The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011863	Enterobacter asburiae strain ATCC 35953 chromosome, complete genome	4713742	330483	363676	4713742	head,transposase,tail,plate,protease,integrase,capsid,terminase	Pseudomonas_phage(31.25%)	46	321634:321648	335098:335112
321634:321648	attL	TGGACATTTTTACTC	NA	NA	NA	NA
WP_023311691.1|330483_331254_-	helix-turn-helix transcriptional regulator	NA	A0A2I7S9A5	Vibrio_phage	37.5	6.1e-40
WP_023311692.1|331388_331646_+	helix-turn-helix domain-containing protein	NA	M1PVU4	Vibrio_phage	64.6	2.1e-16
WP_054829982.1|331645_333691_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2D1GNK9	Pseudomonas_phage	48.3	4.6e-175
WP_023311926.1|333702_334596_+	AAA family ATPase	NA	A0A2D1GNS0	Pseudomonas_phage	59.8	3.6e-100
WP_049111779.1|334606_334897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048703759.1|334909_335116_+	hypothetical protein	NA	NA	NA	NA	NA
335098:335112	attR	GAGTAAAAATGTCCA	NA	NA	NA	NA
WP_049111782.1|335105_335750_+	DUF3164 family protein	NA	A4JWM8	Burkholderia_virus	64.6	9.3e-74
WP_054829983.1|335751_335985_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032663812.1|335974_336166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054829984.1|336246_336966_+	DUF2786 domain-containing protein	NA	A0A0S4L2R2	Pseudomonas_phage	32.6	1.4e-17
WP_024262653.1|336962_337424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054829986.1|337551_337917_+	DUF4406 domain-containing protein	NA	A0A1V0E824	Vibrio_phage	51.1	1.7e-19
WP_071886540.1|338302_338518_+	hypothetical protein	NA	A0A2D1GNS9	Pseudomonas_phage	56.3	2.4e-18
WP_065944692.1|338579_339056_+	regulatory protein GemA	NA	A0A2D1GNN4	Pseudomonas_phage	63.0	7.4e-44
WP_059347798.1|339000_339435_+	hypothetical protein	NA	A0A2D1GNW5	Pseudomonas_phage	44.7	4.8e-26
WP_059346328.1|339448_339949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059346329.1|340028_340673_+	glycoside hydrolase family 19 protein	NA	A0A248XCW5	Klebsiella_phage	56.3	2.8e-62
WP_049111794.1|340669_340933_+	DUF2644 domain-containing protein	NA	A0A2D1GNW8	Pseudomonas_phage	57.3	4.8e-13
WP_059347799.1|340898_341531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000171281.1|341539_341782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021567611.1|341778_342063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000941096.1|342064_342565_+	DUF1804 family protein	NA	L7P7L4	Pseudomonas_phage	54.1	1.2e-47
WP_001568913.1|342557_342764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059346330.1|342788_344438_+|terminase	phage terminase large subunit	terminase	H6V8N6	Pseudomonas_phage	65.9	8.4e-212
WP_048703798.1|344440_346009_+	DUF935 domain-containing protein	NA	A0A0U5KSI0	unidentified_phage	45.0	6.1e-127
WP_059346331.1|345995_347255_+|capsid	minor capsid protein	capsid	A0A0M4UTA3	Ralstonia_phage	35.1	1.1e-51
WP_059346332.1|347251_347794_+	phage virion morphogenesis protein	NA	A0A2H4J9E5	uncultured_Caudovirales_phage	37.1	3.7e-23
WP_032668432.1|347910_348120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059346333.1|348175_349291_+|protease	phage protease	protease	A0A0M5N0Q6	Ralstonia_phage	42.6	2.0e-60
WP_021567605.1|349302_349695_+	hypothetical protein	NA	J9RWG0	Pseudomonas_phage	44.2	7.7e-23
WP_021567604.1|349708_350617_+|head	Mu-like prophage major head subunit gpT family protein	head	A0A2H4J778	uncultured_Caudovirales_phage	63.9	3.8e-105
WP_045261516.1|350616_351024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021567602.1|351027_351456_+	DUF1320 family protein	NA	A0A1B0T6F3	Thiobacimonas_phage	35.1	5.1e-12
WP_059346334.1|351455_352115_+	DUF1834 family protein	NA	A0A0M3LQJ7	Mannheimia_phage	34.2	9.3e-21
WP_054829991.1|352101_352323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054829992.1|352309_353728_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	B7SDP8	Haemophilus_phage	40.9	1.1e-82
WP_054829993.1|353741_354116_+	hypothetical protein	NA	F6MIK8	Haemophilus_phage	55.7	2.5e-31
WP_059346335.1|354116_354509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059346336.1|354643_356785_+|tail	phage tail tape measure protein	tail	B5TAA4	Burkholderia_phage	28.0	3.5e-32
WP_059346337.1|356781_358113_+	DNA circularization N-terminal domain-containing protein	NA	A0A2H4JGT4	uncultured_Caudovirales_phage	27.1	2.8e-32
WP_059346338.1|358096_359314_+|tail	phage tail protein	tail	A0A2H4J9E6	uncultured_Caudovirales_phage	37.9	6.4e-76
WP_054829994.1|359297_359903_+|plate	phage baseplate assembly protein	plate	A0A0M3LPA3	Mannheimia_phage	43.1	2.0e-30
WP_059346339.1|359992_360343_+	phage GP46 family protein	NA	A0A2H4JDR8	uncultured_Caudovirales_phage	60.0	1.5e-30
WP_059346340.1|360342_361410_+|plate	baseplate J/gp47 family protein	plate	A0A0M3LQN4	Mannheimia_phage	46.3	5.5e-71
WP_054829995.1|361406_361973_+	DUF2313 domain-containing protein	NA	F6MIL7	Haemophilus_phage	44.1	1.1e-35
WP_096216684.1|363298_363676_+|tail	tail fiber assembly protein	tail	A0A1S6KZY8	Salmonella_phage	45.1	1.1e-10
>prophage 2
NZ_CP011863	Enterobacter asburiae strain ATCC 35953 chromosome, complete genome	4713742	1062356	1169668	4713742	head,holin,transposase,tail,protease,lysis,integrase,terminase	Salmonella_phage(33.8%)	127	1058555:1058581	1136089:1136115
1058555:1058581	attL	CGGGTAAGCGTCAGCGCCACCCGGCAA	NA	NA	NA	NA
WP_059346617.1|1062356_1063637_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	51.2	1.5e-123
WP_054830143.1|1063669_1063918_-	excisionase family protein	NA	S4TND0	Salmonella_phage	51.4	4.9e-15
WP_054830142.1|1064030_1064279_-	hypothetical protein	NA	G8C7S3	Escherichia_phage	81.2	4.1e-22
WP_054830141.1|1064275_1064467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054830140.1|1064476_1064716_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	67.9	4.2e-24
WP_054830139.1|1064693_1065038_-	DUF2591 family protein	NA	R9VYJ6	Serratia_phage	46.8	1.7e-21
WP_054830138.1|1065034_1065253_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	55.9	2.8e-14
WP_054830137.1|1065254_1065680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054830136.1|1065771_1065963_-	DUF1382 family protein	NA	A0A0N7C481	Escherichia_phage	66.1	7.1e-14
WP_054830135.1|1065959_1066277_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	63.8	1.7e-33
WP_054830134.1|1066273_1066492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081051418.1|1066488_1068399_-	phage N-6-adenine-methyltransferase	NA	A0A2I7RFJ9	Vibrio_phage	52.1	4.2e-114
WP_167347073.1|1068395_1068560_-	hypothetical protein	NA	G8C7S7	Escherichia_phage	96.2	1.0e-21
WP_054830133.1|1068556_1068985_-	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	93.7	8.3e-71
WP_059346619.1|1068981_1069662_-	YqaJ viral recombinase family protein	NA	M9NZE1	Enterobacteria_phage	93.8	5.5e-125
WP_059346621.1|1069658_1070504_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	61.6	7.4e-71
WP_054830131.1|1070522_1070804_-	host nuclease inhibitor GamL	NA	M9NZI3	Enterobacteria_phage	95.7	1.2e-46
WP_059346623.1|1070811_1071888_-	hypothetical protein	NA	A0A077KCC0	Edwardsiella_phage	71.1	3.4e-36
WP_000607101.1|1071958_1072168_-	cell division protein FtsZ	NA	M9NZE2	Enterobacteria_phage	97.1	3.9e-34
WP_000218995.1|1072164_1072323_-	hypothetical protein	NA	M9NZI5	Enterobacteria_phage	100.0	6.9e-23
WP_023330697.1|1072319_1072535_-	hypothetical protein	NA	B5WZV1	Pseudomonas_phage	48.6	5.2e-05
WP_023303584.1|1072810_1073020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063945715.1|1073006_1073189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054830145.1|1073536_1073746_+	hypothetical protein	NA	G8C7T7	Escherichia_phage	84.4	4.5e-22
WP_047737340.1|1073773_1073983_-	hypothetical protein	NA	C6ZR45	Salmonella_phage	62.3	3.8e-13
WP_054830130.1|1074082_1074517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015571542.1|1074678_1075371_-	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	78.9	4.6e-95
WP_054830129.1|1075476_1075710_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	66.2	2.5e-21
WP_054830128.1|1075740_1076307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015571544.1|1076396_1076543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048982990.1|1076535_1077432_+	hypothetical protein	NA	F1C5C3	Cronobacter_phage	59.8	9.8e-98
WP_059346627.1|1077421_1078855_+	AAA family ATPase	NA	Q716D2	Shigella_phage	86.0	6.6e-229
WP_054830127.1|1078854_1079151_+	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	53.6	3.0e-19
WP_054830126.1|1079147_1079720_+	ead/Ea22-like family protein	NA	A0A2R2Z315	Escherichia_phage	45.6	5.2e-28
WP_054830125.1|1079716_1080097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167347074.1|1080099_1080276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_116799391.1|1080369_1081577_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.9	2.3e-102
WP_059346629.1|1081647_1082280_+	hypothetical protein	NA	H6WRY2	Salmonella_phage	38.2	4.7e-30
WP_054829861.1|1082783_1083239_+	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	72.2	1.8e-60
WP_000106777.1|1083238_1083409_+	NinE family protein	NA	K7P7K0	Enterobacteria_phage	100.0	1.1e-23
WP_054829860.1|1083405_1084074_+	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	99.5	5.9e-132
WP_000048136.1|1084066_1084351_+	hypothetical protein	NA	G8C7V5	Escherichia_phage	95.7	9.4e-47
WP_021571188.1|1084347_1084707_+	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	61.3	2.0e-41
WP_153251232.1|1084703_1084820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059346630.1|1084819_1085320_+	antiterminator	NA	G8C7V7	Escherichia_phage	95.1	3.0e-88
WP_023311421.1|1086179_1086521_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	54.2	1.1e-28
WP_102046760.1|1086504_1086948_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	70.5	9.9e-51
WP_054829858.1|1086944_1087415_+|lysis	lysis protein	lysis	Q8HA85	Salmonella_phage	57.9	1.4e-39
WP_032665504.1|1087604_1088291_+	Rha family transcriptional regulator	NA	A0A192Y918	Salmonella_phage	99.1	1.8e-123
WP_023277179.1|1088432_1088804_+	hypothetical protein	NA	Q76H27	Enterobacteria_phage	56.6	1.1e-34
WP_054829857.1|1088807_1089446_+	hypothetical protein	NA	I6S676	Salmonella_phage	90.6	7.7e-113
WP_054829856.1|1089477_1089936_+	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	81.6	5.6e-65
WP_054829855.1|1089928_1091176_+|terminase	terminase	terminase	I6RSK1	Salmonella_phage	99.2	4.1e-219
WP_054829854.1|1091190_1092543_+	DUF1073 domain-containing protein	NA	H6WRT0	Salmonella_phage	75.8	1.4e-201
WP_059346632.1|1092496_1093426_+|head	phage head morphogenesis protein	head	H6WRT1	Salmonella_phage	81.8	1.9e-136
WP_047064334.1|1093429_1094692_+	hypothetical protein	NA	H6WRT2	Salmonella_phage	93.6	2.5e-224
WP_032676278.1|1094704_1095160_+	hypothetical protein	NA	G0ZND8	Cronobacter_phage	82.8	3.0e-63
WP_032676277.1|1095174_1096272_+	hypothetical protein	NA	G0ZND9	Cronobacter_phage	83.6	6.2e-179
WP_032676276.1|1096281_1096578_+	hypothetical protein	NA	G0ZNE0	Cronobacter_phage	70.4	7.3e-34
WP_054829867.1|1096636_1097038_+	hypothetical protein	NA	A0A1V0E5R0	Salmonella_phage	92.5	4.0e-67
WP_054829865.1|1097209_1097572_+	hypothetical protein	NA	I6S1Q5	Salmonella_phage	95.8	2.6e-65
WP_017384090.1|1097579_1098017_+	hypothetical protein	NA	A0A1V0E5P5	Salmonella_phage	92.4	4.2e-70
WP_045339753.1|1098013_1098400_+	hypothetical protein	NA	Q5G8X4	Enterobacteria_phage	92.2	8.9e-64
WP_045339749.1|1098415_1099150_+	hypothetical protein	NA	A0A1V0E5P2	Salmonella_phage	86.8	5.0e-116
WP_059346634.1|1100026_1100557_+	KilA-N domain-containing protein	NA	A0A1V0E5P7	Salmonella_phage	85.8	2.0e-82
WP_048962465.1|1100903_1101425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059346636.1|1101472_1104835_+	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	86.1	0.0e+00
WP_054829853.1|1104834_1105182_+|tail	phage tail protein	tail	H6WRV8	Salmonella_phage	93.9	1.3e-58
WP_022651023.1|1105203_1105359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022651024.1|1105337_1105535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023303627.1|1105700_1106405_+|tail	phage minor tail protein L	tail	A0A1V0E5N2	Salmonella_phage	98.7	9.3e-136
WP_054829864.1|1106404_1107124_+	C40 family peptidase	NA	A0A1V0E5M9	Salmonella_phage	82.7	8.6e-121
WP_059346638.1|1107066_1107600_+|tail	tail assembly protein	tail	H6WRW3	Salmonella_phage	67.0	1.2e-53
WP_081051419.1|1107609_1111389_+|tail	phage tail protein	tail	I6R9B3	Salmonella_phage	61.2	0.0e+00
WP_054829852.1|1111388_1112336_+	hypothetical protein	NA	G5DMH8	Enterobacter_virus	48.1	4.5e-77
WP_063849362.1|1112392_1113601_+|tail	tail fiber domain-containing protein	tail	K7PGY2	Enterobacteria_phage	48.8	1.1e-86
WP_054829850.1|1113695_1113962_-	DinI family protein	NA	K7PKM2	Enterobacterial_phage	97.7	9.5e-41
WP_023306078.1|1114287_1114605_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	48.0	1.1e-19
WP_023311457.1|1115116_1116145_+	Mal regulon transcriptional regulator MalI	NA	NA	NA	NA	NA
WP_054829848.1|1116147_1117044_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_059346641.1|1117151_1118132_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_059346643.1|1118147_1119002_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_054829847.1|1119040_1120582_-	YdgA family protein	NA	NA	NA	NA	NA
WP_059346645.1|1120681_1121857_-	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_029740299.1|1122056_1123703_+	fumarate hydratase	NA	NA	NA	NA	NA
WP_029740298.1|1123842_1125237_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_054829862.1|1125237_1126167_-	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
WP_047647993.1|1126240_1127539_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.5	3.6e-16
WP_059346647.1|1127614_1127875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021241154.1|1128128_1128845_-	two-component system response regulator RstA	NA	NA	NA	NA	NA
WP_054829846.1|1128973_1129309_+	GlpM family protein	NA	NA	NA	NA	NA
WP_059346649.1|1129305_1130028_-	dihydromonapterin reductase	NA	NA	NA	NA	NA
WP_029740292.1|1130067_1131450_-	amino acid permease	NA	NA	NA	NA	NA
WP_024909331.1|1131635_1132580_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_059346651.1|1133115_1134645_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_054829845.1|1134655_1136044_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit beta	NA	NA	NA	NA	NA
WP_023335478.1|1136164_1137115_-	universal stress protein UspE	NA	NA	NA	NA	NA
1136089:1136115	attR	TTGCCGGGTGGCGCTGACGCTTACCCG	NA	NA	NA	NA
WP_008500541.1|1137224_1137419_-	hypothetical protein	NA	K7PGY7	Enterobacteria_phage	58.1	1.5e-11
WP_029740290.1|1137553_1138306_-	fumarate/nitrate reduction transcriptional regulator Fnr	NA	NA	NA	NA	NA
WP_059346652.1|1138489_1139005_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	44.0	5.4e-24
WP_059346653.1|1139015_1140542_-	p-aminobenzoyl-glutamate transporter	NA	NA	NA	NA	NA
WP_029740287.1|1140578_1142024_-	amidohydrolase	NA	NA	NA	NA	NA
WP_059346654.1|1142023_1143334_-	M20 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_023311481.1|1143509_1144421_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_059346655.1|1144776_1145340_+	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_054830291.1|1145367_1147029_-	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.5	2.0e-11
WP_054830290.1|1147173_1148040_+	aldo/keto reductase family oxidoreductase	NA	NA	NA	NA	NA
WP_029740281.1|1148085_1148286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029740280.1|1148573_1149008_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	58.5	5.2e-36
WP_059346656.1|1148991_1150254_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	69.2	6.7e-169
WP_059346657.1|1150266_1150536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054830289.1|1150618_1151506_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_059346658.1|1152700_1153681_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_059347810.1|1153816_1154701_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_059346659.1|1154672_1156127_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_059346660.1|1156223_1156991_+	arylamine N-acetyltransferase	NA	NA	NA	NA	NA
WP_059346661.1|1157013_1160091_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_059346662.1|1160087_1161236_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_059346663.1|1161314_1162511_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_029739347.1|1162507_1163203_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.2	1.4e-27
WP_059346664.1|1163327_1164113_+	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_003857471.1|1164142_1164490_-	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_059346665.1|1164668_1165694_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_059346666.1|1166672_1167707_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_059347811.1|1168129_1168492_+	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_024909144.1|1168478_1168808_+	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_047647926.1|1168846_1169668_-|protease	serine protease	protease	NA	NA	NA	NA
>prophage 3
NZ_CP011863	Enterobacter asburiae strain ATCC 35953 chromosome, complete genome	4713742	1205140	1215213	4713742		Oenococcus_phage(16.67%)	9	NA	NA
WP_054830010.1|1205140_1206355_+	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	29.4	8.2e-47
WP_054830013.1|1206369_1207389_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	27.0	8.7e-18
WP_059346682.1|1207462_1208830_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_059346683.1|1209050_1210514_+	mannitol dehydrogenase family protein	NA	G9E6E2	Micromonas_pusilla_virus	30.6	1.5e-42
WP_014883679.1|1210557_1210761_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	58.2	3.4e-14
WP_059346684.1|1211047_1211479_+	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	35.9	8.2e-18
WP_023311557.1|1211512_1212199_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023311558.1|1212290_1213037_-	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_059346685.1|1213179_1215213_+	peptidyl-dipeptidase Dcp	NA	A0A1V0SIU1	Klosneuvirus	21.5	1.0e-17
>prophage 4
NZ_CP011863	Enterobacter asburiae strain ATCC 35953 chromosome, complete genome	4713742	1811409	1889037	4713742	head,holin,tRNA,portal,tail,plate,protease,integrase,capsid,terminase	Salmonella_phage(32.65%)	92	1847641:1847671	1886826:1886856
WP_054829572.1|1811409_1812105_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_059346914.1|1812171_1814082_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.3	3.6e-89
WP_029742004.1|1814215_1814560_+	RidA family protein	NA	NA	NA	NA	NA
WP_023336068.1|1814566_1814758_-	YoaH family protein	NA	NA	NA	NA	NA
WP_023312196.1|1816150_1816729_+	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_059346915.1|1816913_1818278_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_059346916.1|1818408_1820007_+	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_059346917.1|1822034_1823000_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_008500490.1|1823046_1823847_+	PTS mannose transporter subunit IIC	NA	NA	NA	NA	NA
WP_006810994.1|1823859_1824711_+	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
WP_054829575.1|1824765_1825224_+	DUF986 domain-containing protein	NA	NA	NA	NA	NA
WP_029741998.1|1825621_1826188_+	manganese efflux pump MntP	NA	NA	NA	NA	NA
WP_059346918.1|1826184_1827000_-	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
WP_047647460.1|1827065_1828784_-	peptidoglycan glycosyltransferase FtsI	NA	NA	NA	NA	NA
WP_001062678.1|1829003_1829213_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
WP_059346919.1|1829896_1830886_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_029741994.1|1830909_1831200_-	YebO family protein	NA	NA	NA	NA	NA
WP_006175995.1|1831274_1831418_-	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
WP_054829576.1|1831579_1831819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054829577.1|1831887_1832679_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_059346920.1|1832858_1834232_+	MFS transporter	NA	NA	NA	NA	NA
WP_014884290.1|1834282_1835164_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_059346921.1|1835357_1837406_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	32.7	5.4e-83
WP_023336085.1|1837425_1838112_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_008500476.1|1838208_1838706_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_059346922.1|1838838_1840122_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_054829579.1|1840090_1842724_+	PqiB family protein	NA	NA	NA	NA	NA
WP_054829580.1|1842801_1844244_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_008500472.1|1844350_1844590_+	YebV family protein	NA	NA	NA	NA	NA
WP_033145837.1|1844624_1845269_-	protein-serine/threonine phosphatase	NA	Q8HA16	Enterobacteria_phage	48.6	2.5e-55
WP_059346923.1|1845435_1846377_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_059346924.1|1846550_1847447_+	benzoate transporter	NA	A0A0N9QAD0	Chrysochromulina_ericina_virus	29.7	2.0e-26
1847641:1847671	attL	TAGATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
WP_054829581.1|1848110_1848692_+	antA/AntB antirepressor family protein	NA	A0A0P0ZDY7	Stx2-converting_phage	80.0	8.7e-47
WP_059346925.1|1848806_1849766_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	35.1	1.0e-07
WP_081051426.1|1849773_1850313_-|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	42.7	7.9e-26
WP_041910491.1|1851657_1852245_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	84.6	5.4e-97
WP_054829587.1|1852244_1853324_-|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	83.1	2.0e-174
WP_054829588.1|1853316_1853730_-	phage GP46 family protein	NA	A0A192Y6D0	Salmonella_phage	86.9	4.6e-66
WP_054829589.1|1853733_1854267_-|plate	phage baseplate assembly protein	plate	A0A192Y8K5	Salmonella_phage	81.8	2.7e-79
WP_059346927.1|1854266_1855322_-|plate	baseplate protein	plate	A0A192Y7L7	Salmonella_phage	85.5	3.4e-174
WP_054829590.1|1855318_1856662_-	DNA circularization N-terminal domain-containing protein	NA	A0A192Y5U9	Salmonella_phage	79.2	2.8e-197
WP_059346928.1|1856695_1858618_-|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	78.8	1.6e-267
WP_054829591.1|1858702_1859029_-|tail	phage tail assembly protein	tail	Q8W621	Enterobacteria_phage	80.2	3.1e-41
WP_054829592.1|1859025_1859382_-|tail	phage tail tube protein	tail	A0A192Y8K0	Salmonella_phage	92.4	1.5e-57
WP_059346929.1|1859381_1860896_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	Q8HAC5	Salmonella_phage	72.1	5.5e-202
WP_071886554.1|1860879_1861050_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	64.3	8.2e-14
WP_054829593.1|1861053_1861614_-	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	94.1	8.5e-100
WP_059346930.1|1861610_1862123_-	hypothetical protein	NA	Q8HAC8	Salmonella_phage	96.5	8.1e-89
WP_054829595.1|1862094_1862499_-|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	92.5	2.8e-68
WP_054829596.1|1862495_1862819_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	72.0	2.6e-40
WP_059346931.1|1862898_1864128_-|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	93.6	7.4e-213
WP_059346932.1|1864137_1864740_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	91.5	6.0e-99
WP_059346933.1|1864732_1865950_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	83.2	2.1e-196
WP_167347075.1|1865943_1866102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059346934.1|1866098_1867829_-|terminase	terminase large subunit	terminase	Q8W631	Enterobacteria_phage	59.1	3.8e-199
WP_059346935.1|1867828_1868266_-|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	62.8	3.5e-32
WP_071886555.1|1868374_1868743_-	HNH endonuclease	NA	Q8HA82	Salmonella_phage	73.0	4.2e-47
WP_054829597.1|1868723_1869374_-	methyltransferase domain-containing protein	NA	B5WZS8	Pseudomonas_phage	49.3	1.2e-49
WP_071886556.1|1869354_1870191_-	hypothetical protein	NA	B5WZS7	Pseudomonas_phage	47.8	2.2e-67
WP_071886557.1|1870228_1870768_-	hypothetical protein	NA	B5WZS6	Pseudomonas_phage	52.0	9.5e-48
WP_059346937.1|1870840_1871251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153251264.1|1871499_1871778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054829603.1|1871785_1872415_-	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	89.0	1.6e-102
WP_081051427.1|1872411_1872708_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_054829604.1|1872704_1873109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054829605.1|1873440_1874055_-	hypothetical protein	NA	H9C175	Pectobacterium_phage	65.8	6.8e-74
WP_059346938.1|1874051_1874408_-	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	60.2	9.1e-39
WP_059346939.1|1874400_1875651_-	DNA cytosine methyltransferase	NA	Q71TA0	Escherichia_phage	53.2	1.0e-129
WP_054829607.1|1875643_1875940_-	hypothetical protein	NA	Q6V7S4	Burkholderia_virus	58.1	4.9e-22
WP_164879454.1|1876079_1876247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054829608.1|1876431_1876755_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	65.7	1.7e-31
WP_054829609.1|1876940_1877279_-	hypothetical protein	NA	A0A2P1JU39	Erwinia_phage	63.4	3.0e-07
WP_054829610.1|1877281_1877497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054829611.1|1877493_1877706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059346940.1|1877698_1878355_-	DUF1627 domain-containing protein	NA	NA	NA	NA	NA
WP_167347076.1|1878369_1878918_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	52.0	5.3e-38
WP_059346941.1|1878805_1879909_-	hypothetical protein	NA	Q8W642	Enterobacteria_phage	31.5	1.7e-19
WP_054829614.1|1879905_1880163_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_054829615.1|1880179_1880629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032663354.1|1880628_1880898_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	38.7	2.8e-08
WP_054829616.1|1880970_1881462_+	helix-turn-helix domain-containing protein	NA	A0A0R6PH50	Moraxella_phage	61.6	4.6e-17
WP_153251268.1|1882159_1882345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059346942.1|1882414_1882687_+	hypothetical protein	NA	K7P7B3	Enterobacteria_phage	42.0	5.4e-15
WP_059346943.1|1882909_1884805_+	hypothetical protein	NA	S4TNL0	Salmonella_phage	30.7	9.5e-26
WP_054829617.1|1884801_1885095_+	hypothetical protein	NA	A0A096XUX1	Cronobacter_phage	35.6	1.8e-08
WP_054829618.1|1885081_1885324_+	DUF4060 family protein	NA	NA	NA	NA	NA
WP_054829630.1|1885380_1885641_+	hypothetical protein	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	40.5	2.8e-13
WP_059346944.1|1885618_1886698_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	54.7	9.6e-108
WP_045404471.1|1887072_1887411_-	YebY family protein	NA	NA	NA	NA	NA
1886826:1886856	attR	TAGATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
WP_059346945.1|1887427_1888297_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_054829619.1|1888298_1888670_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_013096102.1|1888806_1889037_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	9.1e-16
>prophage 5
NZ_CP011863	Enterobacter asburiae strain ATCC 35953 chromosome, complete genome	4713742	1981071	2036022	4713742	head,tail,transposase,integrase	uncultured_Caudovirales_phage(25.0%)	61	2006331:2006346	2039716:2039731
WP_047359753.1|1981071_1981413_-	hypothetical protein	NA	A0A2H4J7H0	uncultured_Caudovirales_phage	52.7	7.4e-22
WP_059346963.1|1981477_1984369_-	hypothetical protein	NA	G9L6D4	Escherichia_phage	76.1	0.0e+00
WP_059346964.1|1984368_1987077_-	transglycosylase SLT domain-containing protein	NA	G9L6D3	Escherichia_phage	64.1	0.0e+00
WP_023305517.1|1987079_1987547_-	hypothetical protein	NA	A0A2H4J679	uncultured_Caudovirales_phage	44.7	2.1e-06
WP_059346965.1|1987549_1987999_-	GNAT family N-acetyltransferase	NA	A0A2H4J9Z5	uncultured_Caudovirales_phage	43.0	1.2e-22
WP_059346966.1|1988000_1989992_-	hypothetical protein	NA	A0A2H4J6H2	uncultured_Caudovirales_phage	49.2	1.2e-188
WP_059346967.1|1989993_1990557_-	hypothetical protein	NA	A0A2H4JID6	uncultured_Caudovirales_phage	51.9	1.6e-50
WP_059346968.1|1990615_1991527_-	hypothetical protein	NA	A0A2H4JC66	uncultured_Caudovirales_phage	37.6	7.0e-43
WP_054830271.1|1991743_1991983_-	hypothetical protein	NA	G8C7W3	Escherichia_phage	54.8	4.7e-15
WP_054830270.1|1992016_1992853_-	hypothetical protein	NA	A0A2H4JEQ5	uncultured_Caudovirales_phage	44.0	9.6e-47
WP_054830269.1|1992839_1993073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059346969.1|1993069_1994695_-|head,tail	head-tail connector protein	head,tail	A0A2H4J3N6	uncultured_Caudovirales_phage	59.1	7.8e-170
WP_023305508.1|1994698_1994929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059346970.1|1994943_1995429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054830278.1|1995465_1995756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071886559.1|1995911_1996214_-	DUF968 domain-containing protein	NA	A0A1I9KFA7	Aeromonas_phage	53.7	7.5e-26
WP_054830279.1|1996225_1996822_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	72.7	1.2e-80
WP_059347825.1|1996890_1997082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059346971.1|1997258_1997597_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	69.6	1.6e-37
WP_054830280.1|1997589_1997835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059346972.1|1998315_1998720_-	hypothetical protein	NA	F1C5B6	Cronobacter_phage	48.4	1.2e-05
WP_059346973.1|1998712_1998961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059346974.1|1998964_1999642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071886560.1|1999683_2001072_-	hypothetical protein	NA	Q8HA30	Enterobacteria_phage	48.0	8.6e-109
WP_059346975.1|2001068_2002058_-	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	73.6	7.9e-40
WP_049120718.1|2002060_2002285_-	hypothetical protein	NA	H9C163	Pectobacterium_phage	66.2	1.4e-21
WP_017384468.1|2002306_2002753_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	52.5	7.7e-27
WP_059346976.1|2002818_2003052_-	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	47.2	5.2e-11
WP_049120720.1|2003160_2003616_+	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	51.3	8.6e-34
WP_054830286.1|2004141_2004465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049120723.1|2004472_2004718_+	hypothetical protein	NA	A0A1B1W282	Salmonella_phage	56.2	7.0e-14
WP_059347826.1|2004755_2006969_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	35.0	2.6e-99
2006331:2006346	attL	GAGCGTTTCGATACCG	NA	NA	NA	NA
WP_059346977.1|2006965_2007526_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	55.7	2.2e-47
WP_017384474.1|2007528_2007711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032609568.1|2007921_2008170_+	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	39.5	6.4e-07
WP_049120727.1|2008153_2009170_+|integrase	tyrosine-type recombinase/integrase	integrase	H9C152	Pectobacterium_phage	64.0	6.3e-125
WP_023312285.1|2009745_2010294_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_029741944.1|2010350_2012183_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_013096026.1|2012179_2012836_-	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_001310555.1|2012925_2013942_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_023336161.1|2014400_2015153_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-26
WP_014884380.1|2015149_2015818_-	cystine ABC transporter permease	NA	NA	NA	NA	NA
WP_059346978.1|2015839_2016826_-	D-cysteine desulfhydrase	NA	NA	NA	NA	NA
WP_023336163.1|2016932_2017733_-	cystine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014170714.1|2018425_2019145_-	RNA polymerase sigma factor FliA	NA	NA	NA	NA	NA
WP_059346979.1|2019274_2020480_-	flagellin lysine-N-methylase	NA	NA	NA	NA	NA
WP_023312294.1|2020542_2021367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059346980.1|2021767_2023192_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_023312296.1|2023213_2023618_+	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_023312297.1|2023623_2023998_+	flagella biosynthesis regulatory protein FliT	NA	NA	NA	NA	NA
WP_059347827.1|2024049_2025537_+	alpha-amylase	NA	NA	NA	NA	NA
WP_023312299.1|2025639_2026053_-	lipoprotein	NA	NA	NA	NA	NA
WP_116799391.1|2027203_2028411_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.9	2.3e-102
WP_153251373.1|2028409_2028874_+	GtrA family protein	NA	F1C5B1	Cronobacter_phage	66.7	3.7e-32
WP_001310555.1|2028911_2029928_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_059346981.1|2029964_2030849_+	glycosyltransferase family 2 protein	NA	M1FQW5	Enterobacteria_phage	88.0	1.2e-143
WP_001310555.1|2030957_2031974_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_153251372.1|2032083_2032959_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	34.7	1.5e-34
WP_001310555.1|2033067_2034084_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_155616776.1|2034101_2034917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071886563.1|2035023_2036022_+	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	28.4	1.2e-16
2039716:2039731	attR	CGGTATCGAAACGCTC	NA	NA	NA	NA
>prophage 6
NZ_CP011863	Enterobacter asburiae strain ATCC 35953 chromosome, complete genome	4713742	2247245	2347671	4713742	head,transposase,tRNA,portal,tail,protease,lysis,integrase,capsid,terminase	Enterobacteria_phage(40.68%)	104	2238699:2238731	2352446:2352478
2238699:2238731	attL	CCCTCACCCTAACCCTCTCCCACAGGGAGAGGG	NA	NA	NA	NA
WP_059347042.1|2247245_2248178_-|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
WP_054829875.1|2248219_2249017_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_059347043.1|2249076_2249793_+	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
WP_023312463.1|2249984_2250380_+	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_047647262.1|2250376_2251072_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_059347044.1|2251201_2252086_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_008500918.1|2252212_2252929_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_054829877.1|2253053_2254442_+	glutamine synthetase	NA	NA	NA	NA	NA
WP_008500921.1|2254491_2255502_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_059347045.1|2255517_2257038_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
WP_023312468.1|2257117_2258116_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_029740403.1|2258411_2259434_-	HTH-type transcriptional regulator GalS	NA	NA	NA	NA	NA
WP_059347046.1|2259589_2260747_-	DUF418 family protein	NA	NA	NA	NA	NA
WP_008500927.1|2260766_2261435_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	55.8	6.9e-56
WP_059347047.1|2262823_2263651_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_059347048.1|2263762_2265733_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	35.9	2.8e-12
WP_029740408.1|2265957_2267427_-	amino acid permease	NA	NA	NA	NA	NA
WP_023312476.1|2267607_2268474_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_059347049.1|2268571_2269618_+	YeiH family protein	NA	NA	NA	NA	NA
WP_024908173.1|2269682_2270540_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	32.7	8.1e-25
WP_029740970.1|2270587_2272273_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_008500936.1|2272289_2273228_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_059347050.1|2273227_2274358_-	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_059347051.1|2274719_2275901_+	sugar efflux transporter SetB	NA	NA	NA	NA	NA
WP_023312483.1|2275897_2276152_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_008500940.1|2276316_2276889_+	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_054829878.1|2277004_2278195_-	mannonate dehydratase	NA	NA	NA	NA	NA
WP_059347052.1|2278400_2279867_+	fructuronate reductase	NA	E5EQS6	Micromonas_sp._RCC1109_virus	30.0	2.6e-39
WP_059347053.1|2279991_2280978_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_029740964.1|2281011_2281725_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_008500946.1|2282140_2282710_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	3.6e-13
WP_059347054.1|2282837_2284394_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_059347055.1|2284468_2286274_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_029740961.1|2286283_2287378_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_023312492.1|2287377_2288403_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_059347056.1|2288404_2289994_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.4	1.2e-16
WP_008500952.1|2289997_2290342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054829879.1|2290621_2291818_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	22.6	1.7e-20
WP_029740957.1|2291833_2292541_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_029740955.1|2294707_2294992_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_008500957.1|2295043_2296051_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.6	2.9e-82
WP_008500958.1|2296185_2296413_+	YejL family protein	NA	NA	NA	NA	NA
WP_029740953.1|2296432_2298193_+	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
WP_054829880.1|2298447_2298768_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	74.5	4.6e-42
WP_032623296.1|2298767_2299007_-	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	96.2	2.7e-39
WP_020690100.1|2299107_2299374_+	DinI family protein	NA	K7PKR6	Enterobacteria_phage	94.3	1.0e-39
WP_059347057.1|2299427_2299976_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	79.6	8.4e-76
WP_071886566.1|2300103_2300838_+	hypothetical protein	NA	K7P6M1	Enterobacteria_phage	60.7	1.9e-70
WP_081051433.1|2301028_2301922_+|tail	tail fiber domain-containing protein	tail	O64338	Escherichia_phage	66.2	1.4e-104
WP_059347061.1|2301983_2303285_-	hypothetical protein	NA	K7PH95	Enterobacterial_phage	76.7	2.1e-186
WP_054830174.1|2303411_2303774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048965316.1|2303738_2304380_-	hypothetical protein	NA	G8C7R6	Escherichia_phage	89.2	1.3e-112
WP_072268479.1|2304376_2304679_-	hypothetical protein	NA	G8C7R5	Escherichia_phage	70.0	2.1e-36
WP_059347062.1|2308292_2308910_-|tail	tail assembly protein	tail	M9NZA3	Enterobacteria_phage	99.0	2.0e-105
WP_059347063.1|2308902_2309622_-	C40 family peptidase	NA	K7PJY5	Enterobacterial_phage	98.7	1.2e-141
WP_032677934.1|2309624_2310362_-|tail	phage minor tail protein L	tail	M9NYX1	Enterobacteria_phage	99.6	3.6e-146
WP_001704112.1|2310417_2310756_-|tail	phage tail protein	tail	E4WL34	Enterobacteria_phage	100.0	2.3e-60
WP_059347064.1|2310752_2313890_-|tail	phage tail tape measure protein	tail	E4WL33	Enterobacteria_phage	95.6	0.0e+00
WP_071788861.1|2313873_2314188_-|tail	phage tail assembly protein T	tail	E4WL32	Enterobacteria_phage	97.1	6.8e-54
WP_059347065.1|2314196_2314628_-|tail	phage minor tail protein G	tail	M9NZD7	Enterobacteria_phage	92.3	1.1e-67
WP_023292730.1|2314638_2315382_-|tail	phage tail protein	tail	K7PKX6	Enterobacterial_phage	99.6	4.6e-133
WP_054830175.1|2315389_2315788_-|tail	phage tail protein	tail	E4WL29	Enterobacteria_phage	97.7	3.2e-69
WP_023292731.1|2315784_2316369_-|tail	phage tail protein	tail	M9NZH5	Enterobacteria_phage	100.0	1.2e-99
WP_048029717.1|2316378_2316732_-|tail	tail attachment protein	tail	E4WL27	Enterobacteria_phage	94.0	5.4e-60
WP_054830176.1|2316743_2317157_-	DNA-packaging protein	NA	K7PM13	Enterobacteria_phage	65.0	1.9e-24
WP_023292734.1|2317202_2318228_-|capsid	major capsid protein	capsid	K7PGW9	Enterobacteria_phage	95.9	2.2e-186
WP_039025130.1|2318283_2318616_-|head	head decoration protein	head	E4WL24	Enterobacteria_phage	94.5	2.7e-53
WP_059347066.1|2318625_2319969_-	S49 family peptidase	NA	O64320	Escherichia_phage	93.5	5.8e-203
WP_059347067.1|2319949_2321539_-|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	91.7	4.5e-287
WP_023292738.1|2321535_2321742_-	gpW family protein	NA	E4WL20	Enterobacteria_phage	95.5	9.3e-28
WP_059347068.1|2321741_2323664_-|terminase	phage terminase large subunit family protein	terminase	K7PGW7	Enterobacteria_phage	93.6	0.0e+00
WP_023292740.1|2323638_2324184_-|terminase	terminase small subunit	terminase	K7P7G0	Enterobacteria_phage	93.9	4.1e-91
WP_046886056.1|2324587_2325127_+	YfbU family protein	NA	NA	NA	NA	NA
WP_059347069.1|2325178_2325709_-	hypothetical protein	NA	K7PHH7	Enterobacteria_phage	90.0	7.1e-80
WP_059347070.1|2325698_2326241_-	lysozyme	NA	K7PM52	Enterobacteria_phage	90.6	5.0e-89
WP_048338962.1|2326240_2326543_-	hypothetical protein	NA	O64361	Escherichia_phage	68.3	1.4e-32
WP_054830177.1|2326611_2327664_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	81.7	6.8e-175
WP_001310555.1|2328082_2329099_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_048993919.1|2329188_2329668_+	hypothetical protein	NA	F1C594	Cronobacter_phage	55.7	1.0e-40
WP_048993917.1|2329790_2330483_-	antitermination protein	NA	NA	NA	NA	NA
WP_057072061.1|2330504_2331566_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	56.0	2.4e-111
WP_016247390.1|2331562_2332255_-	phage regulatory protein/antirepressor Ant	NA	G0ZND1	Cronobacter_phage	55.1	5.3e-59
WP_054829656.1|2332269_2334207_-	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	53.5	1.5e-199
WP_059347831.1|2334199_2335537_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	50.8	6.3e-117
WP_020690688.1|2335542_2336406_-	conserved phage C-terminal domain-containing protein	NA	U5P0A0	Shigella_phage	83.9	5.8e-39
WP_054829657.1|2336395_2336575_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	69.2	1.1e-13
WP_023294083.1|2336747_2337296_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	68.1	8.4e-68
WP_020324431.1|2337318_2337534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001515607.1|2337633_2338260_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	1.2e-46
WP_016247397.1|2339064_2339436_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	90.2	2.2e-56
WP_054829658.1|2339489_2340320_+	DUF2303 family protein	NA	Q8HAA2	Salmonella_phage	77.2	4.3e-116
WP_059347071.1|2340455_2340995_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	75.4	2.0e-74
WP_016247400.1|2340982_2341180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059347072.1|2341176_2341617_+	hypothetical protein	NA	G9L6B1	Escherichia_phage	40.7	1.9e-06
WP_020690681.1|2341613_2341835_+	TraR/DksA family transcriptional regulator	NA	A0A0P0ZCX5	Stx2-converting_phage	58.0	5.7e-15
WP_016247403.1|2341841_2342054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054829661.1|2342050_2342395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054829663.1|2342935_2343157_+	hypothetical protein	NA	K7PKM4	Enterobacterial_phage	58.1	4.5e-12
WP_048029701.1|2343137_2343710_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	83.0	6.1e-93
WP_054829678.1|2343754_2343964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059347073.1|2343966_2345154_+|integrase	phage integrase SAM-like domain-containing protein	integrase	A0A2D1GN00	Marinobacter_phage	30.0	3.0e-33
WP_059347074.1|2345371_2346559_-	MFS transporter	NA	NA	NA	NA	NA
WP_054829664.1|2346697_2346958_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_054829665.1|2347167_2347671_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
2352446:2352478	attR	CCCTCTCCCTGTGGGAGAGGGTTAGGGTGAGGG	NA	NA	NA	NA
>prophage 7
NZ_CP011863	Enterobacter asburiae strain ATCC 35953 chromosome, complete genome	4713742	2936029	2998970	4713742	protease,coat,transposase	Escherichia_phage(28.57%)	58	NA	NA
WP_029741339.1|2936029_2936524_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_059347209.1|2936526_2937303_+	molecular chaperone	NA	NA	NA	NA	NA
WP_059347210.1|2937283_2939512_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_059347211.1|2939502_2940459_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_059347212.1|2940585_2941326_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_059347213.1|2941327_2941801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054830231.1|2942430_2944095_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.2	7.6e-11
WP_054830230.1|2944178_2944619_-	homoprotocatechuate degradation operon regulator HpaR	NA	NA	NA	NA	NA
WP_059347214.1|2944889_2946167_+	4-hydroxyphenylacetate degradation bifunctional isomerase/decarboxylase	NA	NA	NA	NA	NA
WP_059347215.1|2946163_2947630_+	5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_048978973.1|2947632_2948484_+	3,4-dihydroxyphenylacetate 2,3-dioxygenase	NA	NA	NA	NA	NA
WP_059347216.1|2948493_2948874_+	5-carboxymethyl-2-hydroxymuconate Delta-isomerase	NA	NA	NA	NA	NA
WP_059347217.1|2948939_2949743_+	2-oxo-hepta-3-ene-1,7-dioic acid hydratase	NA	NA	NA	NA	NA
WP_059347218.1|2949752_2950550_+	4-hydroxy-2-oxoheptanedioate aldolase	NA	NA	NA	NA	NA
WP_059347219.1|2950571_2951924_+	4-hydroxyphenylacetate permease	NA	NA	NA	NA	NA
WP_059347220.1|2951895_2952828_+	4-hydroxyphenylacetate catabolism regulatory protein HpaA	NA	NA	NA	NA	NA
WP_059347221.1|2953005_2954568_+	4-hydroxyphenylacetate 3-monooxygenase, oxygenase component	NA	NA	NA	NA	NA
WP_059347222.1|2954585_2955098_+	4-hydroxyphenylacetate 3-monooxygenase reductase subunit	NA	NA	NA	NA	NA
WP_059347223.1|2955278_2956196_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_023334384.1|2956387_2958541_+	carbon starvation protein A	NA	NA	NA	NA	NA
WP_003856610.1|2958641_2958845_+	YbdD/YjiX family protein	NA	NA	NA	NA	NA
WP_054830196.1|2958855_2959809_+	GTPase	NA	NA	NA	NA	NA
WP_059347224.1|2960285_2961644_-	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_023310269.1|2962055_2962601_+	porin	NA	NA	NA	NA	NA
WP_028015390.1|2962600_2962921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059347225.1|2962969_2964340_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_059347226.1|2964491_2965235_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_054830193.1|2965282_2965936_+	LysE family translocator	NA	NA	NA	NA	NA
WP_059347227.1|2965939_2967211_+	DUF445 domain-containing protein	NA	NA	NA	NA	NA
WP_059347837.1|2967207_2968284_-	DUF2955 domain-containing protein	NA	NA	NA	NA	NA
WP_155616781.1|2968288_2969356_-	biotin/lipoyl-binding protein	NA	NA	NA	NA	NA
WP_047646559.1|2969352_2969823_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_059347229.1|2969971_2970667_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_047646557.1|2970641_2971037_-	amino acid-binding protein	NA	NA	NA	NA	NA
WP_033144543.1|2971029_2971353_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_054830192.1|2971505_2972921_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_059347230.1|2973021_2973924_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_054830342.1|2973910_2974390_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_059347231.1|2974491_2975880_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_023334364.1|2975964_2976126_-	DUF1127 domain-containing protein	NA	NA	NA	NA	NA
WP_047646554.1|2976302_2977721_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_054830341.1|2977782_2978904_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_024909504.1|2979039_2979642_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	G3M9Z8	Bacillus_virus	39.8	4.2e-28
WP_054830340.1|2979730_2980117_+	VOC family protein	NA	NA	NA	NA	NA
WP_054830339.1|2980302_2980920_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_059347232.1|2980923_2986506_-	AAA family ATPase	NA	Q67624	IC4_retrovirus	29.0	1.5e-10
WP_054830396.1|2986515_2986896_-	response regulator	NA	NA	NA	NA	NA
WP_010427264.1|2986919_2987180_-	XapX domain-containing protein	NA	NA	NA	NA	NA
WP_029739325.1|2987176_2987398_-	DUF1427 family protein	NA	NA	NA	NA	NA
WP_059347233.1|2987459_2988146_-	hydrolase	NA	NA	NA	NA	NA
WP_059347234.1|2988364_2990236_+	amidohydrolase	NA	NA	NA	NA	NA
WP_032642739.1|2990235_2990643_+	DoxX family protein	NA	NA	NA	NA	NA
WP_059347235.1|2990639_2992259_+	MFS transporter	NA	NA	NA	NA	NA
WP_059347236.1|2992289_2993111_+	alpha/beta hydrolase	NA	A0A249XMC3	Mycobacterium_phage	28.8	3.3e-15
WP_059347237.1|2993236_2993899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087451024.1|2995313_2996434_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_001310555.1|2996702_2997719_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_001310555.1|2997953_2998970_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
>prophage 8
NZ_CP011863	Enterobacter asburiae strain ATCC 35953 chromosome, complete genome	4713742	4134437	4196777	4713742	tail,plate,holin,tRNA	Erwinia_phage(35.29%)	64	NA	NA
WP_023333540.1|4134437_4134830_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_008503141.1|4134831_4135137_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_029739662.1|4135168_4135537_-	DUF1090 domain-containing protein	NA	NA	NA	NA	NA
WP_023309290.1|4135679_4136063_-	EnvZ/OmpR regulon moderator MzrA	NA	NA	NA	NA	NA
WP_023309289.1|4136065_4136728_-	DedA family protein	NA	NA	NA	NA	NA
WP_023309288.1|4137072_4137849_-	transcriptional regulator ExuR	NA	NA	NA	NA	NA
WP_047646407.1|4137964_4139263_-	MFS transporter	NA	NA	NA	NA	NA
WP_059347595.1|4139738_4141151_+	glucuronate isomerase	NA	NA	NA	NA	NA
WP_054830199.1|4141168_4142656_+	altronate dehydratase	NA	NA	NA	NA	NA
WP_059347598.1|4142742_4143984_-	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_029739669.1|4144256_4145225_-	TerC family protein	NA	A0A291LBC5	Escherichia_phage	32.8	1.5e-35
WP_059347600.1|4145475_4146474_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_023333531.1|4146544_4147048_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_059347601.1|4147131_4148268_+	23S rRNA (guanine(1835)-N(2))-methyltransferase RlmG	NA	NA	NA	NA	NA
WP_059347603.1|4148386_4150408_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_059347605.1|4150555_4152151_-	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_054830200.1|4152185_4153154_-	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_059347607.1|4153369_4154857_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.2	6.8e-19
WP_054830201.1|4154853_4155885_+	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_059347608.1|4155885_4156863_+	autoinducer 2 import system permease LsrD	NA	NA	NA	NA	NA
WP_059347610.1|4156864_4157866_+	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_029741387.1|4157877_4158765_+	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_023333521.1|4158761_4159055_+	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_059347855.1|4159110_4159959_-	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_054830233.1|4162266_4163643_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	27.8	1.0e-32
WP_059347612.1|4164078_4165599_+	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	48.5	8.4e-33
WP_059347614.1|4165935_4167495_+	MCP four helix bundle domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.2	1.4e-11
WP_054830234.1|4167491_4167986_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_059347616.1|4168133_4168898_+	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_054830235.1|4168898_4170068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059347856.1|4170626_4171004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054830236.1|4171000_4171348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054830237.1|4171403_4171979_-	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	62.8	2.8e-66
WP_029741399.1|4172206_4172545_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	72.1	8.6e-39
WP_054830238.1|4172613_4172841_+	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	64.0	9.9e-15
WP_059347618.1|4172840_4173062_+	TraR/DksA family transcriptional regulator	NA	A0A0M4S5Q7	Salmonella_phage	75.0	2.1e-25
WP_059347620.1|4173063_4175253_+	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	73.2	0.0e+00
WP_029741403.1|4175362_4175803_+	DinI-like family protein	NA	A0A218M4I0	Erwinia_phage	75.9	1.6e-53
WP_023309248.1|4175982_4176186_+|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	71.6	4.0e-23
WP_029741404.1|4176176_4176398_+	primosomal protein	NA	A0A218M4L5	Erwinia_phage	75.0	4.6e-25
WP_048981243.1|4176381_4176891_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	82.1	3.3e-74
WP_059347621.1|4176887_4177313_+	protein lysB	NA	A0A218M4K2	Erwinia_phage	59.0	5.2e-33
WP_054830239.1|4177272_4177446_+	hypothetical protein	NA	S4TNY4	Salmonella_phage	76.4	5.6e-18
WP_047646381.1|4177408_4177876_+|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	61.3	6.8e-50
WP_054830240.1|4177988_4178630_+|plate	phage baseplate assembly protein V	plate	S4TUB5	Salmonella_phage	76.5	1.1e-87
WP_081051451.1|4180479_4181433_+|tail	phage tail protein	tail	A0A2I8TVA9	Erwinia_phage	86.8	2.4e-86
WP_054830421.1|4181419_4181629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071886584.1|4181629_4182085_+|tail	tail fiber protein	tail	M1TAS6	Escherichia_phage	55.1	1.7e-37
WP_054830420.1|4182084_4182684_+|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	52.3	3.9e-50
WP_155616786.1|4182655_4183138_-|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	42.9	1.4e-21
WP_029741762.1|4183505_4184099_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	75.0	4.7e-80
WP_059347623.1|4184157_4185345_+|tail	phage tail sheath protein	tail	S4TRX2	Salmonella_phage	83.3	4.7e-188
WP_054830273.1|4185356_4185875_+|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	80.8	1.7e-78
WP_029741760.1|4185931_4186240_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	69.0	4.5e-26
WP_023616176.1|4186272_4186392_+|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	89.7	9.7e-14
WP_059347625.1|4186384_4188664_+|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	39.7	1.5e-129
WP_059347627.1|4188675_4189140_+|tail	phage tail protein	tail	O80317	Escherichia_phage	67.9	1.8e-55
WP_047646373.1|4189136_4190291_+	phage late control D family protein	NA	A0A0M5M5V5	Salmonella_phage	62.0	1.9e-130
WP_029741756.1|4190358_4190559_+	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	79.6	6.3e-21
WP_029741755.1|4190841_4191348_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_023309228.1|4191449_4193297_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_029741754.1|4193450_4195196_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	39.0	1.9e-76
WP_001144069.1|4195311_4195527_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_032650276.1|4195763_4196777_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.6	1.1e-108
>prophage 9
NZ_CP011863	Enterobacter asburiae strain ATCC 35953 chromosome, complete genome	4713742	4344005	4454677	4713742	holin,transposase,tRNA,tail,plate,integrase	Burkholderia_virus(28.85%)	111	4343954:4343990	4427932:4427968
4343954:4343990	attL	TGCCCTCACCCCGGCCCTCTCCCACAGGGAGAGGGAG	NA	NA	NA	NA
WP_054830214.1|4344005_4344986_-|tRNA	tRNA-modifying protein YgfZ	tRNA	NA	NA	NA	NA
WP_010435322.1|4345280_4345547_+	FAD assembly factor SdhE	NA	NA	NA	NA	NA
WP_021242050.1|4345527_4345938_+	protein YgfX	NA	NA	NA	NA	NA
WP_059347709.1|4345944_4346466_-	flavodoxin FldB	NA	NA	NA	NA	NA
WP_023309098.1|4346567_4347464_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.8	6.7e-30
WP_029740340.1|4347492_4348206_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_059347710.1|4348211_4349945_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.1	7.5e-62
WP_096151315.1|4350035_4351133_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	3.1e-05
WP_029740338.1|4351143_4352661_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	37.5	1.3e-86
WP_059347711.1|4352699_4353242_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_059347712.1|4353405_4354149_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A7K9	Microcystis_virus	34.9	6.4e-10
WP_059347713.1|4355445_4356072_+	recombinase family protein	NA	NA	NA	NA	NA
WP_059347714.1|4356363_4357164_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_153251291.1|4357355_4357727_+	hypothetical protein	NA	Q6QLL3	Human_immunodeficiency_virus	86.0	2.4e-13
WP_001310555.1|4357764_4358781_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_044157545.1|4359363_4360035_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_116799391.1|4361386_4362594_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.9	2.3e-102
WP_032637458.1|4363752_4364142_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	54.2	1.0e-30
WP_029464108.1|4364138_4364567_-	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	48.9	1.1e-25
WP_024153841.1|4364556_4364772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024153840.1|4364761_4364989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024153839.1|4364988_4365258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023229473.1|4365244_4365541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021553508.1|4365556_4365829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054830068.1|4365825_4366014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023214065.1|4366092_4366704_-	DUF3164 family protein	NA	A0A2D1GNM4	Pseudomonas_phage	68.5	9.4e-76
WP_059347717.1|4366964_4368131_-	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	60.6	6.3e-121
WP_059347718.1|4368141_4369911_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6QIE0	Burkholderia_phage	67.5	4.4e-227
WP_059347719.1|4369914_4370823_-	hypothetical protein	NA	A4JWN3	Burkholderia_virus	53.0	1.9e-72
WP_059347720.1|4370832_4371138_-	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	58.0	1.6e-23
WP_054830067.1|4371193_4371382_-	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	71.0	3.3e-16
WP_153251290.1|4371474_4371891_+	helix-turn-helix transcriptional regulator	NA	Q5ZQZ8	Pseudomonas_phage	51.6	4.5e-13
WP_054830066.1|4371904_4372441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054830065.1|4372464_4372899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054830064.1|4372937_4373708_-	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	66.5	1.1e-100
WP_054830063.1|4373951_4374518_+	DUF2441 domain-containing protein	NA	NA	NA	NA	NA
WP_071599358.1|4374438_4374675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023229458.1|4374893_4375244_+|holin	putative holin	holin	A4JWP3	Burkholderia_virus	53.9	6.9e-23
WP_054830061.1|4375246_4375975_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.2	1.1e-62
WP_054830060.1|4375994_4376609_+	hypothetical protein	NA	A0A0S4L1H0	Pseudomonas_phage	32.0	1.3e-08
WP_000175096.1|4376605_4376938_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	47.7	1.1e-17
WP_006122433.1|4376930_4377242_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	63.6	3.2e-32
WP_011410682.1|4377241_4377787_+	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	67.6	1.2e-58
WP_059347722.1|4377783_4379307_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.4	3.4e-183
WP_045621860.1|4379306_4380803_+	DUF935 domain-containing protein	NA	Q6QIC0	Burkholderia_phage	60.0	1.0e-171
WP_006122439.1|4381606_4382065_+	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	43.0	4.9e-29
WP_032637444.1|4382279_4383377_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	49.6	3.9e-96
WP_032637443.1|4383390_4384344_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	43.0	4.9e-63
WP_000537462.1|4384354_4384711_+	DUF2190 family protein	NA	NA	NA	NA	NA
WP_032637441.1|4384712_4385159_+	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	51.7	1.9e-33
WP_032637440.1|4385158_4385623_+	Gp37 family protein	NA	Q6QIB2	Burkholderia_phage	52.3	3.7e-40
WP_042836908.1|4385619_4385874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059347723.1|4385863_4387291_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A4JWK5	Burkholderia_virus	78.5	3.7e-216
WP_162837902.1|4387287_4387812_+|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	67.8	4.7e-68
WP_054830059.1|4387814_4388096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059347724.1|4388194_4388536_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_071886585.1|4388477_4388618_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_059347725.1|4388732_4391198_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	41.5	6.5e-168
WP_059347726.1|4393436_4393949_+|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	38.5	9.4e-21
WP_006122457.1|4394340_4395444_+|plate	baseplate J/gp47 family protein	plate	A4JWL6	Burkholderia_virus	53.5	7.1e-106
WP_032636409.1|4395436_4396015_+|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.3	9.8e-67
WP_054830437.1|4396853_4397282_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	46.1	3.7e-26
WP_054830438.1|4397262_4397688_-|tail	tail assembly chaperone	tail	F1BUP0	Erwinia_phage	55.0	7.3e-19
WP_059347727.1|4397707_4398172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054829540.1|4398161_4398743_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	72.1	7.6e-67
WP_054829539.1|4399139_4399481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167347080.1|4400655_4400979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167347081.1|4400921_4401311_-	hypothetical protein	NA	Q6GZ03	Mycoplasma_phage	54.1	9.1e-16
WP_071886588.1|4401267_4401765_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_059347729.1|4403606_4404695_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_047646296.1|4404863_4405565_-	response regulator	NA	NA	NA	NA	NA
WP_059347730.1|4405568_4407206_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_008499689.1|4407382_4407613_+	(4Fe-4S)-binding protein	NA	NA	NA	NA	NA
WP_008499687.1|4407623_4407896_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_059347731.1|4407923_4408535_-	LysE family translocator	NA	NA	NA	NA	NA
WP_047646293.1|4408650_4409121_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_033146458.1|4409158_4410388_-	transporter	NA	NA	NA	NA	NA
WP_054829537.1|4410507_4410969_-	multidrug/biocide efflux PACE transporter	NA	NA	NA	NA	NA
WP_059347732.1|4411074_4411941_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038417283.1|4412034_4413213_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_059347733.1|4413448_4414285_+	5-dehydro-4-deoxy-D-glucuronate isomerase	NA	NA	NA	NA	NA
WP_059347734.1|4414348_4415110_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	1.7e-18
WP_029741163.1|4415422_4416844_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	27.9	2.5e-26
WP_054829536.1|4417047_4418172_+	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_054829535.1|4418260_4418953_+	aspartate/glutamate racemase	NA	NA	NA	NA	NA
WP_047646287.1|4418947_4419874_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_047646286.1|4419995_4421258_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_029741168.1|4421227_4422265_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.1	3.5e-30
WP_059347861.1|4422494_4422971_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_023309052.1|4422931_4423948_-	HTH-type transcriptional regulator GalR	NA	NA	NA	NA	NA
WP_059347735.1|4424571_4426731_+	bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase	NA	A0A2H4PQU7	Staphylococcus_phage	28.1	3.4e-19
WP_045888656.1|4426723_4427917_+	lysophospholipid transporter LplT	NA	NA	NA	NA	NA
WP_038417288.1|4428010_4429051_-	NADP(H)-dependent aldo-keto reductase	NA	NA	NA	NA	NA
4427932:4427968	attR	TGCCCTCACCCCGGCCCTCTCCCACAGGGAGAGGGAG	NA	NA	NA	NA
WP_008499668.1|4429182_4429401_-	YgdI/YgdR family lipoprotein	NA	NA	NA	NA	NA
WP_059347736.1|4429529_4430222_-	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_013098553.1|4430905_4431436_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_023309047.1|4431448_4433695_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	24.7	1.7e-10
WP_023309046.1|4433901_4434777_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_014885081.1|4434783_4435578_+	thymidylate synthase	NA	R4IFY1	Cronobacter_phage	62.9	1.7e-117
WP_029740488.1|4435762_4436227_+	prepilin peptidase-dependent protein	NA	NA	NA	NA	NA
WP_029740489.1|4436217_4436778_+	prepilin peptidase-dependent protein	NA	NA	NA	NA	NA
WP_029740490.1|4436774_4437176_+	DUF2509 family protein	NA	NA	NA	NA	NA
WP_023309042.1|4437160_4437484_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_059347737.1|4437496_4440871_+	exodeoxyribonuclease V subunit gamma	NA	NA	NA	NA	NA
WP_059347738.1|4441011_4443879_+	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	24.8	1.3e-63
WP_059347739.1|4443875_4447418_+	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	21.4	5.6e-11
WP_059347740.1|4447414_4449235_+	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	27.7	2.0e-25
WP_023309037.1|4449269_4450601_-	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_029740496.1|4450828_4452082_+	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	28.0	8.0e-13
WP_023309035.1|4452697_4453795_+	murein transglycosylase A	NA	NA	NA	NA	NA
WP_045261323.1|4453870_4454677_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	34.3	6.5e-16
>prophage 10
NZ_CP011863	Enterobacter asburiae strain ATCC 35953 chromosome, complete genome	4713742	4689108	4703748	4713742	integrase	Bacteriophage(38.46%)	18	4688820:4688834	4703455:4703469
4688820:4688834	attL	ATAAACGCGCTAAAA	NA	NA	NA	NA
WP_008501877.1|4689108_4690212_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.9	7.7e-60
WP_059347788.1|4690223_4691477_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.4	1.8e-97
WP_059347789.1|4691817_4692990_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	49.7	2.3e-110
WP_024136027.1|4692986_4693163_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_059347790.1|4693171_4694572_-	DEAD/DEAH box helicase	NA	Q3LZN8	Bacteriophage	74.5	5.3e-215
WP_155616791.1|4694558_4695707_-	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	48.8	7.1e-101
WP_054829892.1|4695676_4695970_-	VRR-NUC domain-containing protein	NA	B6SD64	Bacteriophage	67.1	3.3e-26
WP_054829898.1|4695970_4696210_-	hypothetical protein	NA	A0A1V0E5L1	Salmonella_phage	87.0	5.0e-33
WP_054829893.1|4696202_4696421_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_054829894.1|4696431_4696635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054829895.1|4696631_4696934_-	hypothetical protein	NA	A0A0B4SK56	Proteus_phage	27.6	5.6e-05
WP_059347792.1|4696939_4699006_-	DNA polymerase	NA	Q775A3	Bordetella_phage	68.6	7.1e-277
WP_001619020.1|4699083_4699632_-	DUF2815 family protein	NA	Q775A5	Bordetella_phage	67.6	2.2e-68
WP_054829896.1|4699647_4700949_-	DUF2800 domain-containing protein	NA	B6SCX9	Bacteriophage	57.8	1.2e-139
WP_059347793.1|4700951_4701872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167347083.1|4701868_4702018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058645991.1|4702728_4703406_-	helix-turn-helix transcriptional regulator	NA	B6SCU0	Bacteriophage	49.5	2.2e-57
WP_054829897.1|4703547_4703748_+	transcriptional regulator	NA	K7RWG7	Bacteriophage	53.8	8.8e-07
4703455:4703469	attR	TTTTAGCGCGTTTAT	NA	NA	NA	NA
>prophage 1
NZ_CP011867	Enterobacter asburiae strain ATCC 35953 plasmid unnamed 4, complete sequence	16554	2186	12791	16554	plate,tail	Burkholderia_virus(45.45%)	13	NA	NA
WP_059347902.1|2186_3071_+|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	46.7	1.3e-54
WP_059347903.1|3067_3283_+|tail	tail protein X	tail	NA	NA	NA	NA
WP_059347904.1|3270_4440_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	49.4	3.5e-87
WP_059347726.1|4439_4952_+|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	38.5	9.4e-21
WP_054830057.1|5006_5354_+	GPW/gp25 family protein	NA	A4JWL5	Burkholderia_virus	62.4	1.7e-34
WP_006122457.1|5344_6448_+|plate	baseplate J/gp47 family protein	plate	A4JWL6	Burkholderia_virus	53.5	7.1e-106
WP_032636409.1|6440_7019_+|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.3	9.8e-67
WP_054830438.1|7907_8333_+|tail	tail assembly chaperone	tail	F1BUP0	Erwinia_phage	55.0	7.3e-19
WP_054830437.1|8313_8742_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	46.1	3.7e-26
WP_081051463.1|8744_9116_-	hypothetical protein	NA	F1BUP1	Erwinia_phage	46.7	7.3e-15
WP_054829540.1|9165_9747_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	72.1	7.6e-67
WP_044858680.1|10143_10500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023333294.1|11720_12791_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.0	4.1e-26
