089_1570641_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	27.8	3.2e-06
WP_059584214.1|1570637_1570982_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	70.4	2.7e-40
WP_059584212.1|1571012_1572566_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	55.0	2.7e-151
WP_045598729.1|1572860_1573121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156432330.1|1573932_1575067_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	31.4	9.4e-21
WP_082717279.1|1575250_1575664_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	38.5	1.9e-16
WP_059584105.1|1575603_1576065_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_081989327.1|1581812_1581929_-	phenylacetate-CoA oxygenase	NA	NA	NA	NA	NA
WP_038754968.1|1582400_1582952_-	phosphohydrolase	NA	A0A2K9L141	Tupanvirus	30.6	1.2e-16
WP_059579922.1|1582956_1584411_-	phosphonoacetaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_059579925.1|1584407_1585679_-	phosphonoacetate hydrolase	NA	NA	NA	NA	NA
WP_038754958.1|1585709_1586564_-	2-aminoethylphosphonate ABC transport system, membrane component PhnV	NA	NA	NA	NA	NA
WP_038754955.1|1586553_1587501_-	2-aminoethylphosphonate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_059579928.1|1587478_1588576_-	2-aminoethylphosphonate ABC transport system ATP-binding subunit PhnT	NA	G3M9Y6	Bacillus_virus	33.5	1.1e-26
WP_038754949.1|1588632_1589715_-	2-aminoethylphosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_081990111.1|1589760_1589946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038754946.1|1589953_1591063_+	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
WP_059579933.1|1591370_1592714_-	MFS transporter	NA	NA	NA	NA	NA
WP_038754941.1|1592757_1593612_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_038754938.1|1593608_1594064_-	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_059579936.1|1594318_1596313_+	sugar phosphate isomerase/epimerase and 4-hydroxyphenylpyruvate domain-containing protein	NA	NA	NA	NA	NA
WP_038754932.1|1596912_1598562_-	L-lactate permease	NA	NA	NA	NA	NA
WP_156437424.1|1598560_1598980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059579941.1|1598954_1601129_-	malate synthase G	NA	NA	NA	NA	NA
WP_038750931.1|1602120_1602390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059579946.1|1602987_1603881_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_059579951.1|1603916_1605218_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_038750928.1|1605214_1605448_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_038750927.1|1605444_1606578_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_038750926.1|1606574_1607507_-	4-hydroxyproline epimerase	NA	NA	NA	NA	NA
WP_059579956.1|1607756_1608677_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_038750924.1|1609206_1610832_+	APC family permease	NA	NA	NA	NA	NA
WP_059579960.1|1610908_1612501_+	aldehyde dehydrogenase (NADP(+))	NA	NA	NA	NA	NA
WP_059579964.1|1612493_1613525_+	Ldh family oxidoreductase	NA	NA	NA	NA	NA
WP_038750921.1|1613839_1615132_+	MFS transporter	NA	NA	NA	NA	NA
WP_059579968.1|1615696_1617214_+	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	30.2	4.9e-33
WP_059579971.1|1617864_1619313_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_059579974.1|1619389_1620535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059580312.1|1620546_1621839_+	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_038750916.1|1622176_1622614_-	DoxX family protein	NA	NA	NA	NA	NA
1623119:1623143	attL	TCACCCTGTGCTGAGTTATTCGGGC	NA	NA	NA	NA
WP_157131162.1|1623133_1623346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059579982.1|1623460_1624645_-|integrase	site-specific integrase	integrase	Q9ZXG4	Shigella_phage	26.5	7.1e-11
WP_059579984.1|1624641_1624995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156437422.1|1624891_1625269_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_059579987.1|1625556_1626264_+	hypothetical protein	NA	A5X9F5	Aeromonas_virus	38.3	3.1e-30
WP_059579990.1|1626388_1626838_-	hypothetical protein	NA	D6RRP3	Pseudomonas_phage	41.3	4.0e-15
WP_059608743.1|1626910_1627231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059579993.1|1627244_1627457_-	hypothetical protein	NA	A0A0K2QIZ6	Achromobacter_phage	57.8	1.3e-13
WP_059579996.1|1627468_1627708_-	hypothetical protein	NA	A0A0A6Z564	Enterobacter_phage	62.5	8.3e-20
WP_059579999.1|1627819_1628044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059580003.1|1628244_1628592_-	hypothetical protein	NA	I6NP76	Burkholderia_phage	74.5	1.8e-39
WP_059580015.1|1628644_1628845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156437421.1|1629634_1629811_+	hypothetical protein	NA	NA	NA	NA	NA
1629140:1629164	attR	TCACCCTGTGCTGAGTTATTCGGGC	NA	NA	NA	NA
WP_059580022.1|1629901_1631767_-|terminase	phage terminase large subunit	terminase	A0A076YJ70	Mesorhizobium_phage	43.2	2.7e-113
WP_059580025.1|1631763_1632045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059580029.1|1632041_1632374_-	hypothetical protein	NA	B5BTX5	Ralstonia_phage	41.6	5.2e-12
WP_059580033.1|1632370_1632658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059580036.1|1632657_1632867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059580040.1|1632901_1634944_-|tail	tail fiber domain-containing protein	tail	R4JJY3	Burkholderia_phage	29.4	4.0e-22
>prophage 3
NZ_CP013418	Burkholderia sp. MSMB0266 chromosome 2, complete sequence	2824254	1647066	1662101	2824254		Rhizobium_phage(18.18%)	18	NA	NA
WP_059580070.1|1647066_1649397_-	hypothetical protein	NA	A0A0P0UWF2	Pectobacterium_phage	24.4	6.9e-26
WP_059580073.1|1649396_1649975_-	hypothetical protein	NA	A0A218M4G9	Pasteurella_phage	29.6	1.9e-09
WP_059580077.1|1650034_1651033_-	hypothetical protein	NA	M1HMB6	Pelagibacter_phage	30.5	1.1e-28
WP_059580081.1|1651158_1651947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082717415.1|1651943_1653476_-	hypothetical protein	NA	L7TJ79	Rhizobium_phage	32.9	1.5e-50
WP_156437418.1|1653472_1653655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156437417.1|1654392_1654593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063889456.1|1654827_1655382_-	hypothetical protein	NA	A0A2H4J8A1	uncultured_Caudovirales_phage	40.0	9.5e-35
WP_082717414.1|1655359_1656247_-	hypothetical protein	NA	L7TLU4	Rhizobium_phage	39.1	2.7e-31
WP_059580108.1|1656150_1656453_-	hypothetical protein	NA	A0A2D1GM12	Salmonella_phage	42.3	1.2e-07
WP_059580111.1|1656452_1657001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059580116.1|1656987_1658847_-	hypothetical protein	NA	F8R4R8	Escherichia_phage	33.5	4.7e-70
WP_059580119.1|1658846_1659035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156437416.1|1659031_1659358_-	hypothetical protein	NA	A0A2D2W4Y4	Ralstonia_phage	43.0	4.0e-17
WP_082717413.1|1659344_1661009_-	AAA family ATPase	NA	A0A0U1ZI53	Ralstonia_phage	40.4	4.1e-105
WP_059580127.1|1661008_1661257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156437415.1|1661256_1661424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059580131.1|1661426_1662101_-	hypothetical protein	NA	A0A0A7HCL4	Escherichia_phage	36.8	1.4e-32
>prophage 1
NZ_CP013419	Burkholderia sp. MSMB0266 plasmid pMSMB0266, complete sequence	375023	82585	206689	375023	protease,holin,integrase,lysis,plate,tail,transposase	Burkholderia_phage(30.77%)	103	118882:118941	216515:216646
WP_059583948.1|82585_83113_+|protease	hydrogenase maturation protease	protease	NA	NA	NA	NA
WP_059583950.1|83105_83393_+	hydrogenase nickel incorporation protein HypA	NA	NA	NA	NA	NA
WP_059583952.1|83392_85723_+	carbamoyltransferase HypF	NA	NA	NA	NA	NA
WP_059584010.1|85722_85965_+	HypC/HybG/HupF family hydrogenase formation chaperone	NA	NA	NA	NA	NA
WP_059583954.1|85961_87107_+	hydrogenase formation protein HypD	NA	NA	NA	NA	NA
WP_059583956.1|87103_88156_+	hydrogenase expression/formation protein HypE	NA	NA	NA	NA	NA
WP_059583957.1|88708_89521_+	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.3	5.3e-26
WP_059710775.1|89477_90326_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_157131170.1|90345_92001_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_059583962.1|94017_95190_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_059583965.1|95339_95885_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_059583969.1|97374_99141_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	50.3	9.2e-132
WP_059583971.1|99137_100160_+	pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha	NA	NA	NA	NA	NA
WP_059583974.1|100156_101131_+	alpha-ketoacid dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_059583977.1|101159_102299_+	2-oxo acid dehydrogenase subunit E2	NA	NA	NA	NA	NA
WP_059583979.1|102295_102544_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_059584012.1|102540_102972_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_059583982.1|102991_104068_+	hypothetical protein	NA	A0A2H4J9J6	uncultured_Caudovirales_phage	28.4	5.2e-21
WP_082717569.1|105858_106368_-	DUF2059 domain-containing protein	NA	NA	NA	NA	NA
WP_059583984.1|106797_107409_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_059583987.1|107405_109031_-	MCE family protein	NA	NA	NA	NA	NA
WP_059583989.1|109023_109743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059583992.1|109739_110396_-	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_059583997.1|111039_111702_-	DUF3313 domain-containing protein	NA	NA	NA	NA	NA
WP_059583999.1|111974_112571_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_082717564.1|113313_114015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059584002.1|114019_114388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059584004.1|114630_114894_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_063889481.1|114890_115319_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_059584018.1|115330_116413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156439882.1|116828_117964_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	26.5	8.8e-11
WP_157131171.1|118183_119000_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
118882:118941	attL	CACTTCCGTCGCCTCCGTATTCGTCTCGAGCGCCGTGCTGACATTCACGGCGCGTTCCTC	NA	NA	NA	NA
WP_059579167.1|119082_120045_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	68.1	2.2e-119
WP_156432335.1|120285_120756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059579164.1|120990_123120_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	28.8	1.2e-40
WP_059579161.1|123147_124572_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_082717301.1|124663_126061_+	TolC family protein	NA	NA	NA	NA	NA
WP_059579158.1|127838_128627_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	32.3	3.1e-31
WP_059579152.1|129367_129751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045598729.1|130618_130879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063889484.1|134241_134355_-|tail	GpE family phage tail protein	tail	A0A089FGX3	Burkholderia_phage	91.9	1.0e-12
WP_059627739.1|134526_134997_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_045598729.1|135060_135321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085701527.1|135330_136953_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.1	4.7e-66
WP_082717279.1|137052_137466_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	38.5	1.9e-16
WP_059584105.1|137405_137867_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_059583232.1|137948_138227_-|tail	phage tail assembly protein	tail	K4NXA3	Burkholderia_phage	91.3	3.0e-37
WP_156437503.1|138563_139301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059583227.1|139477_139897_-|tail	phage tail protein	tail	A4JWT7	Burkholderia_virus	90.6	2.1e-66
WP_059583236.1|139889_140024_-	hypothetical protein	NA	K4PAX1	Burkholderia_phage	90.9	1.2e-15
WP_059583224.1|140001_140442_-|lysis	LysB family phage lysis regulatory protein	lysis	K4NXJ2	Burkholderia_phage	93.2	1.2e-67
WP_059583222.1|140438_141251_-	DUF3380 domain-containing protein	NA	A4JWZ0	Burkholderia_virus	94.8	1.8e-143
WP_059583219.1|141247_141520_-|holin	phage holin family protein	holin	K4NX91	Burkholderia_phage	96.7	1.7e-40
WP_059583217.1|141521_141866_-	hypothetical protein	NA	K4NZQ3	Burkholderia_phage	95.6	3.0e-47
WP_059583215.1|142084_142336_-	hypothetical protein	NA	A4JWZ4	Burkholderia_virus	68.7	1.4e-22
WP_059583208.1|144301_144661_-	type II toxin-antitoxin system HicB family antitoxin	NA	R4JJS9	Burkholderia_phage	80.7	3.0e-50
WP_059583206.1|144657_144912_-	type II toxin-antitoxin system HicA family toxin	NA	R4JMD3	Burkholderia_phage	91.7	6.5e-39
WP_156432331.1|145276_145522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059583204.1|147109_148378_+	serine dehydratase subunit alpha family protein	NA	NA	NA	NA	NA
WP_059583202.1|148409_149156_+	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_059583200.1|149143_149464_+	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_157131172.1|149973_150790_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_156432332.1|151997_152390_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_059584666.1|152386_152722_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_059669918.1|154144_156223_-	serine recombinase	NA	I3VYZ3	Thermoanaerobacterium_phage	22.8	3.1e-09
WP_082717267.1|156209_156413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156432333.1|158052_159561_+	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_059584678.1|159574_160624_+	Ldh family oxidoreductase	NA	NA	NA	NA	NA
WP_059584683.1|160981_161551_-	hypothetical protein	NA	B0FIT1	Escherichia_phage	31.6	4.1e-09
WP_059574913.1|163833_164841_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A223VZK2	Agrobacterium_phage	30.6	6.6e-10
WP_059574911.1|164954_166280_+	autotransporter strand-loop-strand O-heptosyltransferase	NA	NA	NA	NA	NA
WP_082717445.1|166418_167789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059574904.1|167838_168198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059574903.1|168419_170126_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_059574901.1|170116_170851_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_059574899.1|170847_172650_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	29.0	4.0e-05
WP_059574897.1|172929_173424_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_082717447.1|173447_174962_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_059574893.1|175145_175634_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_063889415.1|175630_176083_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_059574889.1|176108_177842_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_059574887.1|177829_178849_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_059574925.1|178835_181544_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	29.7	8.1e-87
WP_059574886.1|181570_184555_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_059574883.1|184580_187142_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_059574881.1|187150_188215_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_082717444.1|188235_188934_+	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_059574877.1|188962_189355_+	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_059574875.1|189364_190093_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_059574921.1|190116_191529_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_059574873.1|191525_192191_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_059574923.1|192202_195892_+	type VI secretion system protein ImpL	NA	NA	NA	NA	NA
WP_082717443.1|195949_197140_+	peptidase	NA	NA	NA	NA	NA
WP_082717442.1|197130_198237_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_059574919.1|198510_198924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082717441.1|199194_199866_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_059574866.1|199993_200473_-	chaperone SicP	NA	NA	NA	NA	NA
WP_059574863.1|200543_202091_-	autophagy evasion T3SS effector BopA	NA	NA	NA	NA	NA
WP_156437409.1|202083_202707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059574861.1|202703_203447_+	type III secretion protein BopE	NA	NA	NA	NA	NA
WP_082717279.1|204757_205171_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	38.5	1.9e-16
WP_059584105.1|205110_205572_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_156437608.1|205660_206689_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
216515:216646	attR	CACTTCCGTCGCCTCCGTATTCGTCTCGAGCGCCGTGCTGACATTCACGGCGCGTTCCTCAAACTCGGTTGCTGCCTGATCTGCTGGAATACCCTCCGGCGCGCCCAGCAGCCTTTATGAAACCGTCTCTTA	NA	NA	NA	NA
>prophage 2
NZ_CP013419	Burkholderia sp. MSMB0266 plasmid pMSMB0266, complete sequence	375023	280944	343209	375023	transposase,tail	Leptospira_phage(33.33%)	54	NA	NA
WP_059577754.1|280944_282240_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_059577654.1|282338_282620_-	BapB protein	NA	NA	NA	NA	NA
WP_157131175.1|282616_286270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059577649.1|287532_288471_-	IpaD/SipD/SspD family type III secretion system needle tip protein	NA	NA	NA	NA	NA
WP_059577751.1|288539_288833_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_059577647.1|288968_290156_-	IpaC/SipC family type III secretion system effector	NA	NA	NA	NA	NA
WP_059577644.1|290212_292087_-	YopB/SseC family type III secretion system translocon subunit	NA	NA	NA	NA	NA
WP_059577641.1|292105_292627_-	type III secretion system translocator chaperone SicA	NA	NA	NA	NA	NA
WP_082717320.1|293981_294740_-	EscT/YscT/HrcT family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
WP_059577637.1|294763_295018_-	EscS/YscS/HrcS family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
WP_059577634.1|295051_295732_-	EscR/YscR/HrcR family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
WP_059577631.1|295721_296684_-	YscQ/HrcQ family type III secretion apparatus protein	NA	NA	NA	NA	NA
WP_063889445.1|296680_297766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059577628.1|297743_298208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059577624.1|298204_299515_-	FliI/YscN family ATPase	NA	NA	NA	NA	NA
WP_059577620.1|299511_299919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059577617.1|299929_302008_-	EscV/YscV/HrcV family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
WP_059577615.1|302052_303177_-	YopN family type III secretion system gatekeeper subunit	NA	NA	NA	NA	NA
WP_059577612.1|303173_305048_-	EscC/YscC/HrcC family type III secretion system outer membrane ring protein	NA	R9TEZ5	Vibrio_phage	26.7	5.4e-13
WP_059577609.1|305061_305820_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_059577606.1|306200_307490_+	PrgH/EprH family type III secretion apparatus protein	NA	NA	NA	NA	NA
WP_059577603.1|307486_307756_+	EscF/YscF/HrpA family type III secretion system needle major subunit	NA	NA	NA	NA	NA
WP_059577599.1|307814_308117_+	type III secretion system protein	NA	NA	NA	NA	NA
WP_082717319.1|308121_308988_+	EscJ/YscJ/HrcJ family type III secretion inner membrane ring protein	NA	NA	NA	NA	NA
WP_059577596.1|308984_309569_+	type III secretion apparatus protein OrgA/MxiK	NA	NA	NA	NA	NA
WP_059577593.1|309537_310317_+	type III secretion system protein	NA	NA	NA	NA	NA
WP_059577591.1|310285_310480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156437540.1|310649_310790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156439882.1|310790_311926_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	26.5	8.8e-11
WP_082717728.1|312047_312500_-	lytic transglycosylase domain-containing protein	NA	A0A0K2QQJ4	Ralstonia_phage	44.0	5.4e-12
WP_082717729.1|312777_313701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157131176.1|314085_317241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045598729.1|318017_318278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156432289.1|318911_319172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059581540.1|319348_319801_+	helix-turn-helix domain containing protein	NA	NA	NA	NA	NA
WP_059581537.1|319836_320088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059581534.1|320077_322159_+	recombinase family protein	NA	A0A0H3UZF2	Geobacillus_virus	20.0	5.8e-08
WP_156437455.1|322654_325213_-	fimbria/pilus outer membrane usher protein	NA	NA	NA	NA	NA
WP_059584129.1|325337_326039_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_082717273.1|326146_326692_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_082717272.1|326743_327298_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_082717271.1|327718_328864_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_059584133.1|330071_330611_+	lysozyme	NA	Q8W6S5	Burkholderia_virus	74.9	1.3e-60
WP_156437454.1|330706_331270_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	26.8	3.1e-09
WP_059584119.1|332127_332421_+|tail	phage tail assembly protein	tail	Q6QIA8	Burkholderia_phage	78.7	1.5e-31
WP_059584115.1|332593_332836_-	hypothetical protein	NA	A4JWK9	Burkholderia_virus	76.2	5.4e-27
WP_082717573.1|334143_334347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082717571.1|335723_336698_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_082717570.1|338341_338653_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_059584108.1|338757_338979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085701565.1|339201_339663_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_157131177.1|340824_341463_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	38.5	3.0e-16
WP_045598729.1|342271_342532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059627737.1|342651_343209_-|transposase	transposase	transposase	NA	NA	NA	NA
