The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014004	Klebsiella pneumoniae subsp. pneumoniae strain NUHL24835 chromosome, complete genome	5387996	114403	179132	5387996	head,protease,integrase,capsid,portal,terminase,tail,holin	Klebsiella_phage(53.06%)	74	132925:132984	174606:174669
WP_002911601.1|114403_115666_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	39.8	8.7e-76
WP_059689523.1|115908_116061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151469.1|116095_117532_+	EmmdR/YeeO family multidrug/toxin efflux MATE transporter	NA	NA	NA	NA	NA
WP_004148975.1|117897_119352_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_004141189.1|119481_119727_-	signal transduction protein PmrD	NA	NA	NA	NA	NA
WP_004180466.1|120000_121623_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_004180464.1|121533_122466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004180463.1|122585_123563_-	oxidoreductase	NA	NA	NA	NA	NA
WP_004180458.1|123559_124264_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004148971.1|124854_126489_+	Na+/H+ antiporter	NA	NA	NA	NA	NA
WP_002911729.1|126989_127907_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_004180456.1|128013_128964_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_004180454.1|129042_129984_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_004180453.1|130182_130419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004227143.1|132005_132806_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
132925:132984	attL	CGGTCTCGAAAACCGGAGTAGGGGCAACTCTACCGGGGGTTCAAATCCCCCTCTCTCCGC	NA	NA	NA	NA
WP_004184758.1|133098_134091_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	87.2	4.9e-175
WP_004184757.1|134092_134320_-	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	78.4	1.1e-29
WP_004184756.1|134627_135269_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	74.8	6.2e-38
WP_004184753.1|135261_135606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004197454.1|135733_136519_-	hypothetical protein	NA	C7BGF1	Burkholderia_phage	52.1	1.7e-61
WP_004184747.1|136518_136818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004184745.1|136905_137829_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.8	4.5e-106
WP_004184742.1|138431_139586_-	hypothetical protein	NA	A0A1S5SAB0	Streptococcus_phage	28.2	1.5e-34
WP_004184740.1|139757_140234_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	45.3	2.0e-12
WP_004197463.1|140335_140599_+	helix-turn-helix domain-containing protein	NA	D0UIL8	Aggregatibacter_phage	47.9	3.7e-13
WP_004184739.1|140627_141080_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	87.8	1.5e-67
WP_004184738.1|141317_141497_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	75.0	1.6e-15
WP_059689842.1|141486_142440_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	74.0	1.5e-99
WP_004184736.1|142436_143246_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	69.7	7.0e-111
WP_004184734.1|143255_143633_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	73.6	5.1e-48
WP_004197461.1|143645_144626_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	67.8	2.0e-136
WP_004184728.1|144639_145218_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	57.2	7.6e-51
WP_004184721.1|145530_145788_+	hypothetical protein	NA	A0A286N2Q3	Klebsiella_phage	100.0	1.3e-42
WP_004197458.1|145693_146140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024176410.1|146783_147083_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	83.8	4.5e-39
WP_004184488.1|147079_147619_+	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	100.0	2.3e-102
WP_004184485.1|147615_147960_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	83.3	3.6e-40
WP_004184481.1|147956_148232_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	44.3	2.8e-11
WP_004184720.1|148467_148752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004184719.1|148884_149157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004184717.1|149480_149726_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	52.6	2.0e-13
WP_004143907.1|149887_150202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004143906.1|150210_150501_+	HNH endonuclease	NA	A0A286N2R3	Klebsiella_phage	91.7	2.5e-50
WP_004143905.1|150713_151148_+	hypothetical protein	NA	A0A286S1P9	Klebsiella_phage	100.0	6.2e-74
WP_004143904.1|151157_152690_+|terminase	terminase	terminase	A0A286S1M9	Klebsiella_phage	100.0	3.9e-296
WP_004143903.1|152692_153970_+|portal	phage portal protein	portal	A0A286S1N5	Klebsiella_phage	99.8	8.1e-247
WP_004216821.1|153975_154656_+|head,protease	HK97 family phage prohead protease	head,protease	A0A286S1N1	Klebsiella_phage	100.0	1.6e-124
WP_004184713.1|154667_155831_+|capsid	phage major capsid protein	capsid	A0A286S1R4	Klebsiella_phage	99.7	7.7e-212
WP_044067369.1|155867_156110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004184712.1|156057_156384_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A286S294	Klebsiella_phage	96.3	1.4e-54
WP_004184711.1|156444_156642_+	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	96.9	2.4e-25
WP_004184710.1|156643_156976_+|head	phage head closure protein	head	A0A286S2A2	Klebsiella_phage	100.0	3.1e-57
WP_000763233.1|156968_157508_+	HK97 gp10 family phage protein	NA	A0A286S249	Klebsiella_phage	100.0	1.0e-94
WP_004184708.1|157504_157870_+	DUF3168 domain-containing protein	NA	A0A286S1R1	Klebsiella_phage	93.4	3.5e-62
WP_000115125.1|157926_158418_+	hypothetical protein	NA	A0A286S1Q8	Klebsiella_phage	100.0	2.3e-88
WP_004184706.1|158461_158815_+|tail	phage tail assembly protein	tail	A0A286S1N4	Klebsiella_phage	97.4	4.2e-60
WP_001333686.1|158847_159111_+	hypothetical protein	NA	A0A286S1P2	Klebsiella_phage	98.9	6.9e-44
WP_052433481.1|159107_159539_+	hypothetical protein	NA	A0A286S1N7	Klebsiella_phage	99.2	9.6e-67
WP_004184699.1|162036_162516_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	99.4	1.0e-93
WP_004184697.1|162502_162985_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	96.9	3.3e-84
WP_004184695.1|162994_163375_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	95.2	4.0e-69
WP_004197289.1|163371_166440_+	hypothetical protein	NA	A0A286S259	Klebsiella_phage	97.3	0.0e+00
WP_004197799.1|166519_168271_+	lipase/acylhydrolase	NA	A0A286S1P0	Klebsiella_phage	54.9	4.4e-25
WP_004184692.1|168273_169032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004184691.1|169067_169802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059689525.1|169817_171971_-	hypothetical protein	NA	B5TAB2	Burkholderia_phage	42.2	7.4e-91
WP_004184689.1|172060_172609_+	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	95.6	2.4e-91
WP_026005871.1|172686_173109_+	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	3.6e-26
WP_004184687.1|173963_174335_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	52.9	1.4e-26
WP_002911596.1|174939_176085_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	58.7	1.1e-117
174606:174669	attR	CGGTCTCGAAAACCGGAGTAGGGGCAACTCTACCGGGGGTTCAAATCCCCCTCTCTCCGCCACT	NA	NA	NA	NA
WP_072157838.1|176476_176743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151461.1|176623_176905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002911594.1|176947_177655_+	phosphohydrolase	NA	S4W232	Pandoravirus	27.7	2.8e-07
WP_004180450.1|177731_179132_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	53.0	3.0e-101
>prophage 2
NZ_CP014004	Klebsiella pneumoniae subsp. pneumoniae strain NUHL24835 chromosome, complete genome	5387996	949026	968025	5387996	coat,transposase	Enterobacteria_phage(100.0%)	22	NA	NA
WP_001567368.1|949026_950430_-|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_059689568.1|950622_950964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162492321.1|951111_951396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071887246.1|951564_952680_+	Replication-associated protein G2P	NA	NA	NA	NA	NA
WP_033559364.1|952696_952990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017898686.1|953182_953410_+|coat	major coat protein	coat	D0U160	Enterobacteria_phage	58.7	3.2e-13
WP_059689571.1|953483_954770_+	attachment protein	NA	A7BJW8	Enterobacteria_phage	59.0	5.0e-103
WP_059689572.1|954772_955114_+|coat	minor coat protein	coat	A7BJW9	Enterobacteria_phage	58.9	3.1e-28
WP_059689573.1|955113_956178_+	assembly protein	NA	A7BJY0	Enterobacteria_phage	65.3	8.0e-131
WP_071887247.1|956158_957445_+	general secretion pathway protein GspD	NA	J7HXF0	Enterobacteria_phage	53.6	5.9e-120
WP_059689568.1|957928_958270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162492321.1|958417_958702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071887246.1|958870_959986_+	Replication-associated protein G2P	NA	NA	NA	NA	NA
WP_033559364.1|960002_960296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017898686.1|960488_960716_+|coat	major coat protein	coat	D0U160	Enterobacteria_phage	58.7	3.2e-13
WP_059689571.1|960789_962076_+	attachment protein	NA	A7BJW8	Enterobacteria_phage	59.0	5.0e-103
WP_059689572.1|962078_962420_+|coat	minor coat protein	coat	A7BJW9	Enterobacteria_phage	58.9	3.1e-28
WP_059689568.1|965237_965579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162492321.1|965726_966011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071887246.1|966179_967295_+	Replication-associated protein G2P	NA	NA	NA	NA	NA
WP_033559364.1|967311_967605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017898686.1|967797_968025_+|coat	major coat protein	coat	D0U160	Enterobacteria_phage	58.7	3.2e-13
>prophage 3
NZ_CP014004	Klebsiella pneumoniae subsp. pneumoniae strain NUHL24835 chromosome, complete genome	5387996	1083874	1092310	5387996		Escherichia_phage(71.43%)	7	NA	NA
WP_004176254.1|1083874_1084939_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	44.5	1.5e-65
WP_162492322.1|1086608_1087694_+	DUF4981 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	61.0	6.3e-107
WP_004179754.1|1087614_1088475_+	class A beta-lactamase SHV-28	NA	A0A077SL40	Escherichia_phage	99.3	1.7e-155
WP_002210513.1|1088495_1089257_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002903955.1|1089517_1090420_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_004179748.1|1090431_1091697_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.3	1.1e-232
WP_002210516.1|1091689_1092310_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 4
NZ_CP014004	Klebsiella pneumoniae subsp. pneumoniae strain NUHL24835 chromosome, complete genome	5387996	1492604	1575448	5387996	integrase,transposase,tRNA,protease,portal,terminase,tail,holin	Enterobacteria_phage(22.5%)	89	1522707:1522721	1573259:1573273
WP_000343760.1|1492604_1493825_+|transposase	ISL3-like element ISKox3 family transposase	transposase	NA	NA	NA	NA
WP_002901096.1|1494098_1494341_+	DinI family protein	NA	Q6UAW0	Klebsiella_phage	72.2	4.1e-27
WP_020806128.1|1494511_1495648_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_004179374.1|1495894_1496395_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_002901080.1|1496511_1496958_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_004140469.1|1496941_1497736_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_074420601.1|1497843_1499019_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_004179371.1|1499050_1499743_-	CTP synthase	NA	NA	NA	NA	NA
WP_004150778.1|1499888_1500398_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_014343000.1|1500402_1500741_+	DUF488 family protein	NA	NA	NA	NA	NA
WP_004179368.1|1500730_1500970_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_004179366.1|1501270_1502284_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.9e-12
WP_004150782.1|1502341_1502443_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_004213093.1|1502442_1502517_+	protein YoaJ	NA	NA	NA	NA	NA
WP_032415974.1|1502634_1502757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140489.1|1502816_1503080_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004150783.1|1503210_1503849_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004148038.1|1503938_1504853_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
WP_004148037.1|1505314_1505434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004179363.1|1505514_1506558_-	type II asparaginase	NA	NA	NA	NA	NA
WP_004140494.1|1506860_1508069_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_004179361.1|1508142_1509927_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	7.6e-17
WP_004150788.1|1509933_1510824_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004140497.1|1510944_1512453_+	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_059689596.1|1512486_1512651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150790.1|1512763_1513450_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_032409986.1|1513848_1514028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150791.1|1514067_1514700_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_004140506.1|1515266_1515464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140509.1|1515579_1516590_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_004140511.1|1516586_1517993_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_004179357.1|1518048_1518936_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_004140514.1|1518952_1519459_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004148027.1|1519485_1519980_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004150795.1|1520070_1520256_-	general stress protein	NA	NA	NA	NA	NA
WP_004140529.1|1520877_1522071_+	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004140530.1|1522183_1522411_+	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
WP_020805510.1|1522564_1522741_+	hypothetical protein	NA	NA	NA	NA	NA
1522707:1522721	attL	TGGCTGGCGTTCTTT	NA	NA	NA	NA
WP_004150797.1|1522860_1523184_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_004150798.1|1523176_1523569_+	amino acid-binding protein	NA	NA	NA	NA	NA
WP_004150799.1|1523565_1524279_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004892953.1|1524551_1524704_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.0	3.8e-18
WP_059689598.1|1524858_1526355_-|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	65.6	4.3e-130
WP_016530340.1|1535295_1535886_-|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	77.0	2.5e-81
WP_023342884.1|1535917_1536628_-	hypothetical protein	NA	Q6UAW4	Klebsiella_phage	90.7	1.1e-136
WP_016530342.1|1536629_1537385_-|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	84.1	1.3e-130
WP_023342885.1|1537381_1537729_-|tail	phage tail protein	tail	K7PJT2	Enterobacteria_phage	67.8	4.7e-40
WP_059689602.1|1537733_1540877_-|tail	phage tail tape measure protein	tail	E4WL33	Enterobacteria_phage	73.0	0.0e+00
WP_071609142.1|1540860_1541175_-|tail	phage tail assembly protein T	tail	E4WL32	Enterobacteria_phage	75.0	5.0e-41
WP_072216832.1|1541195_1541624_-|tail	phage minor tail protein G	tail	M9NZD7	Enterobacteria_phage	60.0	2.7e-37
WP_016530349.1|1541634_1542378_-|tail	phage tail protein	tail	K7PKX6	Enterobacterial_phage	83.0	1.7e-111
WP_059689603.1|1542386_1542788_-|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	75.6	2.1e-55
WP_059689606.1|1542784_1543363_-|tail	phage tail protein	tail	K7PMB7	Enterobacterial_phage	80.7	3.9e-79
WP_023342887.1|1543366_1543642_-	hypothetical protein	NA	K7PH43	Enterobacteria_phage	57.1	1.1e-23
WP_016530353.1|1543634_1543961_-	DUF2190 family protein	NA	K7PJY3	Enterobacterial_phage	66.7	8.1e-34
WP_071887248.1|1544044_1546066_-|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	81.8	0.0e+00
WP_016530355.1|1546016_1547519_-|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	83.0	6.2e-246
WP_059689608.1|1547518_1547731_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	78.6	8.4e-24
WP_016530357.1|1547727_1549830_-|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	84.0	0.0e+00
WP_023342892.1|1549829_1550318_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	87.7	1.3e-72
WP_077265510.1|1550549_1550972_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	61.3	2.6e-40
WP_014228902.1|1550968_1551286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017898990.1|1551237_1551600_-	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	81.7	3.4e-57
WP_017898986.1|1553349_1553700_-	hypothetical protein	NA	R9TPM9	Aeromonas_phage	39.8	1.8e-10
WP_023279523.1|1553696_1554194_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	85.8	1.9e-79
WP_017880269.1|1554193_1554409_-|holin	holin	holin	A5LH82	Enterobacteria_phage	87.3	7.9e-30
WP_020318001.1|1555740_1556184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059689612.1|1556185_1557055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014228895.1|1557083_1557428_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	85.0	1.0e-55
WP_059689615.1|1557440_1558472_-	DUF968 domain-containing protein	NA	S5MW46	Escherichia_phage	49.3	8.1e-96
WP_016160645.1|1558671_1559064_-	hypothetical protein	NA	K7PHB4	Enterobacterial_phage	36.6	8.0e-12
WP_077265511.1|1559104_1559395_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	56.9	6.1e-17
WP_012542186.1|1559406_1559640_-	DinI family protein	NA	K7PM44	Enterobacteria_phage	71.1	1.7e-25
WP_059689618.1|1560669_1562889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059689620.1|1563231_1563672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059689621.1|1563685_1564150_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	68.9	8.5e-61
WP_023279535.1|1564142_1565126_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	55.8	1.2e-45
WP_014907826.1|1565177_1565732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012542199.1|1565734_1565950_-	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	57.5	2.0e-17
WP_012542200.1|1566051_1566441_+	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	60.2	6.7e-35
WP_021462581.1|1567283_1567478_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_021462580.1|1567520_1567865_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_059689623.1|1568006_1570145_+	exonuclease	NA	S4TNL0	Salmonella_phage	42.7	1.2e-98
WP_012542206.1|1570197_1570443_+	excisionase	NA	NA	NA	NA	NA
WP_014228877.1|1570423_1571551_+|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	58.4	3.3e-119
WP_004150800.1|1571668_1572919_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
WP_004150801.1|1573159_1573810_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
1573259:1573273	attR	AAAGAACGCCAGCCA	NA	NA	NA	NA
WP_004150802.1|1573826_1574285_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004150803.1|1574341_1575448_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP014004	Klebsiella pneumoniae subsp. pneumoniae strain NUHL24835 chromosome, complete genome	5387996	1848850	1858313	5387996	tRNA,protease	Brazilian_cedratvirus(16.67%)	8	NA	NA
WP_004179158.1|1848850_1850572_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_004141853.1|1850598_1851318_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|1851671_1851890_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|1852009_1854289_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|1854319_1854637_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|1854962_1855184_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|1855260_1857201_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|1857197_1858313_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 6
NZ_CP014004	Klebsiella pneumoniae subsp. pneumoniae strain NUHL24835 chromosome, complete genome	5387996	4283812	4329264	5387996	head,plate,tRNA,lysis,integrase,capsid,portal,terminase,tail	Salmonella_phage(78.57%)	55	4281970:4281984	4310434:4310448
4281970:4281984	attL	TCCTGCAGCATTTTC	NA	NA	NA	NA
WP_059689712.1|4283812_4287055_-	transporter substrate-binding domain-containing protein	NA	A0A1V0SGX0	Hokovirus	33.6	4.3e-34
WP_004174237.1|4287059_4287674_-	acid-sensing system DNA-binding response regulator EvgA	NA	NA	NA	NA	NA
WP_072157854.1|4287975_4288341_+	hdeB family protein	NA	NA	NA	NA	NA
WP_004181362.1|4288409_4288682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032439000.1|4289303_4290389_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	61.0	5.3e-122
WP_004144799.1|4290392_4291013_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	38.5	3.3e-36
WP_004144798.1|4291113_4291350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004174275.1|4291384_4291894_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	84.6	5.4e-77
WP_004205792.1|4291901_4292102_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	68.8	5.9e-19
WP_004144796.1|4292065_4292404_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
WP_059689717.1|4292471_4292705_+	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	90.9	1.0e-30
WP_004144794.1|4292704_4292932_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	90.7	5.6e-34
WP_059689718.1|4292928_4293816_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	75.9	3.1e-120
WP_059689720.1|4293796_4296202_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	89.0	0.0e+00
WP_004144689.1|4296388_4296577_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	98.4	7.9e-26
WP_059689856.1|4296590_4296824_+	DinI family protein	NA	A0A1S6L014	Salmonella_phage	84.4	3.5e-31
WP_023318927.1|4296900_4297158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059689722.1|4297452_4298262_+	TIGR04255 family protein	NA	NA	NA	NA	NA
WP_142758158.1|4298281_4298944_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_048300108.1|4298953_4299802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059689725.1|4299839_4300871_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	88.6	1.8e-175
WP_049594188.1|4300870_4302634_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	93.2	0.0e+00
WP_059689727.1|4302774_4303608_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	76.5	8.0e-102
WP_020324020.1|4303624_4304689_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	94.6	1.5e-185
WP_059689728.1|4304692_4305343_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	85.2	5.3e-101
WP_059689730.1|4305439_4305904_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	86.4	6.0e-75
WP_002896155.1|4305903_4306107_+|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_004144702.1|4306110_4306326_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	1.0e-29
WP_059689731.1|4306306_4306816_+	lysozyme	NA	E5G6N1	Salmonella_phage	84.6	2.5e-82
WP_049594185.1|4306820_4307204_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.9	9.5e-18
WP_059689733.1|4307200_4307629_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
WP_074194367.1|4307603_4307762_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	71.2	2.0e-14
WP_059689735.1|4307724_4308147_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	3.1e-62
WP_059689737.1|4308139_4308592_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	73.5	3.1e-52
WP_059689738.1|4308627_4309245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059689740.1|4309351_4309924_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	1.6e-77
WP_059689742.1|4309920_4310283_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	83.9	2.2e-48
WP_059689744.1|4310269_4311178_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	69.5	1.2e-111
4310434:4310448	attR	GAAAATGCTGCAGGA	NA	NA	NA	NA
WP_059689745.1|4311170_4311779_+|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	55.6	8.8e-58
WP_059689747.1|4313910_4314651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059689749.1|4314670_4315750_+|tail	phage tail protein	tail	A0A2H4J931	uncultured_Caudovirales_phage	45.5	1.8e-29
WP_004185685.1|4315888_4317061_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.6	8.6e-211
WP_002896201.1|4317070_4317586_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_004144716.1|4317638_4317938_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	80.0	1.6e-33
WP_002896220.1|4317952_4318072_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_074195890.1|4318298_4320692_+|tail	phage tail tape measure protein	tail	A0A2H4JGB2	uncultured_Caudovirales_phage	39.2	4.0e-106
WP_004185683.1|4320688_4321174_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	77.6	4.1e-58
WP_019704974.1|4321170_4322268_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	84.4	7.9e-174
WP_004174338.1|4322338_4322557_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
WP_004144517.1|4322569_4322947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002917636.1|4323274_4323781_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_004174339.1|4323880_4325722_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_004149864.1|4325940_4327686_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.7	1.6e-75
WP_001144069.1|4327797_4328013_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_004181358.1|4328250_4329264_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.9	1.1e-108
>prophage 7
NZ_CP014004	Klebsiella pneumoniae subsp. pneumoniae strain NUHL24835 chromosome, complete genome	5387996	5059818	5118056	5387996	head,protease,tRNA,integrase,capsid,portal,terminase,tail,holin	Klebsiella_phage(37.21%)	66	5082826:5082849	5120525:5120548
WP_004145598.1|5059818_5061237_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002913435.1|5061288_5061681_-	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002913434.1|5061684_5062038_-	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_004151096.1|5062659_5064831_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_002913423.1|5064879_5066082_-	nucleoside permease NupC	NA	NA	NA	NA	NA
WP_002913421.1|5066428_5067670_+	Mn(2+) uptake NRAMP transporter MntH	NA	NA	NA	NA	NA
WP_002913419.1|5067727_5068087_-	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_059689770.1|5068217_5069210_-	L-glyceraldehyde 3-phosphate reductase	NA	NA	NA	NA	NA
WP_004174935.1|5069390_5071052_+	indolepyruvate decarboxylase	NA	NA	NA	NA	NA
WP_004180794.1|5071048_5072284_-	ion channel protein	NA	NA	NA	NA	NA
WP_002913377.1|5072547_5073513_+	glucokinase	NA	NA	NA	NA	NA
WP_004145587.1|5073566_5074319_-	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	26.3	1.5e-14
WP_004149230.1|5074315_5076013_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	28.5	6.7e-47
WP_020324249.1|5076011_5076125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032422755.1|5076121_5076307_-	phytanoyl-CoA dioxygenase	NA	NA	NA	NA	NA
WP_002913372.1|5076395_5077610_+	alanine transaminase	NA	NA	NA	NA	NA
WP_099119320.1|5077680_5077752_-	membrane protein YpdK	NA	NA	NA	NA	NA
WP_004180792.1|5078090_5079287_-	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_004180790.1|5079283_5079742_-	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	33.1	1.9e-12
WP_004180788.1|5079874_5080783_+	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	23.4	1.5e-08
WP_004180785.1|5080792_5081674_-	hypothetical protein	NA	A0A2H4JEC4	uncultured_Caudovirales_phage	56.8	1.5e-05
WP_004174945.1|5082042_5082525_-	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
5082826:5082849	attL	TATATCCATTTAACTAAGGGGACA	NA	NA	NA	NA
WP_059689771.1|5083043_5084213_+|integrase	site-specific integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	85.0	5.8e-199
WP_071887251.1|5084332_5085352_+	DUF4365 domain-containing protein	NA	NA	NA	NA	NA
WP_077265512.1|5085462_5085663_-	hypothetical protein	NA	G3CFG7	Escherichia_phage	61.4	1.6e-13
WP_059689773.1|5085670_5086342_-	DUF550 domain-containing protein	NA	A0A0M4RTV1	Salmonella_phage	49.8	8.0e-36
WP_059689775.1|5086342_5086597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059689776.1|5086589_5087666_-	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	74.1	3.0e-149
WP_059689778.1|5087662_5088451_-	hypothetical protein	NA	A4JX52	Burkholderia_virus	50.6	1.7e-61
WP_057774585.1|5088450_5088750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032408726.1|5089292_5089940_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	63.0	9.3e-74
WP_059689780.1|5090044_5090233_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	66.1	2.6e-16
WP_004213338.1|5090267_5090729_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	88.2	1.7e-69
WP_023317571.1|5090966_5091179_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	72.7	2.2e-16
WP_059689781.1|5091135_5092050_+	transcriptional regulator	NA	H2DE83	Erwinia_phage	57.1	1.4e-30
WP_059689783.1|5092046_5092856_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	69.3	5.9e-110
WP_059689785.1|5092865_5093243_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	72.8	1.1e-47
WP_071887253.1|5093255_5094236_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	68.1	1.1e-134
WP_004899672.1|5094249_5094828_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	57.2	7.6e-51
WP_059689789.1|5094906_5095476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123260042.1|5096121_5096421_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	83.8	2.0e-39
WP_059689791.1|5096417_5096957_+	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	97.8	3.7e-100
WP_059689793.1|5097298_5097574_+	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	89.0	4.9e-08
WP_023316713.1|5097809_5098094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059689794.1|5098462_5098708_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	64.2	2.1e-18
WP_023317581.1|5099285_5099636_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	81.6	4.6e-51
WP_059689796.1|5099792_5100290_+|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	71.3	9.7e-63
WP_059689797.1|5100293_5102045_+|terminase	terminase large subunit	terminase	A0A1P8DTK0	Proteus_phage	72.0	5.7e-251
WP_000923127.1|5102192_5103419_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	85.3	2.5e-208
WP_059689799.1|5103411_5104011_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	82.4	2.9e-90
WP_059689801.1|5104020_5105259_+|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	66.5	2.8e-151
WP_004206686.1|5105336_5105654_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	52.9	2.4e-22
WP_038434521.1|5105723_5105936_+	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	74.3	1.1e-15
WP_040196239.1|5105937_5106270_+|head	phage head closure protein	head	A0A286S2A2	Klebsiella_phage	97.3	4.5e-56
WP_059689802.1|5106262_5106802_+	HK97 gp10 family phage protein	NA	A0A286S249	Klebsiella_phage	97.8	4.4e-93
WP_059689804.1|5106798_5107164_+	DUF3168 domain-containing protein	NA	A0A286S1R1	Klebsiella_phage	94.2	7.1e-63
WP_059689806.1|5107220_5107712_+|tail	phage tail protein	tail	A0A286S1Q8	Klebsiella_phage	98.8	9.5e-87
WP_004899623.1|5107755_5108139_+	hypothetical protein	NA	A0A286S1N4	Klebsiella_phage	86.3	1.4e-53
WP_059689808.1|5108141_5108405_+	hypothetical protein	NA	A0A286S1P2	Klebsiella_phage	87.2	2.8e-37
WP_139169623.1|5108463_5108841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059689810.1|5108889_5111424_+|tail	phage tail tape measure protein	tail	A0A286S1S3	Klebsiella_phage	74.3	0.0e+00
WP_059689813.1|5111423_5111903_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	98.1	3.0e-93
WP_059689815.1|5111889_5112372_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	98.8	3.5e-86
WP_059689817.1|5112381_5112762_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	93.7	6.9e-69
WP_059689819.1|5112758_5115827_+	kinase	NA	A0A286S259	Klebsiella_phage	97.4	0.0e+00
WP_059689820.1|5115902_5118056_+	hypothetical protein	NA	B5TAB2	Burkholderia_phage	42.1	3.8e-87
5120525:5120548	attR	TATATCCATTTAACTAAGGGGACA	NA	NA	NA	NA
>prophage 8
NZ_CP014004	Klebsiella pneumoniae subsp. pneumoniae strain NUHL24835 chromosome, complete genome	5387996	5341165	5348070	5387996	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_004180551.1|5341165_5342029_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_004180550.1|5342039_5342813_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_004151134.1|5343053_5343950_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004144192.1|5344192_5345554_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004175198.1|5345872_5346595_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_004149058.1|5346591_5348070_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 1
NZ_CP014005	Klebsiella pneumoniae subsp. pneumoniae strain NUHL24835 plasmid unnamed1, complete sequence	101030	47693	54891	101030	integrase,transposase	Escherichia_phage(33.33%)	9	45162:45200	57503:57541
45162:45200	attL	TGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAG	NA	NA	NA	NA
WP_000239590.1|47693_48569_+	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_013023839.1|48615_49092_-	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_145914677.1|49350_50220_-	class A beta-lactamase	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-108
WP_001396888.1|50235_50712_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	2.4e-87
WP_000845039.1|50986_52000_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001083725.1|52144_52642_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_001336345.1|52753_53044_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001206356.1|53049_53841_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_001067858.1|54186_54891_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
57503:57541	attR	CTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCA	NA	NA	NA	NA
>prophage 2
NZ_CP014005	Klebsiella pneumoniae subsp. pneumoniae strain NUHL24835 plasmid unnamed1, complete sequence	101030	79354	86375	101030	integrase	Escherichia_phage(50.0%)	7	72735:72748	80739:80752
72735:72748	attL	ATGTCTTTTAAGTT	NA	NA	NA	NA
WP_004197635.1|79354_80149_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	88.7	5.5e-52
WP_006788217.1|80596_80776_-	hypothetical protein	NA	NA	NA	NA	NA
80739:80752	attR	ATGTCTTTTAAGTT	NA	NA	NA	NA
WP_004197649.1|80895_81522_-	ParA family plasmid-partitioning AAA ATPase	NA	A0A222YXS3	Escherichia_phage	43.6	2.9e-40
WP_004098982.1|82178_83054_-	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	56.4	5.6e-82
WP_004197646.1|83467_84739_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.0	5.2e-153
WP_001568036.1|84738_85170_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
WP_001568038.1|85403_86375_+	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
