The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013386	Burkholderia sp. BDU6 chromosome 1, complete sequence	3838800	434360	462586	3838800	tail,protease,plate	Burkholderia_phage(44.44%)	24	NA	NA
WP_059472260.1|434360_434885_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	51.5	1.1e-21
WP_159082853.1|435038_435959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082722386.1|435972_436809_-	hypothetical protein	NA	S5YQN9	Mycobacterium_phage	43.2	3.9e-48
WP_059598042.1|437915_438194_-	DUF4224 domain-containing protein	NA	E5E3T1	Burkholderia_phage	84.1	1.8e-34
WP_108033886.1|438298_438865_-|plate	Baseplate J family protein	plate	A0A089FGR9	Burkholderia_phage	83.8	1.8e-49
WP_108033887.1|439909_440500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082722422.1|440603_441071_-	phage virion morphogenesis protein	NA	K4NZQ8	Burkholderia_phage	90.3	1.2e-70
WP_059472116.1|441067_441484_-|tail	phage tail protein	tail	A4JWT7	Burkholderia_virus	92.8	5.4e-67
WP_050042436.1|441476_441611_-	hypothetical protein	NA	K4PAX1	Burkholderia_phage	93.2	4.0e-16
WP_059598340.1|442336_444739_+	N-6 DNA methylase	NA	A0A2H4PQP4	Staphylococcus_phage	37.0	2.1e-70
WP_159082854.1|444729_445986_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_059473094.1|445995_449082_+	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_059473095.1|449078_449807_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_082722425.1|450124_452089_+	ATP-binding protein	NA	A0A2H4J2R8	uncultured_Caudovirales_phage	65.6	6.2e-246
WP_059473096.1|452307_452808_-	TIGR04141 family sporadically distributed protein	NA	NA	NA	NA	NA
WP_059473097.1|453596_454382_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_059473098.1|454378_455725_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_059473099.1|455833_456448_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_059598338.1|456823_457492_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_059598337.1|457528_458047_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_059473102.1|458063_459554_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_059473103.1|459625_460129_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_059598336.1|460186_460669_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_059598335.1|460747_462586_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 2
NZ_CP013386	Burkholderia sp. BDU6 chromosome 1, complete sequence	3838800	989803	1000661	3838800	protease	Streptococcus_phage(16.67%)	9	NA	NA
WP_059469266.1|989803_991918_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.3	1.2e-56
WP_059469303.1|992165_992675_-	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	6.5e-14
WP_059469265.1|992864_993083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059469264.1|993346_993925_-	pseudouridine synthase	NA	NA	NA	NA	NA
WP_059469263.1|994191_995451_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	63.0	1.5e-11
WP_059469262.1|995618_997205_+	multicopper oxidase family protein	NA	NA	NA	NA	NA
WP_004196460.1|997316_997520_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	81.8	6.8e-23
WP_059469261.1|998049_998364_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	43.4	9.9e-13
WP_059596451.1|998360_1000661_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.5	5.1e-167
>prophage 3
NZ_CP013386	Burkholderia sp. BDU6 chromosome 1, complete sequence	3838800	1900654	1955080	3838800	transposase,integrase	Paenibacillus_phage(40.0%)	38	1897549:1897569	1957158:1957178
1897549:1897569	attL	CCGCCTGACGCGCGCGCCGGC	NA	NA	NA	NA
WP_059597134.1|1900654_1902346_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_159082875.1|1902405_1902597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059597005.1|1903571_1904144_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_059470017.1|1904311_1904692_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_059597133.1|1904955_1906251_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_082722211.1|1906376_1907657_-	MFS transporter	NA	NA	NA	NA	NA
WP_082716279.1|1907629_1908325_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_082722210.1|1908869_1909193_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_108033922.1|1909245_1910062_+|transposase	IS5-like element ISBcen20 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	35.0	2.5e-07
WP_159082876.1|1910889_1911312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059471590.1|1913558_1915217_+	DUF2875 family protein	NA	NA	NA	NA	NA
WP_059598449.1|1915226_1915490_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_059598450.1|1915775_1916702_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_059598451.1|1916698_1917961_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_059598452.1|1918002_1920408_-	long-chain-fatty-acyl-CoA reductase	NA	NA	NA	NA	NA
WP_059598453.1|1920409_1921540_-	acyl-protein synthase	NA	NA	NA	NA	NA
WP_059598454.1|1921569_1922826_-	MdfA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_059598456.1|1923840_1924392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082722459.1|1924658_1925921_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_059597361.1|1926772_1927006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059597362.1|1927060_1927861_+	Fic family protein	NA	NA	NA	NA	NA
WP_059471607.1|1928169_1928490_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_159082877.1|1929871_1932151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082722281.1|1934317_1935376_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_108033924.1|1935907_1937803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082722283.1|1937846_1939091_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	28.9	1.3e-18
WP_059597367.1|1939126_1940365_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_162498961.1|1940427_1941351_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_059597368.1|1941351_1942203_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_059597369.1|1942207_1944349_+	alpha-galactosidase	NA	NA	NA	NA	NA
WP_108033925.1|1944546_1946454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082722286.1|1946588_1946906_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_159082878.1|1947031_1948063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059597370.1|1948589_1949288_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.7	4.4e-21
WP_159082879.1|1949541_1952013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059597372.1|1952085_1952772_+	OmpA family protein	NA	NA	NA	NA	NA
WP_108033926.1|1952773_1954177_+	hypothetical protein	NA	D6PFH9	uncultured_phage	27.3	2.5e-15
WP_108033922.1|1954263_1955080_+|transposase	IS5-like element ISBcen20 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	35.0	2.5e-07
1957158:1957178	attR	CCGCCTGACGCGCGCGCCGGC	NA	NA	NA	NA
>prophage 4
NZ_CP013386	Burkholderia sp. BDU6 chromosome 1, complete sequence	3838800	2306879	2397661	3838800	coat,integrase,plate	Tupanvirus(37.5%)	43	2308806:2308824	2419021:2419039
WP_059597823.1|2306879_2307845_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_059597824.1|2307860_2310269_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
2308806:2308824	attL	GCCGGCGCCGAGCGTGCCG	NA	NA	NA	NA
WP_059597825.1|2310313_2311153_-	molecular chaperone	NA	NA	NA	NA	NA
WP_059597826.1|2311170_2311695_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_059474120.1|2311777_2312338_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_059474204.1|2312390_2312936_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_059597827.1|2313758_2314652_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_059474118.1|2315096_2316335_+	MFS transporter	NA	NA	NA	NA	NA
WP_059597828.1|2316380_2317307_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_059474116.1|2317787_2318069_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_059597829.1|2318495_2318759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059474114.1|2319426_2320083_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_059597830.1|2320398_2321349_-	LysR family transcriptional regulator	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	37.3	3.2e-06
WP_059597851.1|2321491_2322340_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_059474111.1|2322364_2323525_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_059597831.1|2323537_2324716_+	CoA transferase	NA	NA	NA	NA	NA
WP_059597832.1|2324790_2326173_+	MFS transporter	NA	NA	NA	NA	NA
WP_059597833.1|2326561_2327401_-	CoA ester lyase	NA	NA	NA	NA	NA
WP_159082887.1|2327439_2328153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059597835.1|2330465_2332316_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_059474104.1|2334398_2334647_+	MbtH family NRPS accessory protein	NA	NA	NA	NA	NA
WP_082716595.1|2334656_2335409_+	thioesterase	NA	NA	NA	NA	NA
WP_059597836.1|2335482_2336928_+	peptide synthetase	NA	NA	NA	NA	NA
WP_059597837.1|2337060_2354223_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	23.6	7.7e-82
WP_082722354.1|2354259_2365320_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	26.0	1.9e-126
WP_059597839.1|2365327_2370871_+	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	24.8	5.2e-72
WP_082716592.1|2370918_2371719_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_059597840.1|2371984_2374180_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_059597852.1|2374280_2375048_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	26.9	3.9e-10
WP_059597841.1|2375049_2375979_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_082722355.1|2375975_2377994_+	Fe(3+)-hydroxamate ABC transporter permease FhuB	NA	NA	NA	NA	NA
WP_059597842.1|2378026_2379730_+	cyclic peptide export ABC transporter	NA	A0A2H4PQG7	Staphylococcus_phage	28.0	7.8e-11
WP_059597843.1|2379776_2382239_+	acylase	NA	NA	NA	NA	NA
WP_156438458.1|2382304_2383093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059597844.1|2383282_2383483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059597845.1|2384547_2386308_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_159082888.1|2386412_2386742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159082889.1|2386779_2387142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082722357.1|2387239_2387569_-	colicin immunity protein	NA	NA	NA	NA	NA
WP_059597846.1|2392440_2392668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162498949.1|2392681_2392840_+	hypothetical protein	NA	B5BTX7	Ralstonia_phage	73.1	1.2e-14
WP_059471300.1|2393476_2394259_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	37.1	3.2e-36
WP_059597986.1|2396272_2397661_+|integrase	integrase family protein	integrase	NA	NA	NA	NA
2419021:2419039	attR	GCCGGCGCCGAGCGTGCCG	NA	NA	NA	NA
>prophage 5
NZ_CP013386	Burkholderia sp. BDU6 chromosome 1, complete sequence	3838800	3714601	3815842	3838800	transposase,tail,protease,lysis,plate,tRNA,holin,capsid,terminase,portal,head	Burkholderia_phage(56.67%)	108	NA	NA
WP_059597921.1|3714601_3715627_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_059471504.1|3715917_3717105_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	61.0	5.8e-122
WP_059471503.1|3717371_3718256_+	lipid A biosynthesis lauroyl acyltransferase	NA	NA	NA	NA	NA
WP_059471502.1|3718285_3719170_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_059471501.1|3719201_3719915_+	DUF484 family protein	NA	NA	NA	NA	NA
WP_059471500.1|3719955_3720876_+	tyrosine recombinase XerC	NA	G1JX48	Mycobacterium_phage	29.8	6.9e-14
WP_059596299.1|3720941_3722222_+	class I SAM-dependent rRNA methyltransferase	NA	NA	NA	NA	NA
WP_059471498.1|3722400_3723483_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_059471496.1|3724174_3724591_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_059471495.1|3724825_3725362_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_059471494.1|3725372_3726716_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A191ZC11	Erwinia_phage	28.2	3.1e-39
WP_010100880.1|3726901_3727444_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_059471493.1|3727463_3728744_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_059471492.1|3728761_3729004_-	cysteine-rich CWC family protein	NA	NA	NA	NA	NA
WP_059471491.1|3729329_3730229_+	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_059471490.1|3730225_3731029_+	pyrimidine 5'-nucleotidase	NA	NA	NA	NA	NA
WP_059596300.1|3730995_3731688_+	nucleoid occlusion factor SlmA	NA	NA	NA	NA	NA
WP_059596301.1|3732492_3733638_+	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_059596302.1|3733634_3734249_+	methionine biosynthesis protein MetW	NA	NA	NA	NA	NA
WP_059596303.1|3734258_3735572_+	AmpG family muropeptide MFS transporter	NA	NA	NA	NA	NA
WP_059471485.1|3735561_3736626_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_059471484.1|3736729_3737674_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_059471483.1|3737895_3738960_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	46.4	9.9e-81
WP_010100857.1|3739186_3739957_-	exodeoxyribonuclease III	NA	R4TWA8	Phaeocystis_globosa_virus	32.7	1.4e-28
WP_059596304.1|3739986_3740826_-	polyphosphate kinase	NA	NA	NA	NA	NA
WP_059471481.1|3740953_3742441_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_059596305.1|3742443_3743934_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_059471479.1|3744049_3744349_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_004189550.1|3744713_3745757_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_059471478.1|3745876_3746944_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_059596306.1|3746940_3747453_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_059596307.1|3747636_3749985_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_059471475.1|3749996_3751145_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_059471474.1|3751390_3752167_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_059471473.1|3752163_3752949_-	2-dehydro-3-deoxyglucarate aldolase	NA	NA	NA	NA	NA
WP_059596308.1|3753426_3753708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059471471.1|3753758_3754211_-	6-carboxytetrahydropterin synthase QueD	NA	A0A088FAL2	Vibrio_phage	31.4	2.6e-14
WP_059471470.1|3754230_3754863_-	7-carboxy-7-deazaguanine synthase	NA	R4TAH8	Halovirus	30.9	2.8e-06
WP_059471469.1|3754951_3755686_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A1B0Z0B4	Vibrio_phage	43.5	5.6e-51
WP_059596309.1|3756633_3757137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059596310.1|3757149_3757755_+	ImmA/IrrE family metallo-endopeptidase	NA	Q332A2	Clostridium_botulinum_C_phage	30.1	4.1e-07
WP_059473839.1|3758264_3758747_+	DUF2778 domain-containing protein	NA	NA	NA	NA	NA
WP_059473840.1|3758743_3759022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059473841.1|3759227_3759500_-	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	97.8	6.9e-47
WP_059473851.1|3759459_3759732_-	BrnT family toxin	NA	K4NX81	Burkholderia_phage	96.7	1.9e-44
WP_108033978.1|3759845_3760901_-|portal	phage portal protein	portal	A4JWV0	Burkholderia_virus	98.0	1.2e-203
WP_108033979.1|3760897_3762667_-|terminase	terminase ATPase subunit family protein	terminase	K4NXI4	Burkholderia_phage	95.9	0.0e+00
WP_059596552.1|3762810_3763620_+|capsid	GPO family capsid scaffolding protein	capsid	K4PAW2	Burkholderia_phage	91.1	9.1e-135
WP_059596553.1|3763653_3764664_+|capsid	phage major capsid protein, P2 family	capsid	A4JWP9	Burkholderia_virus	93.8	4.4e-179
WP_059596554.1|3764660_3765350_+|terminase	terminase endonuclease subunit	terminase	K4NX86	Burkholderia_phage	93.0	1.1e-109
WP_059596555.1|3765449_3765929_+|head	head completion/stabilization protein	head	A4JWU5	Burkholderia_virus	98.1	1.1e-79
WP_059596556.1|3765928_3766180_+	hypothetical protein	NA	K4NXI9	Burkholderia_phage	98.8	2.2e-39
WP_004524438.1|3766176_3766383_+|tail	tail protein	tail	K4PAW7	Burkholderia_phage	100.0	2.4e-31
WP_059596557.1|3766397_3766742_+	hypothetical protein	NA	K4NZQ3	Burkholderia_phage	99.1	2.9e-50
WP_004524440.1|3766743_3767016_+|holin	phage holin family protein	holin	K4NX91	Burkholderia_phage	100.0	8.8e-42
WP_059596558.1|3767012_3767825_+	DUF3380 domain-containing protein	NA	A4JWZ0	Burkholderia_virus	95.6	2.0e-145
WP_059596559.1|3767821_3768262_+|lysis	LysB family phage lysis regulatory protein	lysis	K4NXJ2	Burkholderia_phage	82.2	4.9e-58
WP_059596560.1|3768239_3768374_+	hypothetical protein	NA	K4PAX1	Burkholderia_phage	88.6	6.4e-14
WP_059596561.1|3768366_3768783_+|tail	phage tail protein	tail	A4JWT7	Burkholderia_virus	93.5	7.1e-67
WP_082722142.1|3768779_3769247_+	phage virion morphogenesis protein	NA	K4NZQ8	Burkholderia_phage	92.9	1.7e-72
WP_159082916.1|3769307_3770534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050042433.1|3770755_3770956_+	hypothetical protein	NA	E5E3V8	Burkholderia_phage	79.2	7.4e-14
WP_082722147.1|3770944_3771715_-	site-specific DNA-methyltransferase	NA	K4NZW3	Burkholderia_phage	88.7	9.2e-129
WP_059596563.1|3771889_3772570_+|plate	phage baseplate assembly protein V	plate	K4NXJ5	Burkholderia_phage	92.9	1.3e-115
WP_050042429.1|3772566_3772929_+|plate	baseplate assembly protein	plate	K4PAX6	Burkholderia_phage	95.8	2.1e-59
WP_059596564.1|3772925_3773831_+|plate	baseplate assembly protein	plate	K4NZR5	Burkholderia_phage	92.4	5.5e-149
WP_059596565.1|3773823_3774378_+|tail	phage tail protein I	tail	A4JWT0	Burkholderia_virus	94.6	9.7e-96
WP_059596566.1|3774379_3776752_+	hypothetical protein	NA	Q45YG3	Burkholderia_virus	82.5	0.0e+00
WP_059596567.1|3776768_3777437_+|tail	phage tail protein	tail	A4JWS8	Burkholderia_virus	95.3	3.3e-106
WP_059596568.1|3777493_3778666_+|tail	phage tail sheath protein	tail	A4JWS7	Burkholderia_virus	95.6	1.5e-215
WP_059596569.1|3778681_3779191_+|tail	phage major tail tube protein	tail	K4NZR9	Burkholderia_phage	95.3	3.3e-90
WP_059596570.1|3779247_3779592_+|tail	phage tail assembly protein	tail	K4NXA3	Burkholderia_phage	94.7	3.4e-51
WP_044368053.1|3779600_3779714_+|tail	GpE family phage tail protein	tail	A0A089FGX3	Burkholderia_phage	91.9	1.0e-12
WP_059596571.1|3779716_3782677_+	hypothetical protein	NA	A4JWS3	Burkholderia_virus	83.7	0.0e+00
WP_059596572.1|3782694_3783120_+|tail	phage tail protein	tail	A4JWS2	Burkholderia_virus	97.9	8.3e-71
WP_059596573.1|3783119_3784220_+	phage late control D family protein	NA	K4PAY4	Burkholderia_phage	95.4	1.1e-194
WP_059596574.1|3784233_3784665_-	hypothetical protein	NA	A0A089FKT7	Burkholderia_phage	96.5	5.8e-72
WP_059596575.1|3785099_3785822_-	hypothetical protein	NA	K4NZS4	Burkholderia_phage	90.8	1.3e-113
WP_059596576.1|3785873_3786332_-	helix-turn-helix transcriptional regulator	NA	E5E3P4	Burkholderia_phage	80.8	1.2e-59
WP_082722144.1|3786655_3786952_+	DNA-binding protein	NA	E5E3P2	Burkholderia_phage	83.1	1.2e-36
WP_059596577.1|3786939_3787188_+	ogr/Delta-like zinc finger family protein	NA	K4PAZ0	Burkholderia_phage	97.6	9.8e-40
WP_059596578.1|3787273_3787822_+	Bro-N domain-containing protein	NA	K4NZS9	Burkholderia_phage	89.0	1.4e-83
WP_059596579.1|3787837_3788056_+	hypothetical protein	NA	K4NXB1	Burkholderia_phage	93.1	1.3e-32
WP_045599893.1|3788061_3788259_+	hypothetical protein	NA	K4NZY3	Burkholderia_phage	93.8	7.5e-27
WP_059596580.1|3788302_3788497_+	hypothetical protein	NA	K4NXL1	Burkholderia_phage	96.9	1.1e-25
WP_059596581.1|3788500_3788740_+	hypothetical protein	NA	K4PAZ5	Burkholderia_phage	79.7	4.8e-28
WP_059596582.1|3788908_3789115_+	hypothetical protein	NA	K4NZT3	Burkholderia_phage	69.1	4.9e-21
WP_059596586.1|3789117_3789480_+	hypothetical protein	NA	K4NXB4	Burkholderia_phage	94.9	7.5e-57
WP_059596583.1|3789476_3789731_+	hypothetical protein	NA	A4JWQ9	Burkholderia_virus	92.9	1.8e-36
WP_108033980.1|3789742_3792535_+	hypothetical protein	NA	K4NXL6	Burkholderia_phage	97.8	0.0e+00
WP_076836148.1|3793235_3793577_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_059598193.1|3794604_3795291_-	response regulator	NA	NA	NA	NA	NA
WP_059471467.1|3795291_3797700_-	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_059471466.1|3797701_3798292_-	DUF4390 domain-containing protein	NA	NA	NA	NA	NA
WP_059471465.1|3798288_3799701_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_010113215.1|3800344_3801202_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_059471464.1|3801310_3801946_-	LysE family translocator	NA	NA	NA	NA	NA
WP_059471463.1|3802066_3803050_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	36.3	1.8e-07
WP_059471462.1|3803081_3803585_-	peptide deformylase	NA	A0A067XQZ3	Caulobacter_phage	31.5	4.2e-13
WP_059471461.1|3803820_3805008_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	39.2	8.1e-23
WP_059471460.1|3805067_3805439_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_059598192.1|3805649_3808259_+	DNA topoisomerase III	NA	A0A2P1ELA0	Moumouvirus	25.3	1.0e-17
WP_059471458.1|3808470_3809526_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_059471457.1|3809965_3810982_+	D-2-hydroxyacid dehydrogenase family protein	NA	NA	NA	NA	NA
WP_059471456.1|3811094_3811964_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_059471455.1|3812002_3812407_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_108033981.1|3813561_3814884_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	52.5	1.1e-60
WP_108033982.1|3815084_3815842_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP013387	Burkholderia sp. BDU6 chromosome 2, complete sequence	2752114	1335078	1369684	2752114	transposase,integrase	Escherichia_phage(33.33%)	20	1334240:1334255	1377498:1377513
1334240:1334255	attL	CGCGGCTGGCAGCGCG	NA	NA	NA	NA
WP_108033957.1|1335078_1336578_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	32.8	8.6e-30
WP_059596311.1|1336564_1337338_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	36.8	1.0e-34
WP_059472649.1|1337334_1337550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159082955.1|1339405_1339933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159082956.1|1340008_1340662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159082957.1|1340855_1341317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059597213.1|1341388_1341763_-	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_082722250.1|1341759_1341993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059597223.1|1342067_1343558_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_059597217.1|1344933_1345926_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_059597218.1|1346149_1352410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159082958.1|1352429_1353017_-	Vps62-related protein	NA	NA	NA	NA	NA
WP_082722247.1|1354409_1355762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082722251.1|1355827_1357183_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	36.8	2.5e-44
WP_082722248.1|1357335_1358652_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_059597220.1|1358652_1358910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082722249.1|1362024_1362651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059597221.1|1363049_1364750_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_159082959.1|1365449_1366409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059598020.1|1368022_1369684_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
1377498:1377513	attR	CGCGCTGCCAGCCGCG	NA	NA	NA	NA
>prophage 2
NZ_CP013387	Burkholderia sp. BDU6 chromosome 2, complete sequence	2752114	2036784	2089127	2752114	integrase,plate,capsid,tail,transposase,tRNA	Burkholderia_virus(59.65%)	69	2021175:2021192	2082048:2082065
2021175:2021192	attL	GCCGACGCCGCGCGCGGC	NA	NA	NA	NA
WP_059598269.1|2036784_2037843_+	acyltransferase	NA	A0A166XZF2	Gordonia_phage	31.2	2.8e-19
WP_059598268.1|2037877_2038921_+	GDP-mannose 4,6-dehydratase	NA	M1HKY0	Acanthocystis_turfacea_Chlorella_virus	56.2	8.7e-106
WP_059472839.1|2038907_2039891_+	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_059472838.1|2039875_2040253_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_059598281.1|2040762_2041137_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	97.5	1.8e-61
WP_059598267.1|2041133_2041574_-	regulatory protein GemA	NA	Q6QIE7	Burkholderia_phage	90.4	1.4e-68
WP_059598266.1|2041557_2041899_-	DUF2528 family protein	NA	A4JWM6	Burkholderia_virus	88.5	2.9e-50
WP_059598265.1|2042006_2042279_-	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	96.7	8.2e-40
WP_059598264.1|2042342_2042960_-	DUF3164 family protein	NA	A4JWM8	Burkholderia_virus	99.5	2.8e-112
WP_059598263.1|2043078_2043318_-	hypothetical protein	NA	A1YZW1	Burkholderia_virus	47.2	2.4e-11
WP_059598262.1|2043311_2043563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059598261.1|2043559_2043889_-	hypothetical protein	NA	Q6QIE2	Burkholderia_phage	92.6	1.5e-51
WP_059598280.1|2043890_2045102_-	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	97.8	4.0e-219
WP_059598260.1|2045101_2046901_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A4JWN2	Burkholderia_virus	98.1	0.0e+00
WP_059598259.1|2046918_2047830_-	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	87.8	9.5e-141
WP_021158474.1|2047842_2048148_-	helix-turn-helix domain-containing protein	NA	A4JWN4	Burkholderia_virus	99.0	1.4e-48
WP_059598258.1|2048144_2048624_-	hypothetical protein	NA	Q6QID6	Burkholderia_phage	98.1	2.4e-87
WP_059598257.1|2048744_2048981_+	hypothetical protein	NA	Q6QID5	Burkholderia_phage	96.2	4.5e-34
WP_059598256.1|2049026_2049209_-	DNA-binding protein	NA	A4JWN7	Burkholderia_virus	95.0	2.0e-26
WP_059598255.1|2049334_2049763_+	helix-turn-helix transcriptional regulator	NA	Q6QID2	Burkholderia_phage	95.1	2.2e-63
WP_059598254.1|2049759_2050530_+	hypothetical protein	NA	A4JWN9	Burkholderia_virus	89.6	5.2e-124
WP_059598253.1|2050603_2050792_+	hypothetical protein	NA	A4JWP0	Burkholderia_virus	87.1	3.1e-22
WP_059598252.1|2050772_2051309_+	hypothetical protein	NA	A4JWP1	Burkholderia_virus	92.7	3.6e-87
WP_159082985.1|2051323_2051704_+	hypothetical protein	NA	J9SVN1	Pseudomonas_phage	44.4	2.8e-14
WP_059598279.1|2051804_2052029_+	hypothetical protein	NA	A4JWP2	Burkholderia_virus	78.6	8.8e-24
WP_021158467.1|2052095_2052443_+	phage protein	NA	A4JWP3	Burkholderia_virus	89.6	5.2e-47
WP_059598250.1|2052445_2053057_+	transglycosylase SLT domain-containing protein	NA	Q6QIC7	Burkholderia_phage	97.5	1.5e-110
WP_059598278.1|2053053_2053653_+	hypothetical protein	NA	A4JWP5	Burkholderia_virus	85.4	1.2e-86
WP_059598249.1|2053649_2053988_+	hypothetical protein	NA	A4JWP6	Burkholderia_virus	87.5	7.3e-46
WP_006485389.1|2053984_2054317_+	hypothetical protein	NA	Q6QIC3	Burkholderia_phage	100.0	8.7e-60
WP_059598248.1|2054318_2054864_+	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	99.4	1.5e-88
WP_059598247.1|2054860_2056363_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	97.6	6.5e-288
WP_059598246.1|2056359_2057835_+	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	97.6	2.1e-278
WP_059598245.1|2057827_2058664_+|capsid	minor capsid protein	capsid	A4JWJ6	Burkholderia_virus	97.5	8.1e-163
WP_059598244.1|2058660_2059188_+	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	98.3	8.9e-91
WP_059598277.1|2059402_2060521_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	97.0	3.6e-206
WP_059598243.1|2060566_2061490_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	92.2	1.2e-159
WP_059598242.1|2061564_2061897_+	DUF2190 family protein	NA	Q6QIB4	Burkholderia_phage	98.2	9.7e-51
WP_059598241.1|2061898_2062351_+	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	95.3	2.2e-77
WP_059598240.1|2062350_2062815_+	hypothetical protein	NA	A4JWK3	Burkholderia_virus	97.4	5.6e-81
WP_059598239.1|2062811_2063057_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	77.8	6.5e-28
WP_059598238.1|2063060_2064494_+|tail	phage tail protein	tail	A4JWK5	Burkholderia_virus	93.5	7.9e-259
WP_059598237.1|2064496_2065021_+|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	94.8	7.5e-90
WP_059598276.1|2065143_2065473_+|tail	phage tail assembly protein	tail	Q6QIA8	Burkholderia_phage	97.2	1.2e-48
WP_059598236.1|2065399_2065603_+	hypothetical protein	NA	Q6QIA7	Burkholderia_phage	89.6	7.7e-27
WP_059598235.1|2065605_2065848_-	hypothetical protein	NA	A4JWK9	Burkholderia_virus	88.8	2.1e-31
WP_059598234.1|2065877_2068490_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	90.3	0.0e+00
WP_059598233.1|2068491_2069382_+|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	93.8	1.2e-98
WP_059598232.1|2069381_2069591_+	hypothetical protein	NA	Q6QIA3	Burkholderia_phage	94.2	1.4e-31
WP_059598231.1|2069578_2070784_+	Cro/Cl family transcriptional regulator	NA	A4JWL3	Burkholderia_virus	95.0	8.3e-209
WP_059598230.1|2070780_2071383_+|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	88.5	2.5e-97
WP_059598229.1|2071436_2071790_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	94.0	5.4e-60
WP_059598228.1|2071786_2072938_+|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	90.3	1.1e-191
WP_059598227.1|2072930_2073512_+|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	90.2	6.6e-95
WP_059598225.1|2074598_2075054_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_082722416.1|2075191_2075440_+	Com family DNA-binding transcriptional regulator	NA	A0A1S5NPS9	Burkholderia_phage	65.9	6.2e-10
WP_059598224.1|2075557_2076685_+	hypothetical protein	NA	A4JWM1	Burkholderia_virus	87.2	1.4e-194
WP_059598223.1|2076675_2077290_+|tRNA	methionyl-tRNA formyltransferase	tRNA	A4JWM2	Burkholderia_virus	81.3	5.3e-95
WP_059472936.1|2077470_2078688_-	O-succinylhomoserine sulfhydrylase	NA	A0A0B5JD48	Pandoravirus	27.1	8.8e-17
WP_059472837.1|2078918_2080454_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	42.1	7.1e-88
WP_010109891.1|2080505_2081000_-	CvpA family protein	NA	NA	NA	NA	NA
WP_059472836.1|2081006_2081819_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_059472935.1|2081848_2083162_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
2082048:2082065	attR	GCCGACGCCGCGCGCGGC	NA	NA	NA	NA
WP_059472835.1|2083260_2084133_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_059598222.1|2084216_2085032_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_059472833.1|2085473_2086322_-	site-specific DNA-methyltransferase	NA	R4THJ7	Phaeocystis_globosa_virus	34.6	9.5e-34
WP_059472832.1|2086332_2087526_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_059597661.1|2087595_2088318_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_059472830.1|2088314_2089127_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
