The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013373	Burkholderia sp. NRF60-BP8 chromosome 1, complete sequence	3427375	410074	428921	3427375	protease,integrase,plate	Pseudomonas_phage(50.0%)	22	410646:410684	415212:415250
WP_027809263.1|410074_410596_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	52.0	9.6e-21
410646:410684	attL	TTTGTAATCATCAGGTGGCGGGTTCGAGTCCTGCAGCCG	NA	NA	NA	NA
WP_043887533.1|410808_411453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155646976.1|411449_411866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059780298.1|411871_412954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082725024.1|413166_413562_-|integrase	tyrosine-type recombinase/integrase	integrase	C8CLF4	Xylella_phage	61.6	1.7e-25
WP_159086676.1|414151_414964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027783368.1|415929_416133_+	hypothetical protein	NA	NA	NA	NA	NA
415212:415250	attR	TTTGTAATCATCAGGTGGCGGGTTCGAGTCCTGCAGCCG	NA	NA	NA	NA
WP_011546588.1|416192_416993_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_059780297.1|417227_417608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059780296.1|417713_418031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159086677.1|418045_418450_+	histidine kinase	NA	NA	NA	NA	NA
WP_059780294.1|418478_418814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034209792.1|418928_419711_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_034209793.1|419707_421054_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_034209794.1|421156_421768_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_059780293.1|422142_422769_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_059780292.1|422815_423331_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_034209797.1|423346_424837_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_059780291.1|424907_425411_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_034209799.1|425459_425945_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_059780290.1|426021_427857_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_059780289.1|427820_428921_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 2
NZ_CP013373	Burkholderia sp. NRF60-BP8 chromosome 1, complete sequence	3427375	727388	736454	3427375		Hokovirus(16.67%)	7	NA	NA
WP_034206477.1|727388_729341_+	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	50.3	1.9e-146
WP_034206478.1|729594_730731_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	26.9	8.5e-22
WP_059779266.1|730735_732643_+	bifunctional anthranilate synthase component I family protein/class IV aminotransferase	NA	S4VNU7	Pandoravirus	37.9	1.2e-55
WP_034206480.1|732786_733602_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	33.3	6.7e-37
WP_059501043.1|733645_734332_-	deoxynucleoside kinase	NA	A0A0M3UL55	Enterococcus_phage	26.4	5.5e-08
WP_059779268.1|734328_734871_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_059779271.1|734906_736454_-	polynucleotide adenylyltransferase PcnB	NA	A0A172Q0J1	Acinetobacter_phage	30.3	1.1e-16
>prophage 3
NZ_CP013373	Burkholderia sp. NRF60-BP8 chromosome 1, complete sequence	3427375	1077358	1085641	3427375		Bacillus_phage(16.67%)	8	NA	NA
WP_059779702.1|1077358_1078759_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.8	7.2e-79
WP_052100257.1|1078766_1079717_+	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	28.1	1.5e-16
WP_006496538.1|1079780_1080773_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	31.2	4.1e-28
WP_059779708.1|1080847_1081189_+	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_034206721.1|1081402_1082305_+	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	39.5	2.4e-51
WP_082725001.1|1082379_1083723_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_034206723.1|1083766_1084690_+	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	34.3	3.3e-40
WP_059779813.1|1084720_1085641_-	alpha/beta hydrolase	NA	Q6TUZ7	Yaba_monkey_tumor_virus	27.6	2.5e-16
>prophage 1
NZ_CP013372	Burkholderia sp. NRF60-BP8 chromosome 2, complete sequence	2801147	1639248	1646887	2801147	integrase	Mycobacterium_phage(16.67%)	15	1633602:1633616	1657708:1657722
1633602:1633616	attL	CGCCATTGCTGCGGC	NA	NA	NA	NA
WP_108041807.1|1639248_1640142_+	pentapeptide repeat-containing protein	NA	A0A2D2W3H3	Mycobacterium_phage	46.7	1.1e-13
WP_059783203.1|1640190_1640415_+	hypothetical protein	NA	Q3HQW9	Burkholderia_phage	39.1	8.3e-06
WP_059783201.1|1640411_1640861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059783200.1|1641369_1641945_+	ERF family protein	NA	A0A2H4FU11	Methylophilaceae_phage	47.7	2.3e-39
WP_059783198.1|1641944_1642223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059783196.1|1642219_1642609_+	recombination protein NinB	NA	A0A1I9KFA6	Aeromonas_phage	33.3	7.2e-05
WP_059783192.1|1642939_1643233_+	hypothetical protein	NA	A4PE68	Ralstonia_virus	64.0	4.5e-28
WP_159086654.1|1643229_1643379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059783190.1|1643375_1643642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059783188.1|1643638_1643839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159086655.1|1643835_1644480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159086656.1|1644479_1644749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059783185.1|1644745_1645105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059783183.1|1645560_1645788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059783181.1|1645759_1646887_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9G075	Enterobacteria_phage	40.7	1.6e-60
1657708:1657722	attR	GCCGCAGCAATGGCG	NA	NA	NA	NA
>prophage 1
NZ_CP013374	Burkholderia sp. NRF60-BP8 chromosome 3, complete sequence	851421	245045	251419	851421		Escherichia_phage(57.14%)	7	NA	NA
WP_059779887.1|245045_245831_+	ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	27.6	4.0e-10
WP_059779885.1|245827_246547_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	28.0	5.2e-17
WP_034209146.1|246543_247941_+	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	30.6	4.4e-28
WP_034209145.1|248050_248947_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	57.8	8.3e-97
WP_059779881.1|248943_249525_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	53.9	7.1e-49
WP_059779879.1|249521_250406_+	dTDP-4-dehydrorhamnose reductase	NA	K7QJU0	Escherichia_phage	34.3	3.1e-27
WP_059779877.1|250402_251419_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	45.2	1.8e-79
