The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012947	Xanthomonas oryzae pv. oryzae strain PXO83 chromosome, complete genome	5025428	7735	50018	5025428	transposase,protease	Ralstonia_phage(33.33%)	39	NA	NA
WP_011407164.1|7735_8572_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_044756151.1|8758_9565_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_011257013.1|9841_11035_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_173425345.1|11302_11857_+	TonB family protein	NA	NA	NA	NA	NA
WP_011257015.1|11941_12703_+	TonB-system energizer ExbB	NA	NA	NA	NA	NA
WP_010364790.1|12749_13172_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011257016.1|13175_13589_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011257017.1|13884_14652_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_019301610.1|14662_14932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257019.1|15006_16467_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_011257020.1|17113_18124_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	37.8	9.5e-49
WP_011257021.1|18395_19598_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_011407169.1|19739_21878_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	40.9	5.3e-65
WP_012443560.1|22088_22382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153296734.1|22413_22911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257024.1|23157_24138_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	55.8	1.6e-88
WP_011257025.1|24185_25352_-	FMN-dependent L-lactate dehydrogenase LldD	NA	NA	NA	NA	NA
WP_011257026.1|25498_26065_-	phosphatidylethanolamine N-methyltransferase family protein	NA	NA	NA	NA	NA
WP_011257028.1|27539_28757_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_011257029.1|29384_30407_-	sugar kinase	NA	NA	NA	NA	NA
WP_080493590.1|30987_32241_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_094187763.1|32314_33112_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_157724563.1|33099_34074_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_012443571.1|34958_35621_-	DUF938 domain-containing protein	NA	NA	NA	NA	NA
WP_044756160.1|35774_36569_-	EcsC family protein	NA	NA	NA	NA	NA
WP_027704023.1|36736_37210_+	SRPBCC domain-containing protein	NA	NA	NA	NA	NA
WP_041182545.1|39540_40497_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_044756163.1|40544_41456_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011257041.1|41942_42341_-	host attachment protein	NA	NA	NA	NA	NA
WP_044756164.1|42432_43125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027704036.1|43294_43765_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_011257044.1|43880_44057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407233.1|45231_45543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756166.1|45797_46745_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.4	4.3e-43
WP_044756167.1|46885_47944_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011257048.1|48082_48364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407230.1|48416_48677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125168735.1|48744_48954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012445831.1|49037_50018_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.5	3.7e-98
>prophage 2
NZ_CP012947	Xanthomonas oryzae pv. oryzae strain PXO83 chromosome, complete genome	5025428	85750	143096	5025428	transposase	Acidithiobacillus_phage(25.0%)	42	NA	NA
WP_044749647.1|85750_87127_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	5.4e-79
WP_041182539.1|87292_88846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257097.1|91059_91401_-	HPF/RaiA family ribosome-associated protein	NA	NA	NA	NA	NA
WP_041182843.1|91585_94144_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_011407204.1|94162_94423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703735.1|95252_97160_-	ABC transporter substrate-binding protein	NA	A0A0P0CRE2	Ostreococcus_lucimarinus_virus	28.7	1.9e-34
WP_011257102.1|97217_98159_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_041182540.1|98351_99716_+	glycoside hydrolase family 10 protein	NA	NA	NA	NA	NA
WP_011257104.1|99712_101341_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_027703733.1|101814_103398_+	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_044756187.1|103394_105629_+	1,4-alpha-glucan branching enzyme	NA	NA	NA	NA	NA
WP_011257107.1|105631_107389_+	malto-oligosyltrehalose trehalohydrolase	NA	NA	NA	NA	NA
WP_094187819.1|107445_109335_+	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
WP_027703731.1|109331_111941_+	malto-oligosyltrehalose synthase	NA	NA	NA	NA	NA
WP_011407199.1|111963_112149_+	DUF2934 domain-containing protein	NA	NA	NA	NA	NA
WP_011257110.1|112263_114426_+	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_027703730.1|114442_115075_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_075244499.1|115238_115736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407197.1|115876_116923_-	methylamine utilization protein	NA	NA	NA	NA	NA
WP_041182545.1|118318_119275_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_125168734.1|119327_119606_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_115862254.1|119602_120568_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_080256641.1|120665_121676_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_148648650.1|121656_124059_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_080256644.1|124174_124633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027704081.1|124632_124965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257122.1|124981_125242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_178380580.1|126061_126328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743401.1|126565_127975_+	FAD/NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_155296471.1|128009_128162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407187.1|128323_128755_+	VirK family protein	NA	NA	NA	NA	NA
WP_012443638.1|129029_129365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407184.1|129804_131094_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.2	2.1e-40
WP_012443641.1|131712_132693_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	55.0	1.0e-87
WP_012443642.1|133158_133482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109181928.1|134041_135007_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_044756190.1|136678_138055_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	56.9	8.3e-80
WP_129215536.1|138656_139364_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	22.6	2.6e-05
WP_070344074.1|139360_140632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128415443.1|140746_141652_-	HEAT repeat domain-containing protein	NA	NA	NA	NA	NA
WP_133264932.1|141655_142072_-	HEAT repeat domain-containing protein	NA	NA	NA	NA	NA
WP_044756191.1|142139_143096_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.9	6.2e-42
>prophage 3
NZ_CP012947	Xanthomonas oryzae pv. oryzae strain PXO83 chromosome, complete genome	5025428	175666	322757	5025428	transposase,tRNA,tail	Arthrobacter_phage(13.04%)	99	NA	NA
WP_115862255.1|175666_176632_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_027703863.1|181031_182090_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_103057315.1|182233_182329_-	xylosidase	NA	NA	NA	NA	NA
WP_041181912.1|182304_182832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042464354.1|183654_185838_-	1,4-alpha-glucan branching protein GlgB	NA	NA	NA	NA	NA
WP_011407267.1|185849_189200_-	maltose alpha-D-glucosyltransferase	NA	NA	NA	NA	NA
WP_011257178.1|189196_192313_-	DUF3416 domain-containing protein	NA	NA	NA	NA	NA
WP_011407587.1|194240_195275_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
WP_094187821.1|197972_198152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080494036.1|198154_198481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012443686.1|198550_198664_+	hemagglutinin repeat-containing protein	NA	NA	NA	NA	NA
WP_044756212.1|198746_200222_+|transposase	IS5-like element ISXoo5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	67.1	1.4e-101
WP_044749647.1|200360_201737_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	5.4e-79
WP_012443690.1|203349_204870_-	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_011257185.1|204886_205165_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_011257186.1|205354_205693_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_012443692.1|206305_208291_+	beta-N-acetylglucosaminidase domain-containing protein	NA	NA	NA	NA	NA
WP_041182297.1|208922_209885_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_011257188.1|210290_211103_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_011257189.1|211295_211907_+	PH domain-containing protein	NA	NA	NA	NA	NA
WP_011257190.1|212323_213181_-	polyamine aminopropyltransferase	NA	A0A1C9C533	Heterosigma_akashiwo_virus	31.5	2.9e-14
WP_012443696.1|213418_215305_+	arginine decarboxylase	NA	NA	NA	NA	NA
WP_044756215.1|217643_220367_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	30.2	6.3e-71
WP_059317514.1|220434_222588_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	28.2	2.0e-27
WP_044756216.1|222584_224276_+	DUF2875 family protein	NA	NA	NA	NA	NA
WP_012443704.1|224811_226716_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_075239321.1|226976_227156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756221.1|227289_227757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257199.1|227914_228874_+	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_044756223.1|228858_229476_+	YdcF family protein	NA	NA	NA	NA	NA
WP_011257200.1|229518_229938_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_012443706.1|230190_231096_-	lipid A hydroxylase LpxO	NA	S4VR59	Pandoravirus	39.5	2.6e-37
WP_011257202.1|231344_232229_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_011257203.1|232292_233075_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011407292.1|233119_233881_-	pimeloyl-ACP methyl ester esterase BioH	NA	NA	NA	NA	NA
WP_011257206.1|234044_234374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407293.1|234692_235784_+	DUF4380 domain-containing protein	NA	NA	NA	NA	NA
WP_011407294.1|235852_237451_+	glucan biosynthesis protein D	NA	NA	NA	NA	NA
WP_011407295.1|237615_238860_-	GAF domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_044756226.1|239311_239941_-	thymidine kinase	NA	A0A023W530	Serratia_phage	55.0	2.6e-52
WP_011257211.1|240147_242124_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	37.2	1.1e-112
WP_011407298.1|243511_244177_-	YceH family protein	NA	NA	NA	NA	NA
WP_044756232.1|244463_245474_+	5'-nucleotidase, lipoprotein e(P4) family	NA	NA	NA	NA	NA
WP_011257215.1|245470_246202_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_044756234.1|246555_248085_-	tryptophan 7-halogenase	NA	M4T1E3	Cyanophage	28.7	1.3e-46
WP_011407300.1|248194_251227_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_044756235.1|251525_254564_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011257219.1|254728_255781_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_075239519.1|255949_256195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407301.1|256193_257159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756236.1|257158_259822_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_044756238.1|260018_260999_+	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_008573820.1|261639_261843_-	YdcH family protein	NA	NA	NA	NA	NA
WP_082322966.1|263303_264488_-|transposase	IS256-like element IS1113 family transposase	transposase	A0A218MNI5	uncultured_virus	45.4	1.0e-41
WP_082322873.1|264538_265216_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_044756239.1|265212_265755_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_044756241.1|265751_266570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143690736.1|266566_266791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069970072.1|266855_267812_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	4.8e-42
WP_044756245.1|268075_268255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069970072.1|268641_269598_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	4.8e-42
WP_011409779.1|271697_272735_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_011409777.1|274428_275274_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	26.7	3.7e-06
WP_011260788.1|275433_276639_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_011409775.1|276691_277024_+	EF-hand domain-containing protein	NA	NA	NA	NA	NA
WP_011409774.1|277072_277810_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	31.1	1.5e-19
WP_027704185.1|277806_279279_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_044756247.1|279565_280747_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_011409772.1|280818_282102_+	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_012443732.1|282098_283085_+	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_011260781.1|283129_284407_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_011260780.1|284403_285024_-	helix-turn-helix transcriptional regulator	NA	A0A0K1LLP9	Caulobacter_phage	41.9	1.9e-07
WP_012443733.1|285166_288874_-	indolepyruvate ferredoxin oxidoreductase family protein	NA	NA	NA	NA	NA
WP_033013610.1|289068_289431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012443735.1|289527_289704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260776.1|289965_290883_+	AEC family transporter	NA	NA	NA	NA	NA
WP_011409768.1|291235_291868_+	ParA family protein	NA	A0A142F1W4	Mycobacterium_phage	36.6	1.6e-09
WP_027704183.1|291883_292360_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_011260773.1|292363_292936_+	YceI family protein	NA	NA	NA	NA	NA
WP_011260772.1|292932_294948_+	phospholipase D family protein	NA	NA	NA	NA	NA
WP_011260771.1|295246_295675_+	hotdog fold thioesterase	NA	NA	NA	NA	NA
WP_011409766.1|295794_296598_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_011260769.1|296657_297647_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_044756250.1|298060_300133_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011409764.1|300327_300939_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_011260766.1|302092_302899_-	META domain-containing protein	NA	NA	NA	NA	NA
WP_011260765.1|303035_303833_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_011260764.1|304054_305464_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_011260763.1|305741_306080_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_027704182.1|306102_307545_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	32.2	2.0e-31
WP_011260761.1|307815_308871_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_011409760.1|308863_310291_+	nitrogen regulation protein NR(I)	NA	NA	NA	NA	NA
WP_027704181.1|310789_311392_+	superoxide dismutase family protein	NA	I3XM75	Mamestra_brassicae_nuclear_polyhedrosis_virus	40.6	7.7e-14
WP_027704180.1|311462_312095_+	superoxide dismutase family protein	NA	M1ICI8	Paramecium_bursaria_Chlorella_virus	41.0	7.8e-17
WP_115862256.1|312377_313343_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011260755.1|313430_313967_-|tail	phage tail protein	tail	A0A0U4JYA4	Arthrobacter_phage	32.1	1.2e-10
WP_011260754.1|314025_314553_-|tail	phage tail protein	tail	A0A218M5J0	Arthrobacter_phage	33.1	1.2e-15
WP_011409756.1|314621_315167_-|tail	phage tail protein	tail	A0A0U4JXW2	Arthrobacter_phage	32.9	1.9e-11
WP_044756255.1|321521_322757_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP012947	Xanthomonas oryzae pv. oryzae strain PXO83 chromosome, complete genome	5025428	347798	447020	5025428	transposase,tRNA	Staphylococcus_prophage(12.5%)	59	NA	NA
WP_041182856.1|347798_348755_-|transposase	IS30-like element IS1112 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.3	6.9e-41
WP_109182069.1|348857_350177_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_094187713.1|350305_351103_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260727.1|351136_351817_-	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_012443767.1|351909_352986_+	ferredoxin reductase	NA	NA	NA	NA	NA
WP_011260725.1|352995_354117_+	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_113090107.1|354182_355172_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_010374782.1|356944_357121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187716.1|357996_358795_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260718.1|359211_360246_-	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_011409728.1|360277_361765_-	MFS transporter	NA	NA	NA	NA	NA
WP_044756270.1|361863_364797_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_012443772.1|365258_366560_+	MFS transporter	NA	NA	NA	NA	NA
WP_044756273.1|367976_368954_+	endo-1,4-beta-xylanase	NA	NA	NA	NA	NA
WP_044756275.1|368994_370413_+	glucuronate isomerase	NA	NA	NA	NA	NA
WP_012443777.1|370639_371695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260709.1|372672_374145_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	32.1	4.5e-47
WP_041182521.1|374367_377019_-	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_011260707.1|377084_378785_-	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_011409724.1|378784_380044_-	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	26.0	3.5e-40
WP_041182560.1|380055_382020_-	9-O-acetylesterase	NA	NA	NA	NA	NA
WP_011409722.1|382016_384212_-	alpha-glucuronidase	NA	NA	NA	NA	NA
WP_011409721.1|384387_385455_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_011259480.1|385680_387018_-	xylose isomerase	NA	NA	NA	NA	NA
WP_012443789.1|387621_388539_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	62.5	4.1e-83
WP_011260701.1|388602_389508_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	32.9	3.1e-43
WP_011409719.1|390134_390920_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_011409718.1|391190_391649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075240508.1|391729_392485_-	alpha/beta hydrolase	NA	G1DB77	Mycobacterium_phage	35.2	9.7e-06
WP_011409716.1|392582_393548_-	ferrochelatase	NA	NA	NA	NA	NA
WP_011409715.1|393702_394605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003484969.1|394677_394905_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_044756277.1|394920_395562_+	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_011260694.1|395558_396314_+	twin-arginine translocase subunit TatC	NA	NA	NA	NA	NA
WP_012443793.1|396465_397365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409712.1|397424_398177_-	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_109182038.1|398720_399519_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_059317415.1|399659_408443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260689.1|408836_410651_-	type II/IV secretion system protein	NA	NA	NA	NA	NA
WP_059317416.1|410740_411649_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_011260687.1|411938_414176_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_044756282.1|414175_415777_+	sulfotransferase family protein	NA	NA	NA	NA	NA
WP_171970771.1|416029_418729_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	36.2	4.1e-147
WP_011409702.1|420293_421388_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_011409701.1|421466_422129_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_044756284.1|422345_423071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260681.1|423169_424483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260680.1|424597_425923_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_011260679.1|425984_426371_+	MerC family mercury resistance protein	NA	NA	NA	NA	NA
WP_044756287.1|426461_428180_-	ExeM/NucH family extracellular endonuclease	NA	NA	NA	NA	NA
WP_011409699.1|428451_428970_-	cytochrome c5 family protein	NA	NA	NA	NA	NA
WP_075239745.1|430088_430400_+	DUF3649 domain-containing protein	NA	NA	NA	NA	NA
WP_044756291.1|432024_432366_+	DUF3325 domain-containing protein	NA	NA	NA	NA	NA
WP_011409694.1|432927_433548_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011260670.1|433676_434840_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_011260669.1|434850_436461_+	methylcrotonoyl-CoA carboxylase	NA	A0A1B2ITV7	Pike_perch_iridovirus	51.5	1.1e-19
WP_011260668.1|436703_438731_+	acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha	NA	NA	NA	NA	NA
WP_011260667.1|438830_440915_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_133264490.1|445700_447020_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP012947	Xanthomonas oryzae pv. oryzae strain PXO83 chromosome, complete genome	5025428	568392	704599	5025428	transposase,tRNA	Ralstonia_phage(17.65%)	103	NA	NA
WP_044749647.1|568392_569769_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	5.4e-79
WP_044756333.1|571410_571710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409617.1|572589_572880_-	DUF2782 domain-containing protein	NA	NA	NA	NA	NA
WP_044756337.1|572956_575758_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	30.4	2.4e-65
WP_011260560.1|576705_577605_-	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_011409614.1|578731_579874_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.8	5.3e-96
WP_044756340.1|583097_584936_-	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_011409612.1|585110_585377_+	proteinase inhibitor	NA	NA	NA	NA	NA
WP_011409611.1|585402_585948_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_012443910.1|586419_587727_+	MFS transporter	NA	NA	NA	NA	NA
WP_011409609.1|587865_589125_+	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
WP_027703952.1|589553_590087_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_044756341.1|590097_591474_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	8.6e-77
WP_011260548.1|591708_591867_-	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
WP_012443914.1|591931_592942_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A0E3FNQ3	Synechococcus_phage	32.2	4.5e-14
WP_011260546.1|593170_594841_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_011409606.1|595159_595543_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_011260544.1|595764_596667_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_082322967.1|596663_599159_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_011260542.1|599166_600798_-	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	37.5	1.7e-63
WP_011260541.1|600794_601958_-	Fic family protein	NA	NA	NA	NA	NA
WP_011260540.1|602029_603046_-	3-oxoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_010370565.1|603147_603468_-	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_044756345.1|603853_604315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756347.1|604341_604818_+|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_011260537.1|605159_606383_-	MFS transporter	NA	NA	NA	NA	NA
WP_011260536.1|606487_607099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409603.1|607200_607950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756348.1|608140_609487_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_044756350.1|609471_610914_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_173425346.1|610963_612673_-	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_044756353.1|613049_613646_+	Ax21 family protein	NA	NA	NA	NA	NA
WP_044756355.1|613968_614994_-	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_044756356.1|615009_615525_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_011260528.1|615634_616069_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_044756357.1|616144_616567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703675.1|616595_617066_-	YiiD C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_027703859.1|619237_620605_+	VOC family protein	NA	NA	NA	NA	NA
WP_011409597.1|620894_624035_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_011260521.1|624168_627417_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_012443931.1|627509_628754_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011409596.1|629013_630330_+	amidohydrolase	NA	NA	NA	NA	NA
WP_011260517.1|631088_631904_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	35.8	7.4e-36
WP_082322968.1|632371_633556_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	2.9e-41
WP_044756360.1|633697_634933_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011407513.1|635001_635391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182545.1|635779_636736_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_109181928.1|636771_637737_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011407516.1|638975_639698_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.6	1.2e-16
WP_027703875.1|639708_641145_+	DUF3526 domain-containing protein	NA	NA	NA	NA	NA
WP_059317422.1|641144_642419_+	DUF3526 domain-containing protein	NA	NA	NA	NA	NA
WP_011407519.1|642508_644650_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_011407520.1|644734_645400_-	DUF2894 domain-containing protein	NA	NA	NA	NA	NA
WP_011257531.1|645396_646071_-	OmpA family protein	NA	NA	NA	NA	NA
WP_027703874.1|646067_648725_-	DUF802 domain-containing protein	NA	NA	NA	NA	NA
WP_012443985.1|648735_649473_-	DUF3348 domain-containing protein	NA	NA	NA	NA	NA
WP_011257534.1|649811_650024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257535.1|650479_650701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148648651.1|651485_652805_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011260472.1|653056_654805_-	DNA primase	NA	A0A1S5RF71	Helicobacter_phage	34.5	4.2e-44
WP_012443989.1|654894_655857_-	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_011409564.1|658150_658597_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	45.2	1.0e-23
WP_002808376.1|658904_659120_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_011260469.1|659399_660464_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	57.1	8.6e-101
WP_011409563.1|660542_660899_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_011260467.1|661126_663298_+	glycoside hydrolase family 3 C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_109181928.1|663960_664926_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_044756360.1|665441_666677_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_044756364.1|667093_668056_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_041182297.1|668835_669798_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_041182296.1|670793_671972_-	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
WP_041182719.1|672138_673095_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.8	3.7e-42
WP_011260461.1|673204_673639_+	membrane protein	NA	NA	NA	NA	NA
WP_011260459.1|674199_674481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027704068.1|675506_676823_-	amino acid permease	NA	NA	NA	NA	NA
WP_011260456.1|676819_677596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182294.1|678272_679235_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_094187728.1|679454_680252_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_027703925.1|680407_681505_-	dipeptide epimerase	NA	NA	NA	NA	NA
WP_012444005.1|681501_682914_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_044756368.1|683137_683944_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_011258802.1|684006_684975_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_148648652.1|685187_686507_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_012444006.1|686673_687420_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_011260450.1|687726_687924_+	CPXCG motif-containing cysteine-rich protein	NA	NA	NA	NA	NA
WP_011260449.1|688134_688512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409547.1|688737_689079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182719.1|689191_690148_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.8	3.7e-42
WP_173425347.1|690376_690784_+	EF-hand domain-containing protein	NA	NA	NA	NA	NA
WP_011260446.1|690821_691574_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_011258188.1|691699_692668_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011409543.1|692871_693447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042465763.1|693571_694189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148648653.1|694231_695029_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260442.1|695037_695847_-	glycosyltransferase family 25 protein	NA	NA	NA	NA	NA
WP_012444011.1|696022_696826_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_027703938.1|696929_697907_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_011260439.1|697903_699169_+	porphyrin biosynthesis protein	NA	NA	NA	NA	NA
WP_011409538.1|699594_700119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703939.1|700248_701544_-	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_027703940.1|701633_702518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260435.1|702720_703101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182581.1|703633_704599_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP012947	Xanthomonas oryzae pv. oryzae strain PXO83 chromosome, complete genome	5025428	779562	840065	5025428	transposase,protease	Organic_Lake_phycodnavirus(28.57%)	45	NA	NA
WP_094187781.1|779562_780360_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260378.1|780540_782190_+	M28 family peptidase	NA	NA	NA	NA	NA
WP_033013308.1|783993_785931_+	glucans biosynthesis glucosyltransferase MdoH	NA	NA	NA	NA	NA
WP_044756406.1|786082_786751_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011260375.1|786755_787808_+	histidine kinase	NA	Q9EYF3	Enterobacteria_phage	33.6	1.8e-18
WP_011409485.1|787838_788576_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_044756408.1|788606_789521_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_011260372.1|790071_790872_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_011260371.1|791430_792396_+	YafY family transcriptional regulator	NA	NA	NA	NA	NA
WP_011260370.1|792504_793074_-	lipocalin family protein	NA	NA	NA	NA	NA
WP_011409482.1|793461_793773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409481.1|793840_795934_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_011409480.1|796016_796448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409479.1|796773_797958_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_027703683.1|798115_800251_+	oligopeptidase B	NA	F2Y2Z7	Organic_Lake_phycodnavirus	26.1	2.1e-29
WP_044757316.1|800594_800993_+	YbaN family protein	NA	NA	NA	NA	NA
WP_044756411.1|801050_801287_+	lipoprotein	NA	NA	NA	NA	NA
WP_011260363.1|801276_802131_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_011409476.1|802127_802799_+	DUF484 family protein	NA	NA	NA	NA	NA
WP_044757318.1|803004_803922_+	tyrosine recombinase XerC	NA	A0A142F2H8	Mycobacterium_phage	28.1	2.2e-12
WP_011260360.1|804437_804989_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_011260359.1|805148_806516_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A2H5BJT2	Erwinia_phage	29.1	6.2e-43
WP_011260358.1|806689_807313_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_011409473.1|807612_808332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444089.1|808503_810516_-	M1 family metallopeptidase	NA	NA	NA	NA	NA
WP_011409471.1|810637_811528_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_011409470.1|811700_812462_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_011260353.1|814206_815283_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_027703680.1|816533_817034_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011260350.1|817030_817486_+	nucleoside deaminase	NA	NA	NA	NA	NA
WP_094187721.1|818626_819425_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257031.1|819480_820449_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_044756415.1|820689_821622_-	carbohydrate kinase family protein	NA	NA	NA	NA	NA
WP_012444096.1|821898_822945_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	21.2	4.6e-06
WP_044756417.1|823117_824464_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_044756419.1|824460_824946_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_012444099.1|824949_827010_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_011260340.1|827006_828125_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_012444101.1|828886_829873_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_082322882.1|829932_831417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756423.1|831413_832493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075242513.1|833446_833932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012444102.1|833928_835008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260337.1|834983_837140_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_044756425.1|838688_840065_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	63.2	1.9e-79
>prophage 7
NZ_CP012947	Xanthomonas oryzae pv. oryzae strain PXO83 chromosome, complete genome	5025428	871706	925246	5025428	transposase	Herpes_simplex_virus(20.0%)	34	NA	NA
WP_044756431.1|871706_872942_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011260307.1|873673_876364_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_076659517.1|876514_877048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076659519.1|877132_879412_+	DUF4982 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	28.6	5.5e-20
WP_011409433.1|881979_883146_+	DUF1624 domain-containing protein	NA	NA	NA	NA	NA
WP_012444126.1|883405_884128_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_027703724.1|884172_885450_+	sugar MFS transporter	NA	NA	NA	NA	NA
WP_012444129.1|885490_886558_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_011260300.1|886564_887593_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_044756434.1|887595_888750_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_044756435.1|889169_889775_-	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
WP_011260297.1|889771_891025_-	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
WP_011409429.1|891026_892925_-	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
WP_011409428.1|892926_894969_-	poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA	NA	NA	NA	NA	NA
WP_012444134.1|895594_895825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109182013.1|896286_897252_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_059317516.1|902856_904089_-	multifunctional CCA addition/repair protein	NA	K4IEX3	Salmonella_phage	41.7	1.2e-72
WP_144408318.1|904653_904998_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_094187777.1|905735_906533_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_094187731.1|906587_907385_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012444143.1|908317_908584_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_041182545.1|909227_910184_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_044756446.1|910396_912970_-	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_011409419.1|913092_914082_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	7.5e-99
WP_011409416.1|916010_916748_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_011260284.1|916797_917613_-	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_011409415.1|917704_918355_-	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_044756449.1|918448_919246_-	cytochrome c4	NA	NA	NA	NA	NA
WP_024712536.1|919390_920014_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_012444150.1|920108_920804_-	VIT family protein	NA	NA	NA	NA	NA
WP_012444151.1|921019_922384_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_075239687.1|922570_923209_-	histidine kinase	NA	W8CYF6	Bacillus_phage	23.4	1.9e-10
WP_075239943.1|923213_923477_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_082341201.1|923506_925246_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP012947	Xanthomonas oryzae pv. oryzae strain PXO83 chromosome, complete genome	5025428	1037350	1103664	5025428	transposase,tRNA	Tupanvirus(15.38%)	59	NA	NA
WP_094187728.1|1037350_1038149_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260188.1|1038349_1038703_-	DMT family protein	NA	NA	NA	NA	NA
WP_044756474.1|1039667_1040507_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.6	2.6e-28
WP_027704204.1|1041598_1042516_-	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_044756475.1|1042829_1045313_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_044756477.1|1045309_1045909_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	36.7	2.3e-26
WP_011260184.1|1046018_1046687_+	arylesterase	NA	NA	NA	NA	NA
WP_002811889.1|1046778_1047492_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.6	2.5e-27
WP_011409346.1|1047634_1048906_+	HAMP domain-containing histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	27.2	1.3e-10
WP_044756480.1|1049479_1050181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409344.1|1050363_1050744_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_011409343.1|1050839_1051478_+	LemA family protein	NA	A0A0C5K8T5	Enterococcus_phage	25.4	2.5e-07
WP_044756482.1|1051815_1052706_+	TPM domain-containing protein	NA	NA	NA	NA	NA
WP_011260174.1|1052705_1053197_+	TPM domain-containing protein	NA	NA	NA	NA	NA
WP_011260173.1|1053251_1054142_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_011260172.1|1054138_1054933_+	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	67.8	3.0e-106
WP_027704106.1|1054999_1055287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260171.1|1055283_1055778_+	dihydrofolate reductase	NA	A0A1B2IBQ4	Erwinia_phage	46.9	3.0e-24
WP_011260170.1|1055831_1056788_-	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	S4TNS0	Salmonella_phage	25.3	1.3e-07
WP_011260169.1|1056816_1057200_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_011260168.1|1057236_1058025_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_011409339.1|1058281_1059253_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_011409338.1|1059273_1060665_-	chaperone SurA	NA	NA	NA	NA	NA
WP_011409337.1|1060661_1063103_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_011409336.1|1063230_1064139_-	histone deacetylase family protein	NA	A0A2K9L2T7	Tupanvirus	30.8	3.4e-37
WP_011260163.1|1064176_1064734_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_011409335.1|1064737_1065316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409334.1|1065614_1066823_+	2-octaprenyl-6-methoxyphenyl hydroxylase	NA	NA	NA	NA	NA
WP_011409333.1|1066819_1068001_+	UbiH/UbiF family hydroxylase	NA	NA	NA	NA	NA
WP_011409332.1|1068128_1068941_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_109182116.1|1069577_1070543_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011409329.1|1071626_1072523_+	gallate dioxygenase	NA	NA	NA	NA	NA
WP_011409327.1|1072959_1073961_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_044756484.1|1074145_1075624_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	27.8	1.4e-40
WP_011409325.1|1075826_1077296_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_011409324.1|1077379_1078207_-	p-hydroxycinnamoyl CoA hydratase/lyase	NA	NA	NA	NA	NA
WP_011260149.1|1078252_1078726_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011409323.1|1078853_1079261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703838.1|1079460_1080183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409321.1|1080265_1081171_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_012444247.1|1081365_1082475_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_011409319.1|1082796_1083840_-	23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM	NA	NA	NA	NA	NA
WP_011409318.1|1083876_1084437_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_011409317.1|1084436_1084847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103057260.1|1085203_1085905_-	DMT family transporter	NA	NA	NA	NA	NA
WP_157724585.1|1087360_1087564_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_059317428.1|1089243_1089429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260138.1|1089621_1091361_-|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	54.8	9.9e-179
WP_012444256.1|1091765_1092407_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_012444257.1|1092408_1092645_+	DUF2007 domain-containing protein	NA	NA	NA	NA	NA
WP_011409313.1|1092759_1093224_-	response regulator	NA	NA	NA	NA	NA
WP_011260134.1|1093220_1094051_-	response regulator	NA	A0A2K9L5I4	Tupanvirus	38.5	3.4e-12
WP_094187708.1|1094047_1094846_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_094187801.1|1094899_1095698_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_044756485.1|1096817_1097525_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_059317429.1|1098045_1099260_+|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.7	3.1e-54
WP_011409288.1|1099620_1100271_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_011260092.1|1100686_1101265_-	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_109182002.1|1102698_1103664_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP012947	Xanthomonas oryzae pv. oryzae strain PXO83 chromosome, complete genome	5025428	1190565	1201392	5025428	transposase	Burkholderia_phage(28.57%)	8	NA	NA
WP_082322974.1|1190565_1191522_+|transposase	IS30-like element IS1112 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.4	3.1e-41
WP_171970781.1|1192922_1193990_-	DUF3396 domain-containing protein	NA	E5E3X8	Burkholderia_phage	38.2	1.3e-61
WP_044756504.1|1194004_1195075_-	DUF3396 domain-containing protein	NA	E5E3X8	Burkholderia_phage	36.6	9.7e-60
WP_011260011.1|1195082_1195778_-	VRR-NUC domain-containing protein	NA	Q8W6S1	Burkholderia_virus	46.1	2.8e-36
WP_011260010.1|1195774_1196224_-	hypothetical protein	NA	A4JWV5	Burkholderia_virus	34.1	3.3e-09
WP_044757335.1|1196553_1199508_-	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	50.1	8.1e-258
WP_027703308.1|1199975_1200158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465718.1|1200588_1201392_+	sulfotransferase	NA	M4QPS9	Synechococcus_phage	27.7	9.0e-26
>prophage 10
NZ_CP012947	Xanthomonas oryzae pv. oryzae strain PXO83 chromosome, complete genome	5025428	1265764	1307752	5025428	transposase,plate	Acidithiobacillus_phage(50.0%)	28	NA	NA
WP_094187763.1|1265764_1266562_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_044757342.1|1267152_1267701_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_044756529.1|1267700_1269932_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_044749647.1|1270147_1271524_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	5.4e-79
WP_094187774.1|1273088_1274191_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.9	4.5e-44
WP_153296765.1|1274281_1275010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756533.1|1275006_1278048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756534.1|1278072_1280610_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_173425335.1|1280620_1281412_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_059317433.1|1282274_1283354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082341202.1|1283350_1284829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082341203.1|1284888_1287717_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_171970810.1|1287727_1288519_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_059317436.1|1289500_1290580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082322887.1|1290576_1292055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082322889.1|1292114_1294574_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_125168764.1|1294582_1295158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075242365.1|1295132_1296110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756541.1|1296106_1298824_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_173425336.1|1298834_1299626_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_011409207.1|1299622_1300957_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_011409206.1|1301108_1301717_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_011259945.1|1301977_1302592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259944.1|1302638_1303139_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_011259943.1|1303142_1304639_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_003467612.1|1304780_1305278_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_011259942.1|1305425_1305914_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_014502420.1|1305916_1307752_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 11
NZ_CP012947	Xanthomonas oryzae pv. oryzae strain PXO83 chromosome, complete genome	5025428	1376805	1505061	5025428	transposase,tRNA,protease	Ralstonia_phage(25.0%)	90	NA	NA
WP_011258802.1|1376805_1377774_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_109182069.1|1377973_1379293_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_082323169.1|1379384_1380365_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_044756568.1|1380502_1383343_+	DUF2339 domain-containing protein	NA	NA	NA	NA	NA
WP_044756570.1|1383339_1384698_+	DUF3999 domain-containing protein	NA	NA	NA	NA	NA
WP_027704219.1|1385031_1386207_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_011259886.1|1386203_1386848_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_011409145.1|1387104_1388571_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_011259884.1|1389167_1390172_+	fructose-bisphosphate aldolase class I	NA	A0A0K0KVJ8	Prochlorococcus_phage	48.2	3.9e-79
WP_041182225.1|1390373_1390913_-	O-acetyl-ADP-ribose deacetylase	NA	A0A0K1L687	Scale_drop_disease_virus	42.6	9.9e-29
WP_011259882.1|1391108_1391615_-	isoprenylcysteine carboxylmethyltransferase family protein	NA	NA	NA	NA	NA
WP_011259881.1|1391921_1392881_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	49.0	3.8e-79
WP_075240596.1|1392897_1394103_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_044756573.1|1394270_1395254_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_044756574.1|1395264_1395546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012445617.1|1396615_1397812_-	GAF domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_012445616.1|1398134_1398572_+	DUF2946 family protein	NA	NA	NA	NA	NA
WP_041182223.1|1398766_1400770_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_012445614.1|1400769_1402362_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_044756578.1|1402497_1403223_-	phosphoadenylyl-sulfate reductase	NA	NA	NA	NA	NA
WP_075240493.1|1403219_1404941_-	assimilatory sulfite reductase (NADPH) hemoprotein subunit	NA	NA	NA	NA	NA
WP_011409142.1|1405049_1406897_-	assimilatory sulfite reductase (NADPH) flavoprotein subunit	NA	NA	NA	NA	NA
WP_011259870.1|1407077_1407986_+	sulfate adenylyltransferase subunit CysD	NA	NA	NA	NA	NA
WP_027704223.1|1408048_1409962_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	30.6	5.4e-29
WP_011409140.1|1410396_1411467_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011259867.1|1411463_1414589_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.8	7.0e-74
WP_041182725.1|1414940_1417610_+	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	48.3	1.8e-240
WP_109182116.1|1418489_1419455_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_033013519.1|1420149_1420287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409134.1|1420802_1421714_+	RNA methyltransferase	NA	NA	NA	NA	NA
WP_044756585.1|1423575_1423881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182545.1|1424440_1425397_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_044749647.1|1425703_1427080_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	5.4e-79
WP_041182545.1|1427192_1428149_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_082341204.1|1428195_1429602_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_012445603.1|1430012_1430435_-	large-conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_011259859.1|1430495_1431209_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_094187763.1|1432486_1433284_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011259856.1|1435114_1435390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409127.1|1435649_1435991_+	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
WP_011259854.1|1436048_1437911_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_011259853.1|1437986_1438745_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_011409125.1|1439046_1439841_-	thiazole synthase	NA	NA	NA	NA	NA
WP_011259851.1|1440376_1440577_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_012445601.1|1440767_1442552_+	autotransporter domain-containing esterase	NA	NA	NA	NA	NA
WP_027704094.1|1447017_1447410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409118.1|1447500_1447893_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_094187763.1|1447925_1448724_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_048488802.1|1450355_1450688_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011409560.1|1450742_1451705_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_115840192.1|1451814_1452780_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011258803.1|1452924_1453893_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
WP_011409116.1|1454443_1456576_-	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_115862263.1|1457765_1458731_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_012445397.1|1459256_1460225_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.1e-99
WP_011407913.1|1460561_1461776_+|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.8e-54
WP_115862264.1|1461863_1463183_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011259831.1|1463273_1463465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409111.1|1463432_1464446_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_011259829.1|1464479_1464713_-	DUF378 domain-containing protein	NA	NA	NA	NA	NA
WP_109181988.1|1466977_1467943_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011409108.1|1468242_1468692_-	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_012445586.1|1468947_1469805_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	41.8	1.3e-11
WP_011259826.1|1470009_1470621_+	DUF998 domain-containing protein	NA	NA	NA	NA	NA
WP_011259825.1|1470693_1473336_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	39.7	2.7e-172
WP_044756603.1|1473849_1474485_+	lipoprotein	NA	NA	NA	NA	NA
WP_011259823.1|1474507_1475536_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_011409104.1|1475532_1476432_+	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_011259822.1|1476488_1476905_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_011259821.1|1476916_1478032_+	J domain-containing protein	NA	NA	NA	NA	NA
WP_011259820.1|1478357_1478567_-	DUF839 domain-containing protein	NA	NA	NA	NA	NA
WP_044756605.1|1479121_1479592_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_012445578.1|1481007_1484121_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_094187763.1|1484419_1485218_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|1485502_1486471_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_109182069.1|1486683_1488003_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011259816.1|1488081_1488816_-	SIMPL domain-containing protein	NA	NA	NA	NA	NA
WP_011409098.1|1488954_1489527_+	Maf-like protein	NA	NA	NA	NA	NA
WP_011259814.1|1489526_1491026_+	ribonuclease G	NA	NA	NA	NA	NA
WP_044756607.1|1491173_1495094_+	TIGR02099 family protein	NA	NA	NA	NA	NA
WP_027704199.1|1495099_1495852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259808.1|1495950_1497396_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_044756609.1|1497652_1498234_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_012445571.1|1498379_1499747_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_143690685.1|1499743_1500064_+	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
WP_012445570.1|1500036_1500225_+	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
WP_027704198.1|1500276_1500741_+	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
WP_044756613.1|1502587_1503463_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_011259802.1|1503464_1503725_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_044756614.1|1503756_1505061_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
>prophage 12
NZ_CP012947	Xanthomonas oryzae pv. oryzae strain PXO83 chromosome, complete genome	5025428	1614775	1774246	5025428	transposase,tRNA,plate	Staphylococcus_prophage(18.75%)	116	NA	NA
WP_012445467.1|1614775_1615771_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	36.0	1.0e-31
WP_011259703.1|1615879_1618258_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_002811076.1|1618279_1618579_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	38.9	4.7e-12
WP_005995911.1|1618559_1618916_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011259702.1|1619524_1620223_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_075242444.1|1620204_1621644_+	GumC family protein	NA	NA	NA	NA	NA
WP_011409041.1|1621887_1623342_+	undecaprenyl-phosphate glucose phosphotransferase	NA	NA	NA	NA	NA
WP_049756340.1|1623436_1624726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259698.1|1624722_1625814_+	acyltransferase family protein	NA	NA	NA	NA	NA
WP_094187837.1|1625830_1626907_+	acyltransferase family protein	NA	NA	NA	NA	NA
WP_011259696.1|1626974_1628117_+	GDP-mannose:cellobiosyl-diphosphopolyprenol alpha-mannosyltransferase	NA	NA	NA	NA	NA
WP_011259695.1|1628113_1629163_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_011409038.1|1629180_1630674_+	lipopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_011259693.1|1630738_1631935_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_011259692.1|1631971_1632766_+	polysaccharide pyruvyl transferase family protein	NA	A0A1V0SAR6	Catovirus	36.0	6.0e-22
WP_011259691.1|1632770_1633565_+	WecB/TagA/CpsF family glycosyltransferase	NA	NA	NA	NA	NA
WP_011259690.1|1633599_1634061_+	cupin domain-containing protein	NA	A0A291AU44	Pandoravirus	40.0	6.3e-16
WP_011259689.1|1634170_1635151_+	TraB/GumN family protein	NA	NA	NA	NA	NA
WP_041182468.1|1635268_1636351_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_024743012.1|1639141_1639678_-	lipocalin family protein	NA	A0A2I2L3Z7	Orpheovirus	33.8	4.0e-14
WP_094187768.1|1641191_1642217_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_094187731.1|1642360_1643158_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_044756654.1|1643145_1643634_-	BrxE family protein	NA	NA	NA	NA	NA
WP_011259682.1|1643665_1643986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409027.1|1644320_1644920_+	AbiEi antitoxin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_011259680.1|1644916_1645840_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_033013473.1|1645919_1646168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259679.1|1646855_1647098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259678.1|1647522_1648032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703322.1|1654226_1654505_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_011259671.1|1654528_1655602_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_027703321.1|1656080_1657697_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_011409015.1|1657901_1658618_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409014.1|1658775_1659714_+	proline racemase family protein	NA	NA	NA	NA	NA
WP_011259667.1|1659713_1660976_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011259666.1|1660972_1661218_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_011259665.1|1661189_1662524_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_044756657.1|1662520_1663429_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_044756659.1|1663639_1665256_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_044756660.1|1665252_1666452_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_012445434.1|1666569_1668402_+	DUF885 family protein	NA	NA	NA	NA	NA
WP_044756662.1|1668398_1670264_+	DUF885 family protein	NA	NA	NA	NA	NA
WP_044757373.1|1670326_1671913_+	amino acid permease	NA	NA	NA	NA	NA
WP_027703320.1|1674237_1674525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756665.1|1674580_1674772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147212893.1|1674768_1674978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756671.1|1675614_1675959_+	DUF5597 domain-containing protein	NA	NA	NA	NA	NA
WP_011409006.1|1675955_1676252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756673.1|1676458_1678030_-	S8/S53 family peptidase	NA	A0A1V0SLL0	Klosneuvirus	37.6	2.3e-70
WP_059317441.1|1678493_1680851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182199.1|1681372_1684189_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	26.1	2.4e-49
WP_059317442.1|1684427_1688792_+	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_033013184.1|1688788_1690375_+	family 43 glycosylhydrolase	NA	NA	NA	NA	NA
WP_059317443.1|1690688_1693034_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_011408522.1|1694487_1695672_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_044756683.1|1697882_1700258_+	glycoside hydrolase family 127 protein	NA	NA	NA	NA	NA
WP_094187766.1|1700372_1701171_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_115862265.1|1702010_1702976_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_041182719.1|1703310_1704267_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.8	3.7e-42
WP_173425337.1|1704257_1704422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408989.1|1704591_1704969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171970808.1|1705153_1706428_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_011408988.1|1706465_1707035_+	molybdenum cofactor guanylyltransferase	NA	NA	NA	NA	NA
WP_011408987.1|1707018_1707381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012445407.1|1708774_1708969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259636.1|1709777_1710755_-	siroheme synthase	NA	NA	NA	NA	NA
WP_012445403.1|1710895_1711087_+	response regulator	NA	NA	NA	NA	NA
WP_011408984.1|1711145_1711397_+	ANTAR domain-containing protein	NA	NA	NA	NA	NA
WP_115862266.1|1711962_1712928_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_041182195.1|1713292_1713472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756692.1|1713911_1714874_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011408980.1|1715126_1716110_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	7.5e-99
WP_011408979.1|1716549_1716807_+	stress-induced protein	NA	NA	NA	NA	NA
WP_011257310.1|1718105_1719341_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_173425338.1|1720097_1720751_-	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_044756695.1|1721237_1722530_+	nucleotide sugar dehydrogenase	NA	NA	NA	NA	NA
WP_011259625.1|1722513_1723776_-	TIGR03862 family flavoprotein	NA	NA	NA	NA	NA
WP_011408975.1|1723787_1724219_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_011408974.1|1724277_1724643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408973.1|1724742_1725504_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_012445389.1|1725725_1726373_+	response regulator	NA	NA	NA	NA	NA
WP_173425339.1|1727765_1731476_-	ribonuclease E	NA	NA	NA	NA	NA
WP_011259619.1|1731877_1732864_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_011259618.1|1732896_1734720_-	DUF3300 domain-containing protein	NA	NA	NA	NA	NA
WP_011408968.1|1735035_1735296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408967.1|1735322_1735556_-	ZIP family metal transporter	NA	NA	NA	NA	NA
WP_011259617.1|1735571_1735994_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_011408966.1|1735990_1736347_-	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_011408965.1|1736435_1737035_+	NfuA family Fe-S biogenesis protein	NA	NA	NA	NA	NA
WP_041182192.1|1737048_1738872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756697.1|1739529_1742364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042465604.1|1742394_1743138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756990.1|1745042_1745999_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.6	6.2e-42
WP_044749647.1|1746454_1747831_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	5.4e-79
WP_148648655.1|1747820_1748084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042465640.1|1748112_1748859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756701.1|1748876_1750868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182545.1|1750920_1751877_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_044756703.1|1751896_1753132_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011257031.1|1753280_1754249_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_109182069.1|1754448_1755768_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_024711387.1|1757084_1757591_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_044756705.1|1757583_1759098_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_011259605.1|1759197_1759701_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_011259604.1|1759736_1760570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259603.1|1760557_1761061_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_012444494.1|1761064_1762942_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_044756708.1|1762905_1763916_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_044756710.1|1763948_1766654_+	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	29.3	1.5e-80
WP_027703476.1|1766842_1767340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125168760.1|1767405_1767900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408952.1|1768288_1768747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012444497.1|1769011_1770949_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	28.6	3.4e-39
WP_011408951.1|1770957_1771497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756713.1|1771493_1772912_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_044756715.1|1772908_1774246_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 13
NZ_CP012947	Xanthomonas oryzae pv. oryzae strain PXO83 chromosome, complete genome	5025428	1883970	1895745	5025428	tRNA	Pseudomonas_phage(22.22%)	12	NA	NA
WP_011408886.1|1883970_1885647_+	2-polyprenylphenol 6-hydroxylase	NA	E5EQ95	Micromonas_sp._RCC1109_virus	27.2	3.3e-38
WP_011408885.1|1885735_1886377_+	transcriptional repressor LexA	NA	A0A1W6JNS2	Morganella_phage	40.2	2.4e-13
WP_011408884.1|1886549_1887584_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	60.7	6.2e-112
WP_012444556.1|1887886_1888375_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_044756742.1|1888476_1891125_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.6	3.7e-84
WP_003481884.1|1891264_1891477_+	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	76.5	1.3e-13
WP_103057523.1|1892079_1892607_+	helix-turn-helix domain-containing protein	NA	A0A1W6JTD5	Pseudomonas_phage	57.4	1.2e-34
WP_012444559.1|1892994_1893294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756743.1|1893479_1894175_+	DNA helicase	NA	E5DV83	Deep-sea_thermophilic_phage	41.0	5.6e-16
WP_011259505.1|1894179_1894929_+	isopentenyl transferase	NA	NA	NA	NA	NA
WP_011259504.1|1895172_1895403_+	endolysin	NA	D5LH07	Escherichia_phage	63.8	4.7e-20
WP_011259503.1|1895445_1895745_+	endolysin	NA	A0A1W6JT17	Escherichia_phage	66.7	1.5e-15
>prophage 14
NZ_CP012947	Xanthomonas oryzae pv. oryzae strain PXO83 chromosome, complete genome	5025428	1920835	1979383	5025428	transposase,tRNA	Staphylococcus_prophage(16.67%)	45	NA	NA
WP_044756746.1|1920835_1921810_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	33.2	6.0e-32
WP_069960338.1|1921878_1922244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259476.1|1923136_1923703_-	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_011259475.1|1923824_1924595_-	SDR family NAD(P)-dependent oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	3.4e-14
WP_011408867.1|1924733_1925630_-	hydroxymethylglutaryl-CoA lyase	NA	A0A1V0SKU2	Klosneuvirus	32.7	8.5e-33
WP_011259473.1|1925700_1926090_-	VOC family protein	NA	NA	NA	NA	NA
WP_011259472.1|1926086_1926884_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_011408865.1|1926998_1927247_+	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_011408864.1|1927243_1929103_+	ferrous iron transporter B	NA	NA	NA	NA	NA
WP_011259469.1|1929104_1929359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408863.1|1929418_1929643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259467.1|1929670_1929979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259466.1|1930212_1931415_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_011259465.1|1931411_1932131_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_059317447.1|1933356_1934073_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_011259464.1|1934312_1935437_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.2	7.8e-44
WP_012444585.1|1935436_1935880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259463.1|1935888_1939131_+	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_010367104.1|1939139_1939604_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_011259461.1|1939620_1940541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059317448.1|1940537_1942277_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	27.8	1.0e-42
WP_109182069.1|1942823_1944143_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_115877379.1|1944501_1945467_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011407237.1|1945806_1946763_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_011408855.1|1947057_1947435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259457.1|1947595_1948297_-|transposase	DDE transposase	transposase	A9YX10	Burkholderia_phage	32.9	1.9e-16
WP_044756748.1|1951104_1952052_+	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014503214.1|1952305_1953430_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.7	9.4e-05
WP_044756749.1|1953634_1955152_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	39.9	2.3e-86
WP_011408849.1|1955293_1956430_+	two-component system response regulator	NA	NA	NA	NA	NA
WP_011259451.1|1956794_1958972_+	response regulator	NA	A0A1V0SGX0	Hokovirus	32.8	3.0e-47
WP_011408848.1|1958983_1959853_-	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_059317449.1|1960029_1961712_-	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	26.8	5.5e-33
WP_044756750.1|1962361_1965130_-	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_003486316.1|1965277_1965526_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011259444.1|1965522_1965933_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_012444596.1|1965998_1968590_+	bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase	NA	NA	NA	NA	NA
WP_011259442.1|1968943_1969759_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_027703620.1|1970414_1972718_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_011259440.1|1972766_1973843_-	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_011259439.1|1973839_1974436_-	chemoreceptor glutamine deamidase CheD	NA	NA	NA	NA	NA
WP_011408845.1|1974432_1975299_-	chemotaxis protein CheR	NA	NA	NA	NA	NA
WP_044756751.1|1975551_1977936_-	MCP four helix bundle domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	58.3	7.8e-09
WP_044756752.1|1978020_1978404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187758.1|1978584_1979383_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP012947	Xanthomonas oryzae pv. oryzae strain PXO83 chromosome, complete genome	5025428	1996198	2068544	5025428	transposase,integrase,tRNA	uncultured_Caudovirales_phage(15.38%)	49	2008271:2008288	2060707:2060724
WP_115840174.1|1996198_1997164_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_044756756.1|1998476_2000819_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	61.7	1.2e-09
WP_011408833.1|2000832_2001594_-	transporter	NA	NA	NA	NA	NA
WP_103073514.1|2001909_2002596_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	36.2	2.8e-12
WP_011408830.1|2004278_2004533_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_011408829.1|2004700_2006710_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_002806565.1|2006743_2007109_-	response regulator	NA	W8CYM9	Bacillus_phage	39.3	2.7e-14
WP_011259421.1|2007105_2007414_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_042465006.1|2007514_2008537_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
2008271:2008288	attL	ATCCATCTCGGCCAGGAA	NA	NA	NA	NA
WP_011259419.1|2008533_2009316_-	ParA family protein	NA	Q8JL10	Natrialba_phage	37.7	1.0e-13
WP_011408827.1|2009317_2010292_-	flagellar motor protein MotD	NA	NA	NA	NA	NA
WP_011259417.1|2010298_2011039_-	flagellar motor protein	NA	NA	NA	NA	NA
WP_027703781.1|2011127_2011481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075242238.1|2011477_2011993_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011408825.1|2012015_2012408_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_044756757.1|2012559_2013267_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	51.2	8.4e-52
WP_125168759.1|2013342_2013690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756758.1|2013691_2015497_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_042465003.1|2015751_2016204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465618.1|2017193_2020295_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_082341205.1|2020453_2021452_+	ParA family protein	NA	H2BD62	Pseudomonas_phage	41.4	8.5e-42
WP_011407913.1|2021414_2022629_+|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.8e-54
WP_041182545.1|2022810_2023767_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_044756759.1|2024206_2024650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070344089.1|2024646_2025063_+	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_115862267.1|2026167_2027487_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408814.1|2027714_2028029_-	DUF1153 domain-containing protein	NA	NA	NA	NA	NA
WP_157724569.1|2027961_2028915_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_041182637.1|2029075_2029465_+	phage late control D family protein	NA	NA	NA	NA	NA
WP_012444637.1|2037119_2038049_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_044756864.1|2038045_2040880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014503414.1|2040908_2041637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756862.1|2041661_2044004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182545.1|2044617_2045574_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_011258529.1|2047713_2048682_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_011259129.1|2050849_2051557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408639.1|2051627_2051942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259128.1|2051901_2053398_-	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_011259127.1|2053521_2053953_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_027703908.1|2054118_2055189_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_011259125.1|2055258_2056404_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.2	2.2e-86
WP_011259124.1|2056535_2056889_+	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_011259123.1|2057085_2058930_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_011259122.1|2059024_2059993_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	30.3	1.4e-28
WP_011408636.1|2060073_2060436_-|integrase	phage integrase N-terminal SAM-like domain-containing protein	integrase	NA	NA	NA	NA
WP_165967678.1|2063053_2064505_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
2060707:2060724	attR	TTCCTGGCCGAGATGGAT	NA	NA	NA	NA
WP_082341214.1|2064691_2065876_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.4	1.0e-41
WP_044756859.1|2065926_2066988_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_115862274.1|2067224_2068544_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP012947	Xanthomonas oryzae pv. oryzae strain PXO83 chromosome, complete genome	5025428	2148400	2295261	5025428	transposase,protease	uncultured_Caudovirales_phage(19.23%)	100	NA	NA
WP_044749647.1|2148400_2149777_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	5.4e-79
WP_041182545.1|2149953_2150910_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_044756851.1|2151190_2159329_+	autotransporter-associated beta strand repeat-containing protein	NA	NA	NA	NA	NA
WP_011259043.1|2159605_2160217_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_027703759.1|2160213_2161236_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_011408577.1|2161354_2162839_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_011408576.1|2162835_2165928_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_011408575.1|2165920_2167036_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_012444836.1|2167534_2170270_-	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_011259038.1|2171101_2172478_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	1.6e-62
WP_011408569.1|2175038_2176217_+	N-acetylmuramoyl-L-alanine amidase	NA	M1IEI0	Bacillus_phage	39.6	1.9e-08
WP_044756849.1|2176254_2177175_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_011259033.1|2179162_2179648_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_011259032.1|2179683_2180499_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	34.1	2.1e-30
WP_011408566.1|2180495_2181338_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_011259030.1|2181516_2181897_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_011259029.1|2181893_2183408_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_011259028.1|2183566_2183911_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_011408564.1|2183914_2184538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408563.1|2184772_2186728_-	DUF839 domain-containing protein	NA	NA	NA	NA	NA
WP_011259025.1|2187161_2189774_+	exo 1,3/1,4-beta-D-glucan glucohydrolase	NA	NA	NA	NA	NA
WP_011408561.1|2190033_2191596_+	sodium/sugar symporter	NA	A0A240F3J2	Aeromonas_phage	39.5	2.7e-87
WP_027703349.1|2191840_2193697_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_041182436.1|2195023_2197213_-	glycoside hydrolase family 3 C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_044756846.1|2197341_2199120_-	M14 family metallopeptidase	NA	NA	NA	NA	NA
WP_011408557.1|2200321_2200930_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_044756845.1|2201260_2201449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408556.1|2201632_2201947_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_044756844.1|2201997_2202831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756843.1|2202897_2203398_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_044757420.1|2203489_2204068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259013.1|2204229_2204730_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_044757418.1|2205041_2206142_+	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_044756842.1|2206244_2206958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756841.1|2207209_2207449_+	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_011259009.1|2209906_2210392_+	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	36.2	2.8e-14
WP_011408551.1|2210542_2211322_-	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_012444869.1|2211510_2213391_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	38.0	2.3e-24
WP_044756840.1|2213724_2215242_+	fumarate hydratase	NA	NA	NA	NA	NA
WP_044756839.1|2215378_2216014_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_044756838.1|2216442_2217576_-	phospholipase A	NA	NA	NA	NA	NA
WP_162828829.1|2218984_2219155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259000.1|2221040_2222015_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	39.6	2.0e-19
WP_027704049.1|2222181_2222415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027704112.1|2226230_2226749_+	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	40.7	6.8e-27
WP_115862273.1|2228482_2229802_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_012444880.1|2229852_2230257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033013508.1|2230791_2231955_+	AAA family ATPase	NA	R4TQL5	Phaeocystis_globosa_virus	32.3	2.7e-15
WP_012444882.1|2231951_2234180_+	S8 family peptidase	NA	NA	NA	NA	NA
WP_044756833.1|2234261_2235476_-|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.1e-54
WP_044756832.1|2235726_2237202_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	65.7	4.3e-98
WP_012444885.1|2237252_2238272_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_027703901.1|2238555_2240136_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_027703900.1|2241346_2241694_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012444889.1|2241690_2242221_+	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	42.6	1.8e-27
WP_012444890.1|2242231_2242645_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	68.2	8.6e-41
WP_173425351.1|2242659_2243367_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	68.2	2.3e-86
WP_044756831.1|2243385_2244690_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	58.9	2.0e-128
WP_026144156.1|2244953_2245310_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_012444894.1|2246305_2249266_+|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_044756830.1|2250260_2253656_-	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	27.8	2.9e-25
WP_011258994.1|2253870_2254251_-	response regulator	NA	NA	NA	NA	NA
WP_012444899.1|2254518_2254695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075239633.1|2254880_2255270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703995.1|2255266_2255470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756829.1|2256309_2257686_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.5	1.3e-77
WP_011408535.1|2257906_2258566_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_011258990.1|2258621_2260538_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_011258989.1|2260640_2261360_-	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_011258988.1|2261356_2262364_-	glucokinase	NA	NA	NA	NA	NA
WP_011408534.1|2262360_2263791_-	glucose-6-phosphate dehydrogenase	NA	A0A222YYZ2	Synechococcus_phage	34.5	2.2e-67
WP_011258986.1|2264228_2265326_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	30.1	2.2e-22
WP_011408533.1|2265454_2266327_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_012444907.1|2266270_2266537_+	DUF1674 domain-containing protein	NA	NA	NA	NA	NA
WP_011258985.1|2266596_2266992_+	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_011258984.1|2266988_2267375_+	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
WP_012444909.1|2267409_2269200_+	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_027703324.1|2269209_2269413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408532.1|2269429_2270212_+	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_044756828.1|2270322_2270571_+	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_014503500.1|2270521_2270974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010378794.1|2270997_2272239_+	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_011258980.1|2272231_2272966_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	34.5	1.0e-31
WP_115862272.1|2274359_2275325_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011408527.1|2275578_2277987_+	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_011408526.1|2278015_2278678_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_011258975.1|2278681_2279146_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011258974.1|2279142_2280912_+	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	28.0	9.4e-52
WP_011258973.1|2280908_2281949_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_011258972.1|2282240_2283020_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_011258971.1|2283016_2283481_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_012444920.1|2283504_2284923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258969.1|2284919_2286776_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_011258968.1|2286775_2287408_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_012444921.1|2287882_2288389_-	VOC family protein	NA	NA	NA	NA	NA
WP_044756826.1|2288555_2289455_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.4	9.7e-37
WP_041182545.1|2290506_2291463_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_011409560.1|2292275_2293238_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_011408520.1|2294416_2295088_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.9	5.2e-27
WP_012444927.1|2295084_2295261_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_CP012947	Xanthomonas oryzae pv. oryzae strain PXO83 chromosome, complete genome	5025428	2464523	2511310	5025428	transposase,tRNA,protease	Ralstonia_phage(11.11%)	32	NA	NA
WP_011258802.1|2464523_2465492_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_075239722.1|2466365_2467523_+	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_109181928.1|2467799_2468765_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_115862271.1|2468742_2470218_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.5	1.6e-76
WP_115862270.1|2470336_2471656_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_157724571.1|2475030_2475327_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_044756800.1|2475923_2476982_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011259163.1|2477178_2478399_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_011259164.1|2478713_2480111_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_011408657.1|2480121_2481339_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_044756799.1|2481338_2481977_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011259167.1|2482047_2482908_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011408658.1|2482904_2483693_-	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_012445041.1|2483703_2484885_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_002812972.1|2484927_2485353_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	41.7	1.1e-19
WP_011259170.1|2485572_2486205_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011259171.1|2486229_2488602_+	3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_011259172.1|2488759_2489965_+	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_011259173.1|2490285_2491617_+	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	35.2	1.5e-41
WP_011408659.1|2491613_2491964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408660.1|2491995_2492403_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	49.1	5.7e-21
WP_011259175.1|2492399_2492726_+	DUF190 domain-containing protein	NA	NA	NA	NA	NA
WP_011259176.1|2492757_2494134_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	38.3	6.8e-74
WP_011259177.1|2494370_2498537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703232.1|2498649_2499321_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_011259179.1|2499385_2501314_-	DUF3857 and transglutaminase domain-containing protein	NA	NA	NA	NA	NA
WP_011259180.1|2501476_2503837_-	DNA translocase FtsK	NA	G1D482	Mycobacterium_virus	45.8	2.5e-84
WP_011259181.1|2504120_2505089_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.5	5.9e-64
WP_011408662.1|2505146_2506268_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_042465566.1|2507695_2508448_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_002813418.1|2508528_2508747_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_011408664.1|2509027_2511310_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	44.5	4.3e-174
>prophage 18
NZ_CP012947	Xanthomonas oryzae pv. oryzae strain PXO83 chromosome, complete genome	5025428	2594321	2732985	5025428	transposase,tRNA,protease	Ralstonia_phage(12.5%)	101	NA	NA
WP_041182545.1|2594321_2595278_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_076659600.1|2597642_2601680_-	type IV secretion protein Rhs	NA	S5W9C6	Leptospira_phage	36.8	6.8e-13
WP_082322907.1|2602954_2607925_-	IPT/TIG domain-containing protein	NA	NA	NA	NA	NA
WP_075239865.1|2608016_2608781_+	cytochrome-c peroxidase	NA	NA	NA	NA	NA
WP_011258802.1|2610906_2611875_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_179085088.1|2611926_2612337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756786.1|2612545_2615614_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.1	9.6e-60
WP_011259260.1|2620470_2620863_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_011259261.1|2620871_2621333_+	cytochrome c	NA	NA	NA	NA	NA
WP_011408704.1|2621837_2622068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_133264955.1|2622633_2622888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408705.1|2622891_2623068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115801893.1|2623860_2624826_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011408707.1|2624832_2626131_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_059317457.1|2626299_2627985_-	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	25.2	3.6e-16
WP_075239845.1|2627981_2629718_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	26.2	8.2e-16
WP_044756785.1|2629869_2630970_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_011259267.1|2631018_2631282_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_011259269.1|2631660_2631771_+	cytochrome bd-I oxidase subunit CydX	NA	NA	NA	NA	NA
WP_173425350.1|2632030_2633257_+	MFS transporter	NA	NA	NA	NA	NA
WP_044756781.1|2633237_2635151_-	CocE/NonD family hydrolase	NA	NA	NA	NA	NA
WP_011408714.1|2635518_2636763_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	45.1	2.5e-91
WP_044756780.1|2637011_2638166_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	37.2	1.0e-46
WP_011259275.1|2638179_2638440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408716.1|2638439_2638805_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011408717.1|2638804_2640100_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_044756779.1|2640223_2641174_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_044756778.1|2641786_2643130_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_011259280.1|2643169_2644270_-	acetylornithine deacetylase	NA	NA	NA	NA	NA
WP_011408722.1|2644275_2644728_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011408723.1|2644969_2646211_-	argininosuccinate synthase	NA	NA	NA	NA	NA
WP_011259283.1|2646282_2647308_-	N-acetylornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_027703614.1|2647620_2648115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444736.1|2648291_2649716_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	1.1e-42
WP_011408724.1|2650213_2650651_+	SufE family protein	NA	NA	NA	NA	NA
WP_011259287.1|2650647_2651898_+	MFS transporter	NA	NA	NA	NA	NA
WP_011259288.1|2651965_2653027_-	S41 family peptidase	NA	NA	NA	NA	NA
WP_075239108.1|2653169_2654198_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_033013281.1|2654282_2654570_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_011259290.1|2654566_2655916_+	dihydroorotase	NA	NA	NA	NA	NA
WP_044756777.1|2655915_2656755_+	M23 family metallopeptidase	NA	A0A075BS18	Microcystis_phage	41.2	2.4e-13
WP_011259294.1|2657626_2657890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444728.1|2658261_2658750_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_115862269.1|2658973_2660293_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258529.1|2660429_2661398_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_094187753.1|2662385_2663183_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012444725.1|2664128_2665310_+	putative acyl-CoA thioester hydrolase	NA	NA	NA	NA	NA
WP_011259303.1|2666701_2668372_+	glycoside hydrolase family 28 protein	NA	NA	NA	NA	NA
WP_011259304.1|2668588_2669278_-	phytoene synthase	NA	NA	NA	NA	NA
WP_011408736.1|2669306_2670011_-	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_011259306.1|2670084_2670804_-	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_027703270.1|2670834_2672172_-	TRZ/ATZ family hydrolase	NA	NA	NA	NA	NA
WP_041182450.1|2672191_2672995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002802373.1|2673186_2673753_-	elongation factor P	NA	NA	NA	NA	NA
WP_011408738.1|2673854_2674883_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_011259310.1|2675101_2677219_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_011259311.1|2677215_2678145_-	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_044756775.1|2678196_2678961_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_011408740.1|2679079_2679913_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_011259314.1|2680165_2680777_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	69.8	1.1e-79
WP_011259315.1|2681031_2681472_+	ribonuclease	NA	NA	NA	NA	NA
WP_011259316.1|2681468_2681894_+	barstar family protein	NA	NA	NA	NA	NA
WP_027703271.1|2682342_2684238_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	26.8	1.8e-48
WP_011259318.1|2684327_2685704_+	ATP-dependent RNA helicase DbpA	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	31.4	1.6e-54
WP_011259319.1|2685806_2686367_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	43.2	1.6e-29
WP_044756774.1|2686464_2688021_-	YdiU family protein	NA	NA	NA	NA	NA
WP_011408742.1|2688304_2689180_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_012444709.1|2689380_2690079_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_011408744.1|2690249_2690459_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	62.3	2.8e-16
WP_011408745.1|2690728_2691214_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_011259325.1|2691284_2691833_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_011259326.1|2691829_2693011_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_012444707.1|2693234_2695304_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_011259328.1|2695403_2696282_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_044756773.1|2696379_2697279_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_011408747.1|2697366_2698107_+	beta-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
WP_011259331.1|2698266_2698842_+	polyhydroxyalkanoate synthesis repressor PhaR	NA	NA	NA	NA	NA
WP_011408749.1|2699015_2699987_-	TraB/GumN family protein	NA	NA	NA	NA	NA
WP_041182163.1|2700020_2700968_-	DUF1684 domain-containing protein	NA	NA	NA	NA	NA
WP_011259334.1|2700967_2702845_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	35.2	1.4e-85
WP_027703275.1|2702982_2704698_-	N-acetylmuramoyl-L-alanine amidase	NA	A6XML1	Bacillus_virus	28.4	4.0e-15
WP_011259336.1|2704768_2705269_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_011259337.1|2705265_2706753_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_011408752.1|2706777_2707845_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_011408753.1|2707990_2709328_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	36.2	1.3e-37
WP_011259340.1|2709623_2710886_-	virulence factor	NA	NA	NA	NA	NA
WP_094187754.1|2711102_2711850_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_041182165.1|2712166_2714002_-	formylglycine-generating enzyme family protein	NA	A0A075BSL8	Microcystis_phage	33.1	5.6e-23
WP_011408756.1|2714273_2715365_+	ribonuclease D	NA	NA	NA	NA	NA
WP_011259345.1|2716457_2716859_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_015463309.1|2719334_2719514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703932.1|2720115_2720406_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011408759.1|2720393_2720672_-	CopG family ribbon-helix-helix protein	NA	NA	NA	NA	NA
WP_027703931.1|2721156_2721357_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_041182719.1|2721605_2722562_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.8	3.7e-42
WP_012445118.1|2722963_2723932_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	1.5e-99
WP_011408397.1|2724335_2725520_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_109181970.1|2726100_2727066_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_042465594.1|2731630_2731975_+	DUF3301 domain-containing protein	NA	NA	NA	NA	NA
WP_011408764.1|2732185_2732512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259352.1|2732544_2732985_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	46.2	9.3e-25
>prophage 19
NZ_CP012947	Xanthomonas oryzae pv. oryzae strain PXO83 chromosome, complete genome	5025428	2740197	2841039	5025428	transposase,tRNA	Bacillus_phage(15.38%)	59	NA	NA
WP_044756769.1|2740197_2741652_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_011408767.1|2742075_2743062_+	PhoH family protein	NA	W8D063	Erwinia_phage	47.7	2.5e-46
WP_011259362.1|2743473_2744136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703624.1|2744190_2744676_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_011408769.1|2744675_2745194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012444677.1|2745288_2746167_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_011259366.1|2746163_2747444_+	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
WP_011259367.1|2747459_2748461_+	magnesium and cobalt transport protein CorA	NA	NA	NA	NA	NA
WP_033013286.1|2748612_2749977_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_041182453.1|2750231_2750642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259369.1|2750797_2751628_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_075240820.1|2751947_2753195_-	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.3	1.2e-24
WP_011408777.1|2753340_2754834_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_011408778.1|2754838_2756425_-	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_011408779.1|2756421_2757624_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_117231491.1|2758130_2759450_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408781.1|2759753_2761139_-	glutamine synthetase	NA	NA	NA	NA	NA
WP_011259377.1|2762046_2763426_+	glutamine synthetase	NA	NA	NA	NA	NA
WP_173340387.1|2763422_2764742_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011259379.1|2764824_2766123_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.4	2.7e-19
WP_011408784.1|2766430_2767711_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_011408785.1|2768016_2768295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259381.1|2768284_2770633_-	FdhF/YdeP family oxidoreductase	NA	NA	NA	NA	NA
WP_011259382.1|2770629_2771475_-	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_059317460.1|2771481_2773251_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_011259384.1|2773780_2775133_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_011408787.1|2775193_2778331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408788.1|2778497_2779352_+	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	39.8	6.4e-14
WP_044756765.1|2779522_2780827_+	DUF445 family protein	NA	NA	NA	NA	NA
WP_027703773.1|2780968_2785063_+	response regulator	NA	A0A1V0SGX0	Hokovirus	28.4	1.1e-55
WP_027703772.1|2785096_2786083_+	response regulator	NA	W8CYM9	Bacillus_phage	27.6	9.7e-06
WP_044756764.1|2786207_2787191_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.2	1.6e-96
WP_044756763.1|2787639_2792664_-	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_027703873.1|2792941_2793601_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012444649.1|2793615_2794920_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_012444648.1|2794932_2798103_+	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_011257851.1|2799078_2800044_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011408798.1|2800750_2801746_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_059317461.1|2801906_2804423_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	28.5	6.3e-09
WP_011259401.1|2804419_2805376_+	1-phosphofructokinase family hexose kinase	NA	NA	NA	NA	NA
WP_011259402.1|2805534_2807277_+	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_012444645.1|2807454_2808732_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_011258802.1|2809398_2810367_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_165967681.1|2810503_2811955_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_041182545.1|2812200_2813157_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_044749647.1|2813344_2814721_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	5.4e-79
WP_041182640.1|2816755_2817490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444638.1|2817514_2820352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444637.1|2820348_2821278_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_012444636.1|2821286_2824049_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.6	3.3e-43
WP_082341208.1|2825614_2828206_-	TAL effector repeat-containing protein	NA	NA	NA	NA	NA
WP_041182637.1|2828245_2828635_-	phage late control D family protein	NA	NA	NA	NA	NA
WP_157724569.1|2828795_2829749_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408814.1|2829681_2829996_+	DUF1153 domain-containing protein	NA	NA	NA	NA	NA
WP_041182545.1|2831510_2832467_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_011408645.1|2833929_2835051_-	phytase	NA	NA	NA	NA	NA
WP_041182147.1|2837317_2837785_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_011259142.1|2837935_2838568_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_011259143.1|2840007_2841039_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP012947	Xanthomonas oryzae pv. oryzae strain PXO83 chromosome, complete genome	5025428	2848408	2921921	5025428	transposase,tRNA	Xanthomonas_phage(13.33%)	48	NA	NA
WP_115862276.1|2848408_2849728_+|transposase	IS701-like element ISXo15 family transposase	transposase	NA	NA	NA	NA
WP_059317462.1|2850016_2853331_+	TAL effector repeat-containing protein	NA	NA	NA	NA	NA
WP_059317463.1|2856607_2860126_+	TAL effector repeat-containing protein	NA	NA	NA	NA	NA
WP_041182100.1|2860394_2860589_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	80.6	2.5e-19
WP_044756872.1|2860592_2860892_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	90.2	2.5e-45
WP_044756873.1|2861115_2864421_+	TAL effector repeat-containing protein	NA	NA	NA	NA	NA
WP_153296780.1|2864833_2865100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258825.1|2865790_2866804_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011258824.1|2866903_2867488_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011259046.1|2867551_2868520_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.9e-99
WP_011258822.1|2869073_2870423_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.6	4.5e-94
WP_012445101.1|2870534_2871194_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_027704061.1|2871554_2872022_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_094187738.1|2872208_2873310_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.2	1.6e-36
WP_044756878.1|2877096_2878311_-|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.7	6.2e-55
WP_044756879.1|2878657_2879857_+	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_011258799.1|2880005_2880188_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_041182545.1|2882201_2883158_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_109181957.1|2885353_2886319_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_094187737.1|2886319_2887073_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012445118.1|2887903_2888872_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	1.5e-99
WP_011258442.1|2889056_2890292_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_012445119.1|2890344_2891112_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_059317464.1|2892339_2894868_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	34.0	3.1e-64
WP_173425341.1|2895434_2896958_-	acetylhydrolase	NA	M1HKG7	Acanthocystis_turfacea_Chlorella_virus	25.8	1.9e-08
WP_011258788.1|2897251_2897392_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_027703703.1|2897391_2898573_-	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_011258786.1|2898661_2899657_+	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	46.9	3.7e-05
WP_044756882.1|2899653_2900793_+	homocysteine S-methyltransferase family protein	NA	A0A140XBC7	Dickeya_phage	65.0	6.3e-17
WP_012445124.1|2900935_2903689_+	methionine synthase	NA	NA	NA	NA	NA
WP_011258783.1|2904075_2905281_-	AGE family epimerase/isomerase	NA	NA	NA	NA	NA
WP_012445125.1|2905277_2906264_-	carbohydrate kinase	NA	NA	NA	NA	NA
WP_011258781.1|2906260_2907571_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_041182423.1|2907584_2908760_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_027703705.1|2908900_2909746_-	transporter	NA	NA	NA	NA	NA
WP_011258778.1|2910079_2910832_-	DUF2058 family protein	NA	NA	NA	NA	NA
WP_011258777.1|2910832_2911069_-	protein SlyX	NA	NA	NA	NA	NA
WP_011258776.1|2911061_2912411_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	40.6	1.4e-79
WP_027703707.1|2912436_2913402_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_011408372.1|2913493_2914051_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_042464800.1|2914186_2914435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014502778.1|2914437_2914800_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012445132.1|2914796_2915672_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.9	3.3e-13
WP_059317465.1|2915668_2916655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012445134.1|2916664_2917495_+	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_042464794.1|2918127_2918550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408367.1|2918672_2920076_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_041182545.1|2920964_2921921_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
>prophage 21
NZ_CP012947	Xanthomonas oryzae pv. oryzae strain PXO83 chromosome, complete genome	5025428	2966441	3033405	5025428	coat,transposase,protease	Bacillus_virus(22.22%)	49	NA	NA
WP_115862278.1|2966441_2967407_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011258724.1|2968852_2969101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703878.1|2970055_2970790_-	serine hydrolase	NA	NA	NA	NA	NA
WP_011258722.1|2970840_2972421_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_027703877.1|2972427_2973621_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_171970799.1|2973631_2975104_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_012445167.1|2975145_2975586_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011258718.1|2975707_2976559_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011258717.1|2976619_2978863_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	34.7	1.1e-81
WP_033013399.1|2979318_2979855_-	bacterioferritin	NA	NA	NA	NA	NA
WP_012445169.1|2979950_2982368_+	penicillin acylase family protein	NA	NA	NA	NA	NA
WP_059317466.1|2983747_2985874_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_027703366.1|2986304_2987357_+	right-handed parallel beta-helix repeat-containing protein	NA	NA	NA	NA	NA
WP_011258712.1|2987425_2989120_-	asparagine synthase B	NA	E5ERH5	Ostreococcus_lucimarinus_virus	38.6	2.5e-86
WP_044756901.1|2989414_2990545_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_011408335.1|2990549_2991050_-	GNAT family N-acetyltransferase	NA	A0A1X9I687	Streptococcus_phage	41.7	2.3e-27
WP_011408334.1|2991046_2991403_-	Spx/MgsR family RNA polymerase-binding regulatory protein	NA	NA	NA	NA	NA
WP_012445174.1|2991865_2993062_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_011408332.1|2993078_2995688_-	[protein-PII] uridylyltransferase	NA	NA	NA	NA	NA
WP_011258707.1|2995684_2996461_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_024744143.1|2996753_2997305_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_044756902.1|2997313_2998084_+	molecular chaperone	NA	NA	NA	NA	NA
WP_044756903.1|2998100_3000452_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_011258703.1|3000448_3001483_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_044756904.1|3001529_3001862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408326.1|3001864_3002590_+	molecular chaperone	NA	NA	NA	NA	NA
WP_044756905.1|3002965_3003769_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_011258700.1|3003938_3004817_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_011408325.1|3004944_3005322_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_011258698.1|3005378_3006101_+	UMP kinase	NA	NA	NA	NA	NA
WP_011258697.1|3006281_3006839_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_027703358.1|3006856_3007618_+	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	32.6	3.6e-16
WP_011258695.1|3007614_3008442_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_011258694.1|3008444_3009635_+	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_044756906.1|3009661_3011008_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_012445188.1|3011091_3013458_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_044756907.1|3013826_3014840_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_011258690.1|3014836_3015298_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_011258689.1|3015321_3016113_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_027703356.1|3016151_3017408_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_011408322.1|3017404_3018145_+	ribonuclease HII	NA	G9E3X7	Emiliania_huxleyi_virus	38.0	1.6e-24
WP_011408321.1|3018602_3022193_+	DNA polymerase III subunit alpha	NA	A0A291AVA6	Streptomyces_phage	36.6	4.4e-181
WP_011258685.1|3022368_3023328_+	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_044756908.1|3024167_3026348_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_044756909.1|3026347_3027085_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.6	3.5e-08
WP_044756910.1|3027081_3028494_+	DUF3526 domain-containing protein	NA	NA	NA	NA	NA
WP_011408319.1|3028484_3029774_+	DUF3526 domain-containing protein	NA	NA	NA	NA	NA
WP_044749647.1|3030509_3031886_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	5.4e-79
WP_044749647.1|3032028_3033405_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	5.4e-79
>prophage 22
NZ_CP012947	Xanthomonas oryzae pv. oryzae strain PXO83 chromosome, complete genome	5025428	3042719	3100918	5025428	transposase,tRNA,protease	Acidithiobacillus_phage(22.22%)	48	NA	NA
WP_044756912.1|3042719_3044195_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	67.8	3.7e-102
WP_011408311.1|3044237_3044633_+	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_044756913.1|3044672_3046049_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	6.6e-77
WP_011258670.1|3047684_3048359_+	DUF502 domain-containing protein	NA	A0A2I7S9X1	Vibrio_phage	24.5	1.9e-08
WP_011258669.1|3048363_3049140_+	queuosine precursor transporter	NA	R4TNY5	Halovirus	27.2	1.9e-09
WP_011258668.1|3050412_3052350_+	DUF885 family protein	NA	NA	NA	NA	NA
WP_011258667.1|3052531_3053509_-	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_044756914.1|3053505_3054903_-	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_044756915.1|3055174_3056233_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_012445211.1|3056996_3057446_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_011258663.1|3057670_3059755_+|tRNA	methionine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_041182084.1|3059997_3060594_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_012445213.1|3060595_3061024_+	Rnf electron transport complex subunit RnfB	NA	NA	NA	NA	NA
WP_011258660.1|3061642_3062425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012445216.1|3062510_3062879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258659.1|3062937_3063501_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_012445217.1|3063497_3064331_+	anti-sigma factor	NA	NA	NA	NA	NA
WP_011408297.1|3064556_3065555_+	acyl-CoA desaturase	NA	G4YAW5	Emiliania_huxleyi_virus	30.6	2.3e-18
WP_027704227.1|3065551_3066802_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_044756917.1|3066801_3067686_+	DUF1365 domain-containing protein	NA	NA	NA	NA	NA
WP_011258655.1|3067682_3068978_+	class I SAM-dependent methyltransferase	NA	A0A2I2L5L3	Orpheovirus	32.4	3.9e-39
WP_011258654.1|3068974_3069520_+	DUF2878 domain-containing protein	NA	NA	NA	NA	NA
WP_044756918.1|3069516_3070299_+	DUF1295 domain-containing protein	NA	NA	NA	NA	NA
WP_011258652.1|3070316_3071387_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011408290.1|3071549_3071897_-	RidA family protein	NA	NA	NA	NA	NA
WP_011258648.1|3072877_3075442_+	bifunctional lysylphosphatidylglycerol flippase/synthetase MprF	NA	NA	NA	NA	NA
WP_011258647.1|3076065_3077436_-	virulence factor family protein	NA	NA	NA	NA	NA
WP_011258646.1|3077505_3077700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059317468.1|3077759_3078368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408284.1|3078403_3079006_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_011258643.1|3079279_3079735_-	PA2169 family four-helix-bundle protein	NA	NA	NA	NA	NA
WP_011258642.1|3080297_3081509_-	MFS transporter	NA	NA	NA	NA	NA
WP_011408282.1|3081729_3082848_+	alkene reductase	NA	NA	NA	NA	NA
WP_075239156.1|3083738_3084029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408280.1|3084317_3084653_-	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
WP_011408279.1|3084767_3085817_+	cation transporter	NA	NA	NA	NA	NA
WP_012445231.1|3087488_3087962_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_012445232.1|3088101_3089478_+	Hsp70 family protein	NA	NA	NA	NA	NA
WP_011258635.1|3089667_3089853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187731.1|3090829_3091628_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_115862279.1|3091744_3093064_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_059317469.1|3093276_3094245_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	3.3e-99
WP_011258631.1|3094501_3094768_-	DksA/TraR family C4-type zinc finger protein	NA	A0A193GYU8	Escherichia_phage	54.5	1.5e-17
WP_011258630.1|3094942_3095197_+	DUF2789 domain-containing protein	NA	NA	NA	NA	NA
WP_011258629.1|3095357_3095531_-	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
WP_012445235.1|3095932_3096460_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_011258627.1|3096928_3098029_+	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_011258626.1|3098089_3100918_-|protease	autotransporter serine protease	protease	A0A1V0SBG2	Catovirus	25.2	3.9e-07
>prophage 23
NZ_CP012947	Xanthomonas oryzae pv. oryzae strain PXO83 chromosome, complete genome	5025428	3120454	3183319	5025428	transposase,protease	Hokovirus(27.27%)	43	NA	NA
WP_109182069.1|3120454_3121774_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_041182545.1|3121874_3122831_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_044756425.1|3122925_3124302_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	63.2	1.9e-79
WP_012445230.1|3124530_3125766_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011258607.1|3125861_3126359_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_027703339.1|3126533_3127868_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	F5CA72	Streptococcus_phi-m46.1-like_phage	26.8	1.7e-29
WP_011408250.1|3128026_3128749_+	response regulator	NA	NA	NA	NA	NA
WP_011258604.1|3128897_3129620_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_011258603.1|3129843_3130743_-	GTPase Era	NA	NA	NA	NA	NA
WP_012445253.1|3130739_3131420_-	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	29.4	9.9e-18
WP_011258601.1|3131409_3131787_-	DUF4845 domain-containing protein	NA	NA	NA	NA	NA
WP_011258600.1|3131817_3132618_-	signal peptidase I	NA	NA	NA	NA	NA
WP_041182078.1|3132724_3134515_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	40.5	3.5e-22
WP_011408249.1|3134695_3136282_-|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	30.0	6.5e-28
WP_012445255.1|3136391_3137282_-	sigma-E factor negative regulatory protein	NA	NA	NA	NA	NA
WP_041182077.1|3137278_3137899_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_011258595.1|3138135_3140217_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_059317470.1|3140433_3141399_-	cation transporter	NA	NA	NA	NA	NA
WP_178383138.1|3141637_3142540_-	3-hydroxyisobutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_059317471.1|3142699_3143872_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_011258591.1|3143871_3144669_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_059317472.1|3144665_3145847_-	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_011408243.1|3145857_3147363_-	CoA-acylating methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_011408242.1|3147501_3148887_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011408239.1|3150919_3151726_+	beta-galactosidase	NA	NA	NA	NA	NA
WP_011408237.1|3152746_3153100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258585.1|3153266_3155198_-	alpha-L-fucosidase	NA	NA	NA	NA	NA
WP_011258581.1|3156530_3156704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703331.1|3157544_3161045_-	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	32.9	9.9e-45
WP_012445273.1|3161191_3164749_-	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	31.2	2.2e-39
WP_012445274.1|3165044_3168620_-	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	32.2	7.8e-37
WP_011258575.1|3168716_3169379_+	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
WP_011258574.1|3169375_3169939_+	cytochrome b	NA	NA	NA	NA	NA
WP_011258573.1|3169948_3170518_+	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
WP_011258572.1|3170842_3171232_+	excalibur calcium-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011408231.1|3171317_3171551_-	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_011258570.1|3171638_3173021_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_044756926.1|3174788_3176006_-	O-succinylhomoserine (thiol)-lyase	NA	NA	NA	NA	NA
WP_044756927.1|3176002_3177034_-	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_044756928.1|3177352_3178252_+	M23 family metallopeptidase	NA	A0A142F145	Bacillus_phage	37.9	3.2e-08
WP_011408227.1|3178384_3179989_+	peptide chain release factor 3	NA	NA	NA	NA	NA
WP_011258564.1|3180064_3180709_+	hemolysin III family protein	NA	NA	NA	NA	NA
WP_044749647.1|3181942_3183319_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	5.4e-79
>prophage 24
NZ_CP012947	Xanthomonas oryzae pv. oryzae strain PXO83 chromosome, complete genome	5025428	3229795	3311979	5025428	transposase,tRNA	Staphylococcus_prophage(16.67%)	55	NA	NA
WP_011407237.1|3229795_3230752_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_059317522.1|3230903_3231287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756939.1|3232192_3233437_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_012445311.1|3233433_3233712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075242902.1|3233789_3234191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408199.1|3234473_3234845_-	biotin/lipoyl-binding protein	NA	NA	NA	NA	NA
WP_041183382.1|3234841_3235108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_187301129.1|3235279_3235486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182545.1|3235553_3236510_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_011258527.1|3236876_3238340_+	glycoside hydrolase family 125 protein	NA	NA	NA	NA	NA
WP_011408197.1|3238475_3240818_+	glycoside hydrolase family 92 protein	NA	NA	NA	NA	NA
WP_011408196.1|3241097_3242939_+	beta-galactosidase	NA	NA	NA	NA	NA
WP_027703763.1|3242988_3245520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408193.1|3246137_3246338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012445314.1|3246395_3246716_-	RebB family R body protein	NA	NA	NA	NA	NA
WP_011258521.1|3247095_3248199_+	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_027703764.1|3248611_3250300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703765.1|3250409_3251141_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_027703766.1|3251137_3252202_-	isoaspartyl peptidase/L-asparaginase	NA	NA	NA	NA	NA
WP_115862280.1|3256850_3258170_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_044757453.1|3258302_3259385_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_044756940.1|3259396_3260020_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_044756941.1|3260270_3260747_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_011408184.1|3260780_3261983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756942.1|3261990_3268917_-	Hpt domain-containing protein	NA	W8CYM9	Bacillus_phage	31.1	2.9e-11
WP_011258510.1|3269030_3271067_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	42.1	2.1e-23
WP_003482487.1|3271106_3271637_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_011258508.1|3271636_3271999_-	response regulator	NA	A0A220YL79	Alteromonas_virus	26.8	9.0e-10
WP_005913706.1|3272016_3272418_-	twitching motility response regulator PilG	NA	NA	NA	NA	NA
WP_044756943.1|3272667_3273618_+	glutathione synthase	NA	NA	NA	NA	NA
WP_011258506.1|3273614_3274490_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_044757457.1|3274785_3275736_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	48.8	1.4e-65
WP_012445327.1|3275698_3276418_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_044756945.1|3276431_3278459_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	33.2	2.7e-95
WP_044756946.1|3278660_3279185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756947.1|3279197_3281642_-	penicillin-binding protein 1B	NA	NA	NA	NA	NA
WP_044756949.1|3281883_3283986_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_044757459.1|3284318_3285761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756951.1|3286050_3288237_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_002812057.1|3288526_3288607_+	pyrroloquinoline quinone precursor peptide PqqA	NA	NA	NA	NA	NA
WP_044756952.1|3288690_3289590_+	pyrroloquinoline quinone biosynthesis protein PqqB	NA	NA	NA	NA	NA
WP_011408174.1|3289586_3290339_+	pyrroloquinoline-quinone synthase PqqC	NA	NA	NA	NA	NA
WP_012445334.1|3290335_3290614_+	pyrroloquinoline quinone biosynthesis peptide chaperone PqqD	NA	NA	NA	NA	NA
WP_012445335.1|3290610_3291729_+	pyrroloquinoline quinone biosynthesis protein PqqE	NA	NA	NA	NA	NA
WP_011408171.1|3291791_3292304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703396.1|3292732_3294247_+	PhoPQ-regulated protein	NA	NA	NA	NA	NA
WP_044756953.1|3295688_3298343_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_044756954.1|3298563_3302685_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SDF7	Indivirus	28.5	5.6e-47
WP_011408166.1|3302786_3303332_+	DNA starvation/stationary phase protection protein	NA	A0A2H4N7L5	Lake_Baikal_phage	32.4	1.5e-16
WP_011258487.1|3303887_3305684_+	DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	35.5	1.5e-81
WP_011408165.1|3305822_3306320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703393.1|3306398_3306803_+	response regulator	NA	NA	NA	NA	NA
WP_008578058.1|3307433_3308108_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A088F6S9	Vibrio_phage	34.7	6.4e-25
WP_044756955.1|3308486_3309863_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	1.4e-58
WP_012443979.1|3310743_3311979_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
>prophage 25
NZ_CP012947	Xanthomonas oryzae pv. oryzae strain PXO83 chromosome, complete genome	5025428	3326030	3389790	5025428	transposase,tRNA	Ralstonia_phage(36.36%)	31	NA	NA
WP_011408113.1|3326030_3327797_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_011258426.1|3327954_3328731_+	DUF3011 domain-containing protein	NA	NA	NA	NA	NA
WP_012445361.1|3329228_3329522_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_044756958.1|3329962_3331201_+	MFS transporter	NA	NA	NA	NA	NA
WP_044756961.1|3333784_3335341_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_011258418.1|3336729_3338121_+	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_041182545.1|3339491_3340448_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_011258414.1|3341568_3344190_+	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.8	1.4e-30
WP_094187728.1|3346076_3346875_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_041182545.1|3350354_3351311_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_044756968.1|3351386_3352355_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	1.1e-99
WP_082322985.1|3352269_3352968_+	RHS repeat-associated core domain-containing protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.8	8.6e-25
WP_011258802.1|3353019_3353988_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_144408327.1|3354098_3354479_+	AHH domain-containing protein	NA	NA	NA	NA	NA
WP_109182069.1|3354545_3355865_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|3356064_3357033_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_115862281.1|3357169_3358489_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_041182545.1|3361108_3362065_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_157724567.1|3367261_3367534_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_041182622.1|3369113_3369689_-	SUKH-4 family immunity protein	NA	NA	NA	NA	NA
WP_044756972.1|3369692_3374387_-	RHS domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	48.6	1.5e-24
WP_044756973.1|3374530_3376150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444470.1|3376173_3378420_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	31.3	4.4e-54
WP_012444469.1|3378644_3380525_-	M61 family metallopeptidase	NA	NA	NA	NA	NA
WP_010365831.1|3380691_3381027_-	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_012444468.1|3381026_3381659_-	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_011408097.1|3381655_3383656_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_011258402.1|3383655_3384591_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_011258401.1|3385104_3386055_-	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_011408096.1|3386143_3386644_-	signal peptidase II	NA	NA	NA	NA	NA
WP_011258399.1|3386958_3389790_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SGW1	Hokovirus	22.2	4.1e-41
>prophage 26
NZ_CP012947	Xanthomonas oryzae pv. oryzae strain PXO83 chromosome, complete genome	5025428	3440421	3502302	5025428	transposase	Staphylococcus_prophage(12.5%)	42	NA	NA
WP_115862282.1|3440421_3441741_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_082322932.1|3442301_3442472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756487.1|3442592_3443807_-|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.7	8.2e-55
WP_011257031.1|3443978_3444947_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_128415435.1|3444998_3445487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756978.1|3445486_3448249_-	type IV secretion protein Rhs	NA	NA	NA	NA	NA
WP_041182545.1|3448272_3449229_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_115862283.1|3450744_3452064_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258344.1|3453114_3454947_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.3	1.2e-30
WP_011258343.1|3455078_3455669_-	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_059317473.1|3455734_3458791_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_059317474.1|3458787_3459891_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011258340.1|3459916_3460753_-	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_011408058.1|3460772_3462242_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_012444424.1|3462347_3463037_+	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	28.3	3.6e-07
WP_011408056.1|3463033_3464227_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	23.9	5.2e-22
WP_011258336.1|3464285_3465551_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_059317475.1|3465697_3467374_-	serine hydrolase	NA	NA	NA	NA	NA
WP_059317476.1|3467315_3467816_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_059317477.1|3469631_3470579_+	DMT family transporter	NA	NA	NA	NA	NA
WP_059317478.1|3470766_3471489_-	pseudouridine synthase	NA	NA	NA	NA	NA
WP_012444418.1|3471645_3474042_-	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	30.2	3.8e-11
WP_011258329.1|3474305_3476210_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	35.7	2.5e-58
WP_044757481.1|3476885_3477533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041183663.1|3477569_3477812_+	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_014502654.1|3478155_3478557_-	MAPEG family protein	NA	NA	NA	NA	NA
WP_027704130.1|3478582_3479116_-	DUF4019 domain-containing protein	NA	NA	NA	NA	NA
WP_044756983.1|3479518_3479773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258319.1|3482696_3483242_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A1S5V092	Saudi_moumouvirus	51.9	4.1e-14
WP_044756984.1|3483498_3484797_+	alkaline phosphatase family protein	NA	NA	NA	NA	NA
WP_011258317.1|3484923_3486369_+	chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	31.5	4.9e-14
WP_044756986.1|3486441_3487482_+	zinc-dependent alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_011408042.1|3487614_3487797_-	30S ribosomal protein THX	NA	NA	NA	NA	NA
WP_011258314.1|3488096_3488507_-	MerC domain-containing protein	NA	NA	NA	NA	NA
WP_044756988.1|3491135_3493517_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_059317479.1|3493743_3494715_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.5	1.2e-32
WP_094187725.1|3494766_3495177_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011258309.1|3495275_3496001_-	OmpA family protein	NA	G3M9Z0	Bacillus_virus	33.9	1.4e-09
WP_012444398.1|3496417_3497836_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0S949	Catovirus	31.7	3.3e-47
WP_059317480.1|3497938_3499369_-	replicative DNA helicase	NA	O80281	Escherichia_phage	53.4	8.5e-120
WP_011258306.1|3499590_3500145_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	35.3	1.1e-19
WP_011258305.1|3500361_3502302_-	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1B1ISV2	uncultured_Mediterranean_phage	30.5	4.4e-26
>prophage 27
NZ_CP012947	Xanthomonas oryzae pv. oryzae strain PXO83 chromosome, complete genome	5025428	3508651	3563712	5025428	transposase,tRNA	Staphylococcus_prophage(25.0%)	48	NA	NA
WP_011258297.1|3508651_3509482_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_027704135.1|3509554_3509983_+	cytochrome c	NA	NA	NA	NA	NA
WP_011408030.1|3510114_3510594_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_011258294.1|3510844_3511060_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	59.7	6.5e-16
WP_011258293.1|3511287_3511773_+	DUF456 domain-containing protein	NA	NA	NA	NA	NA
WP_011258291.1|3513334_3513538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408025.1|3514315_3514774_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011408024.1|3515179_3515686_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_011258289.1|3515699_3517103_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_075242217.1|3518288_3519020_-	nitrilase	NA	NA	NA	NA	NA
WP_044756990.1|3519093_3520050_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.6	6.2e-42
WP_011258802.1|3520633_3521602_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_115862284.1|3521801_3523121_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_082341210.1|3524442_3524595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408018.1|3524630_3525014_-	inner membrane CreD family protein	NA	NA	NA	NA	NA
WP_011258280.1|3525529_3526342_+	C1 family peptidase	NA	NA	NA	NA	NA
WP_044756991.1|3526402_3527461_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.2	7.6e-73
WP_044756992.1|3527455_3528625_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.8	8.3e-97
WP_161795362.1|3528667_3528793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408014.1|3528828_3529212_-	inner membrane CreD family protein	NA	NA	NA	NA	NA
WP_012444370.1|3529946_3530759_+	C1 family peptidase	NA	NA	NA	NA	NA
WP_115862285.1|3530829_3532149_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_044756993.1|3532270_3533329_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_044756994.1|3533456_3534176_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_011408011.1|3534611_3535520_+	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_014502625.1|3535931_3536474_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_044756996.1|3536876_3540341_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_125168745.1|3540572_3540791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258268.1|3540830_3541160_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_044756997.1|3541178_3543176_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_044756998.1|3543243_3545400_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	62.1	2.9e-10
WP_044756999.1|3545410_3545926_+	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_041182609.1|3545952_3547236_+	EAL domain-containing response regulator	NA	NA	NA	NA	NA
WP_012444362.1|3547240_3548047_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_012444361.1|3548043_3549183_+	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_044757000.1|3551130_3553188_-	M13 family peptidase	NA	E3T4I7	Cafeteria_roenbergensis_virus	31.6	1.2e-79
WP_042465485.1|3553520_3553772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044757001.1|3554123_3554873_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_012444354.1|3554976_3555690_+	deoxyribonuclease V	NA	NA	NA	NA	NA
WP_129215637.1|3555761_3556274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044757002.1|3556451_3557342_+	pirin family protein	NA	NA	NA	NA	NA
WP_024712501.1|3557588_3558050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044757003.1|3558394_3560803_-	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_044757486.1|3560799_3561366_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_154583424.1|3561437_3561590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044757004.1|3561586_3562171_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_154583424.1|3562224_3562377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182545.1|3562755_3563712_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
>prophage 28
NZ_CP012947	Xanthomonas oryzae pv. oryzae strain PXO83 chromosome, complete genome	5025428	3570873	3732916	5025428	transposase,tRNA	Staphylococcus_prophage(14.29%)	115	NA	NA
WP_011258802.1|3570873_3571842_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_041182394.1|3572671_3573220_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_080497155.1|3573614_3574220_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_011258248.1|3574212_3575160_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_059317483.1|3575156_3577580_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	29.0	3.1e-37
WP_041182545.1|3579028_3579985_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_075241467.1|3580049_3580628_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_044757005.1|3580696_3581557_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_059317524.1|3581611_3584434_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	28.8	3.2e-54
WP_012445686.1|3585049_3585907_-	pirin family protein	NA	NA	NA	NA	NA
WP_044757012.1|3586138_3588211_+	carbon starvation protein A	NA	NA	NA	NA	NA
WP_005926176.1|3588210_3588435_+	putative selenoprotein	NA	NA	NA	NA	NA
WP_044757492.1|3588972_3589677_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_115862286.1|3590028_3590994_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_173425342.1|3593440_3594988_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.9	1.2e-13
WP_011258239.1|3595270_3595807_-	single-stranded DNA-binding protein	NA	A0A1B1W281	Salmonella_phage	58.5	3.6e-31
WP_044757016.1|3596082_3597081_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_044757017.1|3597265_3598060_-	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_011258236.1|3598376_3599783_-	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_011258235.1|3599763_3601119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258234.1|3601115_3601574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044757019.1|3601557_3604167_-	bifunctional aspartate kinase/diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_012445697.1|3605266_3606148_+	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_027703692.1|3607246_3607846_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_011258228.1|3607998_3608433_-	OsmC family protein	NA	NA	NA	NA	NA
WP_011258227.1|3608907_3609855_-	aspartate carbamoyltransferase catalytic subunit	NA	NA	NA	NA	NA
WP_011407969.1|3609868_3610336_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_011258225.1|3610328_3610895_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_011407966.1|3612159_3612732_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_041182545.1|3612799_3613756_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_044757021.1|3614429_3615560_-	PilT/PilU family type 4a pilus ATPase	NA	NA	NA	NA	NA
WP_011258220.1|3615673_3616711_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_011407962.1|3617074_3617767_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_011407961.1|3617810_3618671_+	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_011258216.1|3620705_3621131_+	HU family DNA-binding protein	NA	NA	NA	NA	NA
WP_044757022.1|3621236_3621878_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_027703896.1|3621935_3622277_+	DUF3861 domain-containing protein	NA	NA	NA	NA	NA
WP_027703897.1|3622520_3622877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258212.1|3622932_3623529_+	DUF1439 domain-containing protein	NA	NA	NA	NA	NA
WP_099051294.1|3623646_3624027_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_011407955.1|3624133_3624352_-	peptidase	NA	NA	NA	NA	NA
WP_003487757.1|3624456_3624924_-	SET domain-containing protein-lysine N-methyltransferase	NA	NA	NA	NA	NA
WP_011407954.1|3625095_3625554_+	SUF system Fe-S cluster assembly regulator	NA	NA	NA	NA	NA
WP_044757023.1|3625569_3627027_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_011407952.1|3627284_3628049_+	Fe-S cluster assembly ATPase SufC	NA	W5SAS9	Pithovirus	28.9	1.6e-11
WP_011258208.1|3628048_3629311_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_011258207.1|3629307_3630552_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	41.9	2.3e-92
WP_011258206.1|3630760_3631300_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011258205.1|3631296_3631626_+	non-heme iron oxygenase ferredoxin subunit	NA	NA	NA	NA	NA
WP_011258203.1|3633510_3634527_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_125168743.1|3635247_3635514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_181690202.1|3635635_3635782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075239693.1|3635791_3636946_+	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
WP_011258200.1|3636945_3638268_+	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	NA	NA	NA	NA
WP_011407948.1|3638294_3639335_+	fatty acid desaturase family protein	NA	NA	NA	NA	NA
WP_011407947.1|3639352_3640213_+	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	NA	NA	NA	NA
WP_011407946.1|3640247_3640847_+	LysE family translocator	NA	NA	NA	NA	NA
WP_011258198.1|3640913_3641849_+	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_075239694.1|3641914_3643267_+	glutamine synthetase	NA	NA	NA	NA	NA
WP_082322987.1|3643358_3644543_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	6.5e-41
WP_011257310.1|3646231_3647467_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_044757028.1|3648652_3650977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044757029.1|3651001_3652870_-	ATP-binding protein	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	21.2	4.4e-15
WP_173340392.1|3653082_3654438_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011407938.1|3655274_3656066_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_044757030.1|3657117_3658593_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.4	2.9e-99
WP_033013356.1|3658675_3659494_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011258183.1|3660604_3661450_+	LysR family transcriptional regulator AmpR	NA	Q6JIH3	Burkholderia_virus	31.7	8.6e-11
WP_027703789.1|3661473_3661899_-	YcxB family protein	NA	NA	NA	NA	NA
WP_041182018.1|3662171_3664088_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	30.7	8.6e-67
WP_082322988.1|3665218_3666175_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	4.8e-42
WP_011258179.1|3668176_3668617_+	VOC family protein	NA	NA	NA	NA	NA
WP_011258178.1|3668890_3671278_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	32.9	9.2e-10
WP_012445735.1|3671610_3674010_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	33.3	4.9e-11
WP_012445737.1|3675108_3676818_+	Kef family K(+) transporter	NA	NA	NA	NA	NA
WP_162531725.1|3676981_3678083_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.3	5.0e-43
WP_011258173.1|3678227_3678989_+	4-hydroxy-2-oxovalerate aldolase	NA	NA	NA	NA	NA
WP_044757032.1|3678989_3681131_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_011258171.1|3681366_3682593_+	siderophore biosynthesis protein PvsA	NA	NA	NA	NA	NA
WP_011258170.1|3682589_3684392_+	IucA/IucC family siderophore biosynthesis protein	NA	NA	NA	NA	NA
WP_011258169.1|3684388_3685585_+	MFS transporter	NA	NA	NA	NA	NA
WP_027703817.1|3685562_3687332_+	iron transporter	NA	NA	NA	NA	NA
WP_027703818.1|3687328_3688525_+	type III PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_011258166.1|3688699_3689434_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_011258165.1|3689430_3690021_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_011407923.1|3690017_3691064_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_011258163.1|3691060_3691582_-	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_011258162.1|3692095_3692707_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_027703819.1|3692703_3693303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258160.1|3693302_3693896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258158.1|3695668_3697546_-	TonB-dependent vitamin B12 receptor	NA	A0A0P0I887	Acinetobacter_phage	29.5	4.9e-06
WP_109181892.1|3700603_3700753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044757036.1|3700783_3701695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407916.1|3701819_3704405_-	ATP-dependent chaperone ClpB	NA	A0A1C3S747	Escherichia_phage	35.4	3.8e-126
WP_011258151.1|3704850_3705156_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_012445759.1|3705185_3705461_+	glutathione transferase	NA	NA	NA	NA	NA
WP_094187788.1|3706146_3706944_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407913.1|3707638_3708853_-|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.8e-54
WP_011407912.1|3709272_3709680_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_044757505.1|3710020_3711511_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_044757038.1|3712136_3712544_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_044757039.1|3712667_3713447_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_011407909.1|3713547_3714060_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_011258141.1|3714103_3714361_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_011407908.1|3714470_3715268_-	aminotransferase class IV family protein	NA	NA	NA	NA	NA
WP_044757040.1|3715258_3716329_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_011407905.1|3717901_3719278_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_011407903.1|3720809_3721601_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_027704032.1|3721888_3722938_-	galactose mutarotase	NA	NA	NA	NA	NA
WP_044757042.1|3723185_3724769_+	alpha-N-arabinofuranosidase	NA	NA	NA	NA	NA
WP_115862287.1|3725266_3726232_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_144408330.1|3726922_3728020_-	HutD family protein	NA	NA	NA	NA	NA
WP_011258127.1|3729512_3729920_-	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011407897.1|3730044_3731538_+	M20 family metallopeptidase	NA	NA	NA	NA	NA
WP_044757045.1|3731857_3732916_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 29
NZ_CP012947	Xanthomonas oryzae pv. oryzae strain PXO83 chromosome, complete genome	5025428	3762073	3915654	5025428	transposase	Xanthomonas_phage(36.36%)	114	NA	NA
WP_011257570.1|3762073_3763309_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011258091.1|3763730_3765119_-	amino acid permease	NA	NA	NA	NA	NA
WP_011258090.1|3765874_3766816_-	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_011407882.1|3767129_3767894_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011407881.1|3768086_3769469_+	APC family permease	NA	NA	NA	NA	NA
WP_011258087.1|3769908_3771306_+	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_012445797.1|3771868_3772267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258085.1|3772411_3773416_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_011258084.1|3773453_3774971_-	tryptophan 7-halogenase	NA	A0A1D7SEI2	Cyanophage	32.3	8.1e-52
WP_044757048.1|3775011_3776058_-	cupin-like domain-containing protein	NA	NA	NA	NA	NA
WP_011407875.1|3776068_3776821_-	SapC family protein	NA	NA	NA	NA	NA
WP_011407874.1|3777152_3780311_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_044757049.1|3781357_3783364_-	M1 family metallopeptidase	NA	NA	NA	NA	NA
WP_011258079.1|3783583_3784030_-	redox-sensitive transcriptional activator SoxR	NA	NA	NA	NA	NA
WP_011258077.1|3786045_3787212_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	42.1	5.8e-74
WP_011407870.1|3787213_3787786_-	DUF1190 domain-containing protein	NA	A0A191ZBZ0	Erwinia_phage	27.7	1.1e-09
WP_011407869.1|3787798_3788203_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_027703609.1|3788240_3788918_-	YjfK family protein	NA	NA	NA	NA	NA
WP_027703610.1|3788914_3789997_-	potassium channel protein	NA	NA	NA	NA	NA
WP_011258072.1|3790022_3790796_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_012445807.1|3790808_3791225_-	YjfI family protein	NA	NA	NA	NA	NA
WP_011258070.1|3791405_3792005_-	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_011258069.1|3792171_3792714_+	shikimate kinase	NA	NA	NA	NA	NA
WP_059317488.1|3792710_3793823_+	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_011407864.1|3794124_3794376_+	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_011258066.1|3794390_3795455_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_059317489.1|3796926_3800643_+	TAL effector repeat-containing protein	NA	NA	NA	NA	NA
WP_012445814.1|3800911_3801106_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	80.6	8.8e-20
WP_011407856.1|3801109_3801409_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	93.5	9.9e-47
WP_044757051.1|3801632_3806081_+	TAL effector repeat-containing protein	NA	NA	NA	NA	NA
WP_042464821.1|3806349_3806544_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	82.3	3.9e-20
WP_011407858.1|3806547_3806847_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	92.4	1.4e-45
WP_044757052.1|3807070_3810481_+	TAL effector repeat-containing protein	NA	NA	NA	NA	NA
WP_041182763.1|3810749_3810944_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	92.2	2.5e-19
WP_011407856.1|3810947_3811247_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	93.5	9.9e-47
WP_011407855.1|3811470_3814479_+	TAL effector repeat-containing protein	NA	NA	NA	NA	NA
WP_041182763.1|3814747_3814942_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	92.2	2.5e-19
WP_011407856.1|3814945_3815245_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	93.5	9.9e-47
WP_044757053.1|3815468_3819596_+	TAL effector protein PthXo1	NA	NA	NA	NA	NA
WP_012444927.1|3819814_3819991_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_012445821.1|3819987_3820659_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	36.8	3.1e-24
WP_012445822.1|3820680_3821550_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.0	1.2e-28
WP_044757054.1|3822046_3825226_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_027703881.1|3825511_3826801_+	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_011407850.1|3830191_3830641_-	azurin	NA	NA	NA	NA	NA
WP_011407846.1|3832083_3832587_-	RidA family protein	NA	NA	NA	NA	NA
WP_011258050.1|3832611_3833037_-	cytochrome c	NA	NA	NA	NA	NA
WP_044757055.1|3833033_3834641_-	flavin monoamine oxidase family protein	NA	NA	NA	NA	NA
WP_011407844.1|3834710_3835055_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011407842.1|3836177_3836795_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_011258048.1|3837040_3838267_-	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	25.1	4.0e-17
WP_011258047.1|3838339_3839212_+	ion transporter	NA	NA	NA	NA	NA
WP_094187758.1|3840472_3841271_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407839.1|3841351_3842011_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_011407838.1|3842162_3844250_+	VTT domain-containing protein	NA	NA	NA	NA	NA
WP_012445831.1|3844425_3845406_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.5	3.7e-98
WP_012445833.1|3845809_3846727_+	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	32.7	1.3e-31
WP_094187728.1|3846769_3847567_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_027704066.1|3847792_3848182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407833.1|3848261_3848939_+	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	27.4	7.4e-05
WP_027704076.1|3849401_3850721_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_115801876.1|3850830_3851796_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011407830.1|3853035_3854037_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_153296750.1|3854693_3854834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445035.1|3855911_3857147_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_153296751.1|3857327_3857477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012445839.1|3859227_3860001_+	S1/P1 nuclease	NA	NA	NA	NA	NA
WP_011258028.1|3860014_3860845_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_011407824.1|3860915_3861692_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_027703578.1|3861708_3862395_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_011407823.1|3862394_3863009_+	molybdenum ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.0	2.1e-19
WP_011407822.1|3863351_3863936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703579.1|3863932_3865255_-	TonB family protein	NA	NA	NA	NA	NA
WP_011407820.1|3865244_3865610_-	BlaI/MecI/CopY family transcriptional regulator	NA	NA	NA	NA	NA
WP_027703580.1|3865709_3867071_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_044757056.1|3867088_3867787_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.0	9.8e-29
WP_044757057.1|3867809_3868472_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011407815.1|3868452_3869292_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011407814.1|3869291_3869966_-	iron-containing redox enzyme family protein	NA	NA	NA	NA	NA
WP_044757058.1|3869962_3871462_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_069960293.1|3871458_3872106_-	thermostable hemolysin	NA	NA	NA	NA	NA
WP_011258012.1|3874375_3875551_+	phosphatidylinositol-specific phospholipase C1-like protein	NA	NA	NA	NA	NA
WP_027703583.1|3875680_3878395_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_133264561.1|3878455_3878695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042464572.1|3878777_3879707_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_011258009.1|3879709_3880426_+	M23 family metallopeptidase	NA	A0A0M5M794	Arthrobacter_phage	34.2	2.7e-05
WP_011258007.1|3881244_3883245_-	transketolase	NA	NA	NA	NA	NA
WP_027703585.1|3883471_3884752_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_033013273.1|3884949_3885267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407804.1|3885562_3887320_-	BatD family protein	NA	NA	NA	NA	NA
WP_027703586.1|3887316_3889134_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_011258003.1|3889130_3890138_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_011258002.1|3890134_3890596_-	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_011258001.1|3890598_3891561_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_012445859.1|3891581_3892601_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_115862288.1|3893223_3894258_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011258092.1|3894328_3895564_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_094187728.1|3895706_3896504_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407796.1|3896575_3898525_-	type IV pilus secretin PilQ family protein	NA	NA	NA	NA	NA
WP_011257996.1|3898544_3899078_-	pilus assembly protein PilP	NA	NA	NA	NA	NA
WP_011257995.1|3899074_3899740_-	type 4a pilus biogenesis protein PilO	NA	NA	NA	NA	NA
WP_044757059.1|3899736_3900495_-	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_027703769.1|3900494_3901577_-	type IV pilus assembly protein PilM	NA	NA	NA	NA	NA
WP_011257992.1|3901768_3904198_+	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_041182719.1|3904265_3905222_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.8	3.7e-42
WP_011407794.1|3905566_3906217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407793.1|3906593_3907883_-	citrate synthase	NA	NA	NA	NA	NA
WP_005911911.1|3908096_3908339_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_044757060.1|3908410_3909349_-	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_011257988.1|3909474_3911628_-	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_011257987.1|3911648_3912029_-	RidA family protein	NA	NA	NA	NA	NA
WP_011257986.1|3912108_3914280_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	38.8	2.8e-13
WP_011407791.1|3914408_3914708_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_094187796.1|3914855_3915654_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 30
NZ_CP012947	Xanthomonas oryzae pv. oryzae strain PXO83 chromosome, complete genome	5025428	3974848	4038991	5025428	transposase,integrase,protease	Ralstonia_phage(20.0%)	51	3974286:3974345	4037114:4037178
3974286:3974345	attL	CCTAAGAACCTGTTCACGATCTCCTGAGCAGCAGTGCCAGGAACGCCAGGTGGATGAACT	NA	NA	NA	NA
WP_044757070.1|3974848_3976084_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_044757071.1|3977072_3978674_+	rhamnogalacturonase B	NA	NA	NA	NA	NA
WP_041182379.1|3979290_3980037_-	cellulase	NA	NA	NA	NA	NA
WP_113195645.1|3980509_3981268_-	cellulase	NA	NA	NA	NA	NA
WP_011407749.1|3981784_3982300_-	peptide deformylase	NA	NA	NA	NA	NA
WP_044757517.1|3982621_3983044_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	61.9	5.2e-41
WP_012445908.1|3983815_3985684_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_011407746.1|3985722_3986676_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_011257917.1|3986681_3987638_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_011257916.1|3987630_3989583_+	DUF3488 domain-containing transglutaminase family protein	NA	NA	NA	NA	NA
WP_011257915.1|3989579_3990113_+	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_011407744.1|3990232_3990583_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_011257913.1|3990684_3991278_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_011257912.1|3991375_3991696_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_044757072.1|3991702_3993799_-	DNA polymerase III subunit gamma/tau	NA	E7DN81	Pneumococcus_phage	40.7	4.1e-46
WP_044757073.1|3994360_3994807_-	molybdenum cofactor biosynthesis protein MoaE	NA	NA	NA	NA	NA
WP_011257909.1|3994803_3995049_-	MoaD/ThiS family protein	NA	NA	NA	NA	NA
WP_011407742.1|3995045_3995543_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_011257907.1|3995567_3995927_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_044757074.1|3995944_3996976_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_011257905.1|3996975_3997725_-	MBL fold metallo-hydrolase	NA	A0A0A0RUN7	Bacillus_phage	26.0	2.4e-09
WP_011257904.1|3997724_3998474_-	3-deoxy-D-manno-octulosonic acid kinase	NA	NA	NA	NA	NA
WP_011257903.1|3998494_3999544_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_011257902.1|3999754_4000159_-	hypothetical protein	NA	A0A1C9C5K8	Heterosigma_akashiwo_virus	35.9	5.0e-17
WP_011257901.1|4000200_4000956_+|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	52.2	2.1e-61
WP_115862289.1|4001054_4002020_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011257899.1|4002102_4002660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075239641.1|4002721_4002985_-	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	43.4	7.5e-06
WP_044757075.1|4002981_4004676_-	DUF2875 family protein	NA	NA	NA	NA	NA
WP_044757076.1|4004672_4006880_-	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	28.2	2.0e-19
WP_044757078.1|4007199_4008897_-	DUF2875 family protein	NA	NA	NA	NA	NA
WP_059317525.1|4008893_4011044_-	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	28.2	2.0e-27
WP_044757079.1|4011111_4013835_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	30.3	9.7e-72
WP_012445927.1|4014230_4014431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407730.1|4015323_4015953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012445930.1|4016779_4017484_+	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_011257889.1|4017919_4018654_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	40.4	8.7e-36
WP_011257888.1|4018662_4019115_-	ribonuclease HI	NA	A0A1Q2U2R0	Vibrio_phage	55.4	2.8e-40
WP_011257887.1|4019142_4019799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257886.1|4019811_4020579_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_044757080.1|4020575_4021754_+	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_011407728.1|4022452_4024423_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_002806049.1|4025254_4025527_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	64.0	2.2e-21
WP_012445937.1|4025740_4028212_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.2	1.7e-224
WP_011257881.1|4028355_4029642_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.9	9.0e-137
WP_002806026.1|4029766_4030393_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.4	1.0e-56
WP_012445939.1|4030485_4031778_-	trigger factor	NA	NA	NA	NA	NA
WP_011257875.1|4035095_4035857_+	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_011257874.1|4036000_4037008_-	isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_148648659.1|4037271_4038237_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
4037114:4037178	attR	CCTAAGAACCTGTTCACGATCTCCTGAGCAGCAGTGCCAGGAACGCCAGGTGGATGAACTGCAAG	NA	NA	NA	NA
WP_094187737.1|4038237_4038991_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 31
NZ_CP012947	Xanthomonas oryzae pv. oryzae strain PXO83 chromosome, complete genome	5025428	4088359	4127430	5025428	transposase,protease	Ralstonia_phage(25.0%)	23	NA	NA
WP_011409560.1|4088359_4089322_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_012445975.1|4090183_4090426_+	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_011407721.1|4090974_4091436_+	cell wall hydrolase	NA	NA	NA	NA	NA
WP_011258802.1|4091696_4092665_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_094187763.1|4094061_4094860_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257834.1|4095101_4095716_+	glutathione S-transferase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_011257835.1|4095798_4096785_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_011257836.1|4096900_4097395_-	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	52.3	5.5e-26
WP_011257837.1|4097639_4099469_+	translational GTPase TypA	NA	NA	NA	NA	NA
WP_011257838.1|4099538_4099958_+	DUF2127 domain-containing protein	NA	NA	NA	NA	NA
WP_011257840.1|4100880_4102008_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_011257841.1|4102108_4103491_-	3-deoxy-7-phosphoheptulonate synthase class II	NA	NA	NA	NA	NA
WP_044757084.1|4103738_4105862_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011407706.1|4106390_4106909_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_011257570.1|4109231_4110467_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_044757085.1|4111080_4111971_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_115862291.1|4114570_4115890_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_094187858.1|4116634_4117558_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	33.1	5.8e-37
WP_094187763.1|4117745_4118543_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_115877379.1|4120305_4121271_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_012445996.1|4121599_4123150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044757086.1|4124047_4125262_+|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.8e-54
WP_094187798.1|4126632_4127430_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 32
NZ_CP012947	Xanthomonas oryzae pv. oryzae strain PXO83 chromosome, complete genome	5025428	4136360	4192902	5025428	transposase,protease	Acinetobacter_phage(20.0%)	40	NA	NA
WP_041182780.1|4136360_4137326_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011407697.1|4139567_4140050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257818.1|4140246_4140783_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	53.6	3.6e-47
WP_011257817.1|4140896_4142045_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_041182545.1|4142571_4143528_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_011407696.1|4143717_4146684_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	24.9	8.7e-42
WP_011407695.1|4146732_4147626_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011407693.1|4150513_4152391_-	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_011257812.1|4153667_4154669_+	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_011257811.1|4154712_4156434_+	acetolactate synthase 2 catalytic subunit	NA	E4WLQ6	Ostreococcus_tauri_virus	32.9	6.1e-64
WP_011257810.1|4156417_4156675_+	acetolactate synthase	NA	NA	NA	NA	NA
WP_044757088.1|4156750_4157875_+	threonine dehydratase	NA	NA	NA	NA	NA
WP_011407690.1|4157871_4159434_+	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	24.4	4.3e-08
WP_011257808.1|4159764_4160838_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_011257807.1|4161654_4162302_-	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_011257806.1|4162369_4163818_-	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_027703665.1|4163938_4164823_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_115862292.1|4165814_4166780_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011407687.1|4166948_4167410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257800.1|4167679_4168333_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011407686.1|4168461_4169118_+	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_011257798.1|4169138_4170518_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_011257797.1|4170790_4172107_-	lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_011257796.1|4172183_4173104_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase	NA	NA	NA	NA	NA
WP_011257795.1|4173337_4174672_-	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_011407685.1|4174652_4175765_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_011257793.1|4175774_4175972_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_103057263.1|4176097_4176631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257791.1|4177257_4177893_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011257788.1|4179623_4180406_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_044757089.1|4180599_4183272_-	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	28.0	7.5e-77
WP_044757090.1|4183598_4184891_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	37.7	4.9e-74
WP_011257785.1|4185228_4185414_-	DUF2065 family protein	NA	NA	NA	NA	NA
WP_027703756.1|4185707_4186571_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_011407680.1|4186570_4187698_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_011257782.1|4188327_4188714_-	twitching motility response regulator PilH	NA	W8CYM9	Bacillus_phage	31.8	9.6e-10
WP_011257781.1|4188953_4189853_-	DnaJ domain-containing protein	NA	A0A2L0UZR4	Agrobacterium_phage	27.7	5.9e-18
WP_011407679.1|4190263_4190740_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_011257779.1|4190902_4191385_+	peroxiredoxin	NA	A0A1D8KSL1	Synechococcus_phage	36.2	3.1e-21
WP_094187801.1|4192103_4192902_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 33
NZ_CP012947	Xanthomonas oryzae pv. oryzae strain PXO83 chromosome, complete genome	5025428	4225134	4299395	5025428	transposase,tRNA	Ralstonia_phage(16.67%)	49	NA	NA
WP_059317495.1|4225134_4226100_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_044757098.1|4226211_4228503_+	CRISPR-associated helicase/endonuclease Cas3	NA	NA	NA	NA	NA
WP_011257746.1|4228630_4229305_+	type I-C CRISPR-associated protein Cas5	NA	NA	NA	NA	NA
WP_044757099.1|4229301_4231146_+	type I-C CRISPR-associated protein Cas8c/Csd1	NA	NA	NA	NA	NA
WP_011257744.1|4231142_4232009_+	type I-C CRISPR-associated protein Cas7/Csd2	NA	NA	NA	NA	NA
WP_011257743.1|4232028_4232661_+	CRISPR-associated protein Cas4	NA	NA	NA	NA	NA
WP_011407655.1|4232663_4233698_+	type I-C CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_011257741.1|4233712_4234003_+	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
WP_011407652.1|4241162_4242002_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_011407650.1|4242612_4243770_+	phosphotransferase	NA	NA	NA	NA	NA
WP_044757100.1|4243805_4245968_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011407648.1|4246343_4246919_+	nicotinamide mononucleotide transporter	NA	NA	NA	NA	NA
WP_011257733.1|4247024_4247753_+	UTRA domain-containing protein	NA	NA	NA	NA	NA
WP_011257732.1|4248176_4249016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257731.1|4249012_4251325_-	type II secretion system secretin GspD	NA	A7BJX1	Enterobacteria_phage	23.5	5.2e-10
WP_011407647.1|4251321_4252131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407646.1|4252120_4252774_-	type II secretion system protein M	NA	NA	NA	NA	NA
WP_011407645.1|4252757_4253879_-	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_011407644.1|4253875_4254727_-	general secretion pathway protein GspK	NA	NA	NA	NA	NA
WP_011257726.1|4254723_4255359_-	type II secretion system protein J	NA	NA	NA	NA	NA
WP_012446066.1|4255355_4255772_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_011257724.1|4255768_4256278_-	GspH/FimT family pseudopilin	NA	NA	NA	NA	NA
WP_011407642.1|4256287_4256719_-	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_044757101.1|4256986_4258204_-	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_012446069.1|4258379_4260107_-	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_012446070.1|4260236_4260767_-	PPC domain-containing protein	NA	NA	NA	NA	NA
WP_012446071.1|4260799_4261312_-	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	38.8	5.7e-10
WP_011407636.1|4262339_4266137_-	YadA-like family protein	NA	NA	NA	NA	NA
WP_044757102.1|4267114_4271167_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.1	3.4e-121
WP_011257718.1|4271565_4272363_-	DsbC family protein	NA	NA	NA	NA	NA
WP_011257717.1|4272814_4273786_-	site-specific tyrosine recombinase XerD	NA	G1JX48	Mycobacterium_phage	27.9	6.4e-18
WP_011257716.1|4274212_4274680_+	RDD family protein	NA	NA	NA	NA	NA
WP_011407635.1|4275094_4276201_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_011407634.1|4276197_4277280_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_059317496.1|4277387_4278860_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	37.2	6.2e-49
WP_011257711.1|4279205_4279631_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_044757104.1|4279838_4282781_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	34.8	8.4e-130
WP_027704099.1|4282788_4283091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187802.1|4283717_4284818_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.3	2.1e-41
WP_075244150.1|4285005_4285320_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_115862293.1|4285386_4286706_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258529.1|4286842_4287811_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_115862294.1|4288010_4289330_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_044757108.1|4289649_4290690_+	pectate lyase	NA	NA	NA	NA	NA
WP_027704044.1|4290956_4292930_-	transglycosylase SLT domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	36.7	7.9e-15
WP_115862295.1|4293229_4294549_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|4294698_4295667_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_059317497.1|4295743_4296700_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	4.8e-42
WP_011407913.1|4298180_4299395_-|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.8e-54
>prophage 34
NZ_CP012947	Xanthomonas oryzae pv. oryzae strain PXO83 chromosome, complete genome	5025428	4316512	4327140	5025428		Enterobacteria_phage(42.86%)	10	NA	NA
WP_011407616.1|4316512_4317859_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	26.9	2.6e-33
WP_011257680.1|4317905_4319309_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.6	2.5e-47
WP_011257679.1|4319425_4320334_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.7	2.4e-27
WP_011257678.1|4320330_4320888_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	48.1	1.0e-44
WP_011407613.1|4320884_4321772_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	58.2	2.2e-94
WP_011407612.1|4321827_4322883_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	48.0	4.3e-84
WP_011257675.1|4323108_4323855_+	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_011257674.1|4323854_4324796_+	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_011407611.1|4325018_4325837_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_011407610.1|4325826_4327140_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	3.8e-13
>prophage 35
NZ_CP012947	Xanthomonas oryzae pv. oryzae strain PXO83 chromosome, complete genome	5025428	4455223	4502485	5025428	transposase	Acinetobacter_phage(50.0%)	46	NA	NA
WP_094187763.1|4455223_4456021_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012446191.1|4457886_4458135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044757130.1|4458146_4459961_-	methyltransferase	NA	NA	NA	NA	NA
WP_011407528.1|4460081_4460462_+	response regulator	NA	NA	NA	NA	NA
WP_011257545.1|4460430_4460697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407527.1|4460696_4461977_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_044757132.1|4462123_4462339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407526.1|4463093_4464503_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_044757134.1|4464493_4465510_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_075240101.1|4465678_4465945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165967674.1|4466879_4468331_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_012443955.1|4468601_4469570_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	2.5e-99
WP_115862298.1|4469719_4471039_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_153296753.1|4471109_4471274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703827.1|4471273_4471507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033013369.1|4471764_4472811_+	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_044757138.1|4472994_4474575_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_011409570.1|4474963_4475860_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_011260477.1|4475862_4477026_-	COX15/CtaA family protein	NA	NA	NA	NA	NA
WP_011260478.1|4477036_4477612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012443950.1|4477639_4478359_-	SURF1 family protein	NA	NA	NA	NA	NA
WP_012443949.1|4478419_4478638_+	twin transmembrane helix small protein	NA	NA	NA	NA	NA
WP_011260481.1|4478737_4479613_-	cytochrome c oxidase subunit 3	NA	NA	NA	NA	NA
WP_012443948.1|4479651_4480248_-	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_011409573.1|4480244_4480418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260484.1|4480398_4482003_-	cytochrome c oxidase subunit I	NA	NA	NA	NA	NA
WP_011260485.1|4482041_4482995_-	cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
WP_044757542.1|4483011_4483488_-	DUF2244 domain-containing protein	NA	NA	NA	NA	NA
WP_011260487.1|4483764_4486965_+	bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA	NA	NA	NA	NA	NA
WP_094187805.1|4487124_4488103_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	1.9e-38
WP_003483093.1|4489160_4489631_-	bacterioferritin	NA	NA	NA	NA	NA
WP_027703893.1|4489973_4490189_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_011260490.1|4490269_4490887_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_005990700.1|4491435_4491828_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_011260491.1|4491831_4492260_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_011260492.1|4492445_4493099_+	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_011409578.1|4493374_4493689_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_011260494.1|4493848_4494643_-	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_011260495.1|4494780_4495473_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_011409579.1|4495793_4496510_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_027703892.1|4496502_4497375_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	52.3	2.1e-65
WP_011409580.1|4497436_4498474_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	44.1	7.2e-76
WP_011260499.1|4498591_4499221_-	flavin reductase family protein	NA	NA	NA	NA	NA
WP_011409581.1|4499372_4499954_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	59.3	3.2e-65
WP_080493584.1|4500659_4501484_+	conjugal transfer protein TraG N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_094187806.1|4501383_4502485_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.5	1.1e-39
>prophage 36
NZ_CP012947	Xanthomonas oryzae pv. oryzae strain PXO83 chromosome, complete genome	5025428	4507371	4567264	5025428	transposase,integrase,tRNA	Vibrio_phage(15.38%)	52	4511584:4511600	4559962:4559978
WP_044757142.1|4507371_4508748_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	1.9e-79
WP_041182574.1|4509042_4509999_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.1	4.5e-40
4511584:4511600	attL	GCGTAGTGCTGCGTCAT	NA	NA	NA	NA
WP_011407508.1|4513304_4513550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257521.1|4513546_4513819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257520.1|4513815_4514022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407507.1|4514242_4515430_+|integrase	integrase	integrase	V9IQN0	Stenotrophomonas_phage	50.3	1.0e-110
WP_044757143.1|4515689_4516487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041181951.1|4516483_4517758_-	DNA cytosine methyltransferase	NA	A0A191SB20	Nostoc_phage	37.4	8.3e-58
WP_011257516.1|4517838_4518249_-	DNA mismatch endonuclease Vsr	NA	I6NSG0	Burkholderia_phage	52.0	7.0e-35
WP_011257515.1|4519561_4519720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041181950.1|4519716_4520019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044757144.1|4520025_4521111_-	type IV secretion system protein	NA	NA	NA	NA	NA
WP_044757145.1|4521112_4521373_-	EexN family lipoprotein	NA	NA	NA	NA	NA
WP_044757146.1|4521369_4521849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044757147.1|4521862_4522582_-	P-type DNA transfer protein VirB5	NA	NA	NA	NA	NA
WP_165967658.1|4522796_4522952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044757149.1|4523213_4524053_-	helix-turn-helix domain-containing protein	NA	R9TPU9	Vibrio_phage	40.0	8.0e-09
WP_041181948.1|4524521_4525616_-|integrase	site-specific integrase	integrase	A0A1L7DQ84	Ralstonia_phage	36.9	2.6e-52
WP_011407506.1|4526365_4526686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407505.1|4526878_4528753_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	35.5	1.8e-37
WP_011257505.1|4528861_4529302_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_011257504.1|4529300_4530317_+	lauroyl acyltransferase	NA	NA	NA	NA	NA
WP_011407503.1|4530516_4531038_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011257502.1|4531280_4532414_+	GTP cyclohydrolase II RibA	NA	A0A2H4PQS2	Staphylococcus_phage	44.2	6.1e-28
WP_048488816.1|4532523_4533033_+	PH domain-containing protein	NA	NA	NA	NA	NA
WP_012443970.1|4533029_4534535_+	PH domain-containing protein	NA	NA	NA	NA	NA
WP_113090124.1|4534700_4535759_-	UDP-N-acetylglucosamine 2-epimerase	NA	NA	NA	NA	NA
WP_011257498.1|4535759_4536584_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_011257497.1|4536781_4538059_-	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_059317501.1|4538223_4539945_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_011407500.1|4539995_4541309_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_011257494.1|4541308_4542232_-|tRNA	methionyl-tRNA formyltransferase	tRNA	NA	NA	NA	NA
WP_027703439.1|4542625_4543138_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	43.0	2.6e-18
WP_011407499.1|4543270_4544407_+	LysM peptidoglycan-binding domain-containing protein	NA	G3MBQ1	Bacillus_virus	57.1	1.7e-09
WP_011257491.1|4544478_4545621_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_011257490.1|4545663_4546137_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_041181947.1|4546177_4546900_+	pilin	NA	NA	NA	NA	NA
WP_011257488.1|4546941_4548216_+	RDD family protein	NA	NA	NA	NA	NA
WP_011257487.1|4548398_4550891_+	DNA topoisomerase I	NA	A0A0G2YA05	Acanthamoeba_polyphaga_mimivirus	35.1	1.9e-114
WP_011257486.1|4550901_4551465_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_011407497.1|4551688_4552462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173425352.1|4552485_4553133_+	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
WP_011407495.1|4553294_4554071_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011257482.1|4554177_4554393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041181946.1|4554578_4556480_-	signal peptide peptidase SppA	NA	A0A291AUM2	Sinorhizobium_phage	28.3	8.1e-09
WP_059317502.1|4556564_4557941_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_011257479.1|4558449_4559295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012443959.1|4559625_4560228_-	DUF3106 domain-containing protein	NA	NA	NA	NA	NA
4559962:4559978	attR	ATGACGCAGCACTACGC	NA	NA	NA	NA
WP_011257477.1|4560211_4561237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044757158.1|4561702_4563925_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_011257475.1|4564327_4564843_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_115862299.1|4566298_4567264_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 37
NZ_CP012947	Xanthomonas oryzae pv. oryzae strain PXO83 chromosome, complete genome	5025428	4745448	4900982	5025428	holin,transposase,tRNA	Tupanvirus(10.53%)	100	NA	NA
WP_011257354.1|4745448_4746453_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_012446316.1|4746915_4747140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257351.1|4747860_4748436_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_027704120.1|4748494_4750000_-	catalase	NA	A0A2K9L0T1	Tupanvirus	48.0	1.6e-97
WP_011257349.1|4750708_4751179_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011407399.1|4752389_4752656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258802.1|4752736_4753705_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_115862308.1|4753904_4755224_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_044757197.1|4755566_4757699_-	ATP-dependent DNA helicase DinG	NA	NA	NA	NA	NA
WP_011257344.1|4757976_4758126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257343.1|4758160_4758559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257342.1|4758548_4759400_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_041181934.1|4759452_4760334_+	PD40 domain-containing protein	NA	NA	NA	NA	NA
WP_011257339.1|4760956_4763491_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_011407395.1|4763724_4764477_+	DNA/RNA non-specific endonuclease	NA	H6X497	Enterobacteria_phage	33.9	5.6e-22
WP_011407394.1|4764604_4765519_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011407393.1|4766791_4767784_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_011257333.1|4768448_4768907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041181932.1|4769006_4770797_-	DUF885 domain-containing protein	NA	NA	NA	NA	NA
WP_027703506.1|4771005_4773243_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_011257330.1|4773667_4774357_-	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_044757561.1|4774746_4777761_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011407388.1|4777944_4778646_+	SapC family protein	NA	NA	NA	NA	NA
WP_011257326.1|4778635_4779649_+	cupin-like domain-containing protein	NA	NA	NA	NA	NA
WP_041181930.1|4779659_4781225_+	tryptophan 7-halogenase	NA	E3SL43	Synechococcus_phage	28.8	7.3e-40
WP_044757199.1|4781364_4782375_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_011257323.1|4782784_4783978_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_012446337.1|4783974_4784721_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	1.5e-19
WP_027703503.1|4784752_4786354_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011257320.1|4786414_4786615_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_027703502.1|4786611_4787199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153296754.1|4787402_4787564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407380.1|4787684_4787957_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_027703501.1|4788022_4789012_+	CDF family Co(II)/Ni(II) efflux transporter DmeF	NA	NA	NA	NA	NA
WP_027703500.1|4789096_4789924_-	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_011257314.1|4789960_4790956_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.0	9.4e-25
WP_011257313.1|4790952_4791765_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_011257312.1|4791728_4792517_+	DUF3800 domain-containing protein	NA	A0A1W6JTE9	Pseudomonas_phage	44.4	4.5e-54
WP_012446345.1|4792635_4793574_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_011257310.1|4794000_4795236_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_082322992.1|4795288_4796455_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_094187862.1|4799088_4800190_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	4.7e-41
WP_041182545.1|4800312_4801269_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_094187814.1|4802831_4803629_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407366.1|4803981_4804266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044757202.1|4806612_4807722_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_044757204.1|4807956_4808601_+	SCP2 sterol-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011257293.1|4808597_4810271_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5EQY1	Bathycoccus_sp._RCC1105_virus	28.6	3.1e-28
WP_011257292.1|4810384_4810774_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_171970795.1|4810917_4811751_+	pseudouridylate synthase	NA	NA	NA	NA	NA
WP_011407361.1|4811846_4812425_-	DUF2059 domain-containing protein	NA	NA	NA	NA	NA
WP_011407360.1|4812481_4812913_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_011407359.1|4812915_4813545_+|holin	lysophosphatidylcholine acyltransferase	holin	NA	NA	NA	NA
WP_044757206.1|4813574_4813775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042464365.1|4814181_4816350_+	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_011257286.1|4816476_4818639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109181928.1|4819465_4820431_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011257284.1|4820623_4822105_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.0	2.7e-100
WP_011257283.1|4822541_4822901_-	L-fucose mutarotase	NA	NA	NA	NA	NA
WP_011407355.1|4822903_4824205_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_011407354.1|4824385_4825162_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011407353.1|4826454_4827039_+	manganese efflux pump MntP family protein	NA	NA	NA	NA	NA
WP_011407352.1|4827231_4830684_-	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
WP_044757210.1|4831428_4834071_+	glycosyl hydrolase 115 family protein	NA	NA	NA	NA	NA
WP_044757567.1|4834174_4836574_-	NdvB protein	NA	NA	NA	NA	NA
WP_027703801.1|4836576_4837959_-	MFS transporter	NA	NA	NA	NA	NA
WP_027703800.1|4838116_4838701_+	gluconokinase	NA	NA	NA	NA	NA
WP_044757212.1|4839586_4841341_+	PQQ-binding-like beta-propeller repeat protein	NA	A0A0M4JT37	Mollivirus	35.6	7.3e-81
WP_011257273.1|4841648_4841876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407344.1|4841856_4842306_-	3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_011257271.1|4842316_4842745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115862301.1|4844239_4845559_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258188.1|4848430_4849399_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_115862302.1|4850681_4852001_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_012445230.1|4852293_4853529_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_059317507.1|4855210_4856167_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.4	1.0e-39
WP_115862304.1|4857011_4857977_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_044757224.1|4857994_4858552_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011257259.1|4858570_4858858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407332.1|4859242_4860037_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	27.8	1.7e-08
WP_011257257.1|4860036_4860786_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_012446379.1|4860797_4861349_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_011257255.1|4861345_4862008_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011257254.1|4861997_4862288_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_011257253.1|4862298_4863357_+	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_044757229.1|4866023_4866986_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011407325.1|4867332_4868148_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	27.3	6.3e-19
WP_044757236.1|4877493_4879398_-	GAF domain-containing protein	NA	Q6XLU9	Feldmannia_irregularis_virus	27.7	3.9e-19
WP_011407319.1|4879394_4879997_-	biliverdin-producing heme oxygenase	NA	NA	NA	NA	NA
WP_011407318.1|4880056_4881361_-	tetracycline resistance MFS efflux pump	NA	NA	NA	NA	NA
WP_011257243.1|4881908_4884071_-	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_011407316.1|4884364_4884571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257241.1|4884778_4885168_-	YchJ family protein	NA	NA	NA	NA	NA
WP_011257239.1|4886512_4887643_-	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_011257238.1|4888290_4889343_-	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_011257237.1|4890105_4891179_-	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_011407313.1|4891486_4892545_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	45.7	3.0e-77
WP_011407913.1|4893775_4894990_-|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.8e-54
WP_041182826.1|4896718_4897252_+	lipocalin family protein	NA	NA	NA	NA	NA
WP_094187728.1|4900183_4900982_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 38
NZ_CP012947	Xanthomonas oryzae pv. oryzae strain PXO83 chromosome, complete genome	5025428	4954348	5013594	5025428	transposase,protease	Ralstonia_virus(18.18%)	44	NA	NA
WP_115862307.1|4954348_4955314_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011260840.1|4955489_4956905_-	amino acid permease	NA	NA	NA	NA	NA
WP_011260841.1|4957395_4959720_+	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_044757575.1|4960077_4960488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044757577.1|4960865_4961411_+	glutathione peroxidase	NA	Q70H87	Fowlpox_virus	33.9	2.6e-16
WP_044757259.1|4961506_4962883_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	1.1e-76
WP_011260845.1|4963919_4965047_-	PA0069 family radical SAM protein	NA	NA	NA	NA	NA
WP_011409820.1|4965902_4967243_-	outer membrane protein transport protein	NA	NA	NA	NA	NA
WP_011409821.1|4967458_4968151_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_011409822.1|4968274_4968595_+	DUF1820 family protein	NA	NA	NA	NA	NA
WP_011260850.1|4968594_4969587_+	D-2-hydroxyacid dehydrogenase family protein	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	27.4	8.5e-10
WP_011409823.1|4969893_4971417_-	PDZ domain-containing protein	NA	A0A0R6PIZ1	Moraxella_phage	29.2	1.7e-25
WP_027703885.1|4971521_4972820_-	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_011260853.1|4972917_4973574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044757261.1|4973724_4975536_+	M28 family peptidase	NA	NA	NA	NA	NA
WP_011409826.1|4975683_4976034_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_115862308.1|4976212_4977532_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_042465377.1|4978944_4980126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409829.1|4980223_4983655_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_011409830.1|4983802_4984501_-	DUF4194 domain-containing protein	NA	NA	NA	NA	NA
WP_011409831.1|4984484_4985957_-	DUF3375 domain-containing protein	NA	NA	NA	NA	NA
WP_044757264.1|4985953_4986541_-	DUF4276 family protein	NA	NA	NA	NA	NA
WP_044757265.1|4986540_4987737_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_041182832.1|4987810_4988413_-	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	48.9	2.0e-46
WP_103057218.1|4989120_4989648_+	TolC family protein	NA	NA	NA	NA	NA
WP_011409837.1|4989644_4990211_+	FUSC family protein	NA	NA	NA	NA	NA
WP_011409838.1|4990486_4991848_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	26.9	8.3e-32
WP_082322996.1|4992109_4993066_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.7	2.4e-41
WP_011409842.1|4995155_4995362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409843.1|4995348_4996461_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_049756351.1|4998812_4999565_-	immunity 52 family protein	NA	NA	NA	NA	NA
WP_011409848.1|4999561_5000269_-	hypothetical protein	NA	A4PE25	Ralstonia_virus	34.6	2.0e-08
WP_041182345.1|5000282_5000624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044757268.1|5000604_5001114_-	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	34.4	4.8e-09
WP_069960357.1|5001110_5001512_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_005921785.1|5002857_5003079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012446478.1|5003972_5004158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044757270.1|5005190_5006360_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	39.0	1.3e-41
WP_041182532.1|5006385_5007696_-	MFS transporter	NA	NA	NA	NA	NA
WP_011260881.1|5008072_5009407_-	membrane dipeptidase	NA	NA	NA	NA	NA
WP_010364861.1|5009608_5009929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027704146.1|5010047_5011214_-	class I SAM-dependent rRNA methyltransferase	NA	NA	NA	NA	NA
WP_011260885.1|5011477_5012434_+	TerC family protein	NA	K4F9T9	Cronobacter_phage	29.9	8.4e-31
WP_011260886.1|5012808_5013594_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
