The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011145	Bacillus cereus strain FORC_013 chromosome, complete genome	5418913	641983	649669	5418913		uncultured_Caudovirales_phage(16.67%)	10	NA	NA
WP_001036848.1|641983_642967_+	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	27.2	1.1e-17
WP_000403758.1|642956_643727_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.1	3.7e-13
WP_001086120.1|643759_644524_+	class B sortase	NA	NA	NA	NA	NA
WP_000587818.1|644596_644920_-	heme oxygenase	NA	NA	NA	NA	NA
WP_006916399.1|645215_646415_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	41.2	4.7e-71
WP_001014310.1|646453_646648_-	YwbE family protein	NA	NA	NA	NA	NA
WP_001293578.1|646648_646822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000018056.1|646990_647683_+	response regulator transcription factor	NA	B5LWA6	Feldmannia_species_virus	28.8	1.0e-06
WP_000247686.1|647684_648620_+	HAMP domain-containing histidine kinase	NA	Q8QNA2	Ectocarpus_siliculosus_virus	26.6	7.8e-13
WP_059303420.1|648745_649669_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	44.4	1.4e-46
>prophage 2
NZ_CP011145	Bacillus cereus strain FORC_013 chromosome, complete genome	5418913	1456132	1466306	5418913	bacteriocin	Bacillus_phage(54.55%)	15	NA	NA
WP_059303514.1|1456132_1456792_-	helix-turn-helix domain-containing protein	NA	A0A2H4J441	uncultured_Caudovirales_phage	40.6	4.3e-34
WP_059303515.1|1456995_1457208_+	hypothetical protein	NA	A6M975	Geobacillus_virus	63.0	3.6e-11
WP_000531225.1|1457410_1458169_+	ORF6C domain-containing protein	NA	A0A2H4JBC7	uncultured_Caudovirales_phage	69.0	9.2e-97
WP_059303516.1|1458180_1458375_+	hypothetical protein	NA	A0A1C8E9A1	Bacillus_phage	71.0	2.9e-15
WP_000511420.1|1458527_1459400_+	DnaD domain protein	NA	A0A2H4J394	uncultured_Caudovirales_phage	65.3	6.8e-96
WP_000883316.1|1459406_1459544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000464425.1|1459518_1459905_+	DUF1492 domain-containing protein	NA	A0A288WG73	Bacillus_phage	71.4	2.6e-47
WP_033692154.1|1460143_1461130_+	lysozyme family protein	NA	A0A223LKM8	Bacillus_phage	43.9	1.7e-34
WP_001051368.1|1461248_1462091_+	M23 family metallopeptidase	NA	A0A218KCJ1	Bacillus_phage	47.7	6.1e-33
WP_000405767.1|1462364_1463261_+	N-acetylmuramoyl-L-alanine amidase family protein	NA	A0A0S2MVR5	Bacillus_phage	52.4	4.1e-80
WP_000392444.1|1463322_1463553_+|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	A0A1B1P7Q9	Bacillus_phage	73.7	1.5e-23
WP_001102628.1|1463932_1464256_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000031383.1|1464248_1464791_+	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
WP_000976237.1|1464791_1465595_+	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_000413738.1|1465685_1466306_-	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	62.2	8.2e-19
>prophage 3
NZ_CP011145	Bacillus cereus strain FORC_013 chromosome, complete genome	5418913	2737397	2840668	5418913	holin,terminase,head,protease,capsid,portal,integrase,tail	Bacillus_phage(80.88%)	117	2796430:2796489	2840669:2840762
WP_002025803.1|2737397_2739077_-|tail	phage tail family protein	tail	A0A2H4JF18	uncultured_Caudovirales_phage	64.8	1.1e-94
WP_000535863.1|2739694_2740126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000718601.1|2740254_2740380_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_000718602.1|2740420_2740531_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_001188935.1|2741203_2743168_-|protease	M6 family metalloprotease domain-containing protein	protease	NA	NA	NA	NA
WP_001012102.1|2743500_2744043_-|integrase	site-specific integrase	integrase	W8CYP1	Bacillus_phage	89.4	2.6e-85
WP_000166128.1|2744042_2744525_-	ArpU family transcriptional regulator	NA	H0USV3	Bacillus_phage	80.6	1.4e-69
WP_001202055.1|2744552_2744723_-	hypothetical protein	NA	A0A1B0T6D0	Bacillus_phage	88.5	8.2e-06
WP_000796389.1|2746458_2746923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113732231.1|2747105_2747897_+	glycosyltransferase family 2 protein	NA	A0A1V0SJD8	Klosneuvirus	33.3	9.5e-20
WP_001010965.1|2748089_2748554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000087352.1|2748863_2749355_+	exosporium leader peptide-containing protein	NA	NA	NA	NA	NA
WP_002025794.1|2750609_2750924_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001111721.1|2751265_2752510_-	MFS transporter	NA	NA	NA	NA	NA
WP_001223581.1|2752574_2753210_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002025793.1|2753320_2753458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000033157.1|2753695_2753908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025921925.1|2755265_2756642_-	DEAD/DEAH box helicase	NA	A0A1V0SIR5	Klosneuvirus	36.0	1.2e-57
WP_000535037.1|2756715_2756985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059303809.1|2757144_2757831_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000513517.1|2758003_2758264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000415079.1|2758867_2759197_+	DUF1232 domain-containing protein	NA	NA	NA	NA	NA
WP_000021786.1|2759349_2760585_-	tetracycline resistance MFS efflux pump	NA	NA	NA	NA	NA
WP_001030904.1|2760791_2761262_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000632959.1|2761493_2762495_-	bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB	NA	NA	NA	NA	NA
WP_059303810.1|2762569_2764153_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_016124560.1|2764223_2764772_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_000876588.1|2764909_2765803_-	ATPase	NA	NA	NA	NA	NA
WP_000274965.1|2765799_2766972_-	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_001021960.1|2766994_2767261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001032280.1|2767339_2768623_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_000865907.1|2768634_2768940_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_000636016.1|2769167_2770727_+	family 10 glycosylhydrolase	NA	NA	NA	NA	NA
WP_000008374.1|2770784_2771618_-	DUF3974 domain-containing protein	NA	NA	NA	NA	NA
WP_000137402.1|2771642_2772755_-	toxic anion resistance protein	NA	NA	NA	NA	NA
WP_033684640.1|2773069_2773663_-	class I SAM-dependent methyltransferase	NA	A0A2P1JQT7	Mycobacterium_phage	35.0	1.4e-12
WP_001100984.1|2773966_2774125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000447159.1|2774157_2775027_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_000713010.1|2775004_2776315_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000010320.1|2776409_2776715_-	DUF5519 family protein	NA	NA	NA	NA	NA
WP_000126325.1|2776944_2777577_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_154609169.1|2778140_2779373_-	collagen-like repeat preface domain-containing protein	NA	NA	NA	NA	NA
WP_059303812.1|2780023_2780935_-	DUF4183 domain-containing protein	NA	NA	NA	NA	NA
WP_016122494.1|2781150_2781738_+	collagen-like triple helix repeat-containing protein	NA	NA	NA	NA	NA
WP_000598280.1|2782680_2783463_+	glycosyltransferase family 2 protein	NA	A0A1V0SJD8	Klosneuvirus	32.1	1.2e-22
WP_000774113.1|2783849_2784086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059303813.1|2784497_2785091_+	hypothetical protein	NA	A0A0U3TZ58	Bacillus_phage	89.1	2.6e-86
WP_059303814.1|2785447_2785912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059303815.1|2785971_2786688_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2MVR5	Bacillus_phage	92.0	9.9e-85
WP_059303816.1|2786704_2786935_-|holin	phage holin	holin	A0A0S2MVE8	Bacillus_phage	96.1	3.7e-33
WP_001115042.1|2786977_2787217_-	hemolysin XhlA family protein	NA	A0A1B1P7E0	Bacillus_phage	100.0	7.4e-37
WP_059303817.1|2787233_2788193_-|integrase	site-specific integrase	integrase	A0A0S2GLC8	Bacillus_phage	96.2	8.7e-177
WP_059303818.1|2790184_2790370_-	hypothetical protein	NA	A0A1B1P7U0	Bacillus_phage	91.1	4.0e-22
WP_059303819.1|2790563_2790830_-	helix-turn-helix domain-containing protein	NA	A0A0U3ULL9	Bacillus_phage	90.6	2.4e-36
WP_082188891.1|2790870_2791530_-	Rha family transcriptional regulator	NA	A0A288WFT2	Bacillus_phage	49.6	7.5e-55
WP_059303821.1|2791540_2791783_-	helix-turn-helix transcriptional regulator	NA	A8ASM3	Listeria_phage	41.1	4.8e-07
WP_059303822.1|2791979_2792321_+	helix-turn-helix transcriptional regulator	NA	A0A1B0T6A7	Bacillus_phage	45.6	9.1e-20
WP_162900576.1|2792633_2792789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048558286.1|2794518_2794872_+	helix-turn-helix transcriptional regulator	NA	A0A1B1P888	Bacillus_phage	44.5	4.2e-20
WP_059303824.1|2795322_2796429_+|integrase	site-specific integrase	integrase	A0A0U3U8Y8	Bacillus_phage	69.1	4.4e-124
2796430:2796489	attL	CAATGTTTGCAAAATGTTTGCAATCCATATATACATAGTCTTCAAAACCTTTATATATCA	NA	NA	NA	NA
WP_059303813.1|2796954_2797548_+	hypothetical protein	NA	A0A0U3TZ58	Bacillus_phage	89.1	2.6e-86
WP_059303814.1|2797904_2798369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059303815.1|2798428_2799145_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2MVR5	Bacillus_phage	92.0	9.9e-85
WP_059303816.1|2799161_2799392_-|holin	phage holin	holin	A0A0S2MVE8	Bacillus_phage	96.1	3.7e-33
WP_001115042.1|2799434_2799674_-	hemolysin XhlA family protein	NA	A0A1B1P7E0	Bacillus_phage	100.0	7.4e-37
WP_059303817.1|2799690_2800650_-|integrase	site-specific integrase	integrase	A0A0S2GLC8	Bacillus_phage	96.2	8.7e-177
WP_059303825.1|2800766_2801135_-	hypothetical protein	NA	A0A0S2MVE0	Bacillus_phage	77.6	3.6e-46
WP_059303826.1|2801146_2806456_-	peptidase S74	NA	A0A0S2MVB4	Bacillus_phage	46.6	0.0e+00
WP_059303827.1|2806452_2807916_-|tail	phage tail family protein	tail	A0A0A7AQV1	Bacillus_phage	58.6	2.8e-166
WP_059303828.1|2807950_2812966_-|tail	phage tail tape measure protein	tail	A0A1B1P7S6	Bacillus_phage	89.3	0.0e+00
WP_000938713.1|2812981_2813122_-	hypothetical protein	NA	A0A1B1P7R9	Bacillus_phage	95.7	1.3e-17
WP_059303829.1|2813139_2813535_-	hypothetical protein	NA	A0A1B1P7S9	Bacillus_phage	89.3	1.2e-55
WP_059303830.1|2813594_2814179_-|tail	phage tail protein	tail	A0A1B1P7S4	Bacillus_phage	99.0	3.4e-107
WP_059303831.1|2814192_2814552_-	structural protein	NA	A0A1B1P7S7	Bacillus_phage	92.4	8.0e-59
WP_000852721.1|2814548_2814986_-	HK97 gp10 family phage protein	NA	A0A1B1P7R6	Bacillus_phage	96.6	7.4e-75
WP_059303832.1|2814973_2815321_-|head	phage head closure protein	head	A0A1B1P7T4	Bacillus_phage	95.7	4.5e-59
WP_059303833.1|2815307_2815583_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B1P7Q8	Bacillus_phage	97.8	4.0e-42
WP_082188893.1|2815591_2815891_-	fibronectin type III domain-containing protein	NA	NA	NA	NA	NA
WP_059303835.1|2815868_2817056_-|capsid	phage major capsid protein	capsid	A0A1B1P7R4	Bacillus_phage	94.2	1.0e-206
WP_059303836.1|2817052_2817808_-|protease	Clp protease ClpP	protease	A0A0U3U021	Bacillus_phage	98.4	1.2e-136
WP_059303837.1|2817785_2819000_-|portal	phage portal protein	portal	A0A0U3SQF0	Bacillus_phage	98.8	2.2e-233
WP_059303838.1|2819015_2820788_-|terminase	terminase large subunit	terminase	A0A1B1P7R3	Bacillus_phage	98.3	0.0e+00
WP_000357492.1|2820768_2821149_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B1P7R2	Bacillus_phage	98.4	2.7e-65
WP_000138428.1|2821310_2821673_-	HNH endonuclease	NA	A0A1B1P8D2	Bacillus_phage	95.8	2.3e-61
WP_059303839.1|2821665_2821881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059303840.1|2821910_2822231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059303841.1|2822637_2823567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001028525.1|2823893_2824436_-|integrase	site-specific integrase	integrase	A0A1B1P746	Bacillus_phage	88.9	2.5e-88
WP_059303842.1|2824432_2824903_-	ArpU family transcriptional regulator	NA	A0A1B1P744	Bacillus_phage	92.3	2.9e-77
WP_059303843.1|2824923_2825094_-	hypothetical protein	NA	A0A1B1P735	Bacillus_phage	83.9	1.7e-06
WP_059303844.1|2825205_2825472_-	hypothetical protein	NA	A0A1X9SGH7	Bacillus_phage	56.4	3.8e-13
WP_059303845.1|2826358_2826694_-	hypothetical protein	NA	A0A2H4JCU3	uncultured_Caudovirales_phage	45.1	9.6e-06
WP_059303846.1|2827266_2828604_+	collagen-like protein	NA	A0A285PWR0	Cedratvirus	63.4	2.6e-38
WP_059303847.1|2828882_2829191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059303848.1|2829227_2829611_-	hypothetical protein	NA	A0A1P8CWZ8	Bacillus_phage	33.6	4.4e-07
WP_059304312.1|2829624_2829984_-	hypothetical protein	NA	A0A0A7AR03	Bacillus_phage	89.1	1.7e-56
WP_172794557.1|2830231_2830495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059303849.1|2830534_2831071_-	dUTP diphosphatase	NA	A0A2H4J4W9	uncultured_Caudovirales_phage	79.2	1.0e-78
WP_172794561.1|2831083_2831251_-	hypothetical protein	NA	A0A0U3SD36	Bacillus_phage	92.7	4.1e-18
WP_059303850.1|2831318_2831534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000109543.1|2831554_2831806_-	hypothetical protein	NA	A0A0K2CNP4	Brevibacillus_phage	42.2	2.2e-07
WP_000717825.1|2831831_2831999_-	DUF3954 domain-containing protein	NA	A0A1B0T6B8	Bacillus_phage	62.3	1.8e-13
WP_059303851.1|2832017_2832377_-	hypothetical protein	NA	A0A1B1P7A1	Bacillus_phage	53.3	1.4e-31
WP_059303852.1|2832369_2832648_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	61.0	6.7e-13
WP_059303853.1|2832664_2832859_-	hypothetical protein	NA	A0A0U3K3J8	Bacillus_phage	82.8	1.7e-23
WP_059303854.1|2832874_2833750_-	ATP-binding protein	NA	Q2I8C8	Bacillus_phage	45.2	5.0e-62
WP_059303855.1|2833688_2834420_-	DnaD domain protein	NA	A0A1B0T6C0	Bacillus_phage	80.3	7.5e-72
WP_059303856.1|2834424_2834601_-	hypothetical protein	NA	A0A1B1P7U0	Bacillus_phage	96.6	1.7e-25
WP_059303857.1|2834630_2834795_-	hypothetical protein	NA	A0A0U3B230	Bacillus_phage	90.7	5.1e-21
WP_059303819.1|2834794_2835061_-	helix-turn-helix domain-containing protein	NA	A0A0U3ULL9	Bacillus_phage	90.6	2.4e-36
WP_082188891.1|2835101_2835761_-	Rha family transcriptional regulator	NA	A0A288WFT2	Bacillus_phage	49.6	7.5e-55
WP_059303821.1|2835771_2836014_-	helix-turn-helix transcriptional regulator	NA	A8ASM3	Listeria_phage	41.1	4.8e-07
WP_059303858.1|2836210_2836561_+	helix-turn-helix transcriptional regulator	NA	A0A1B0T6A7	Bacillus_phage	45.6	7.1e-20
WP_162900576.1|2836863_2837019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059303859.1|2837045_2838248_-	hypothetical protein	NA	D2XQ10	Bacillus_virus	46.0	2.0e-82
WP_048558286.1|2838757_2839111_+	helix-turn-helix transcriptional regulator	NA	A0A1B1P888	Bacillus_phage	44.5	4.2e-20
WP_059303824.1|2839561_2840668_+|integrase	site-specific integrase	integrase	A0A0U3U8Y8	Bacillus_phage	69.1	4.4e-124
2840669:2840762	attR	CAATGTTTGCAAAATGTTTGCAATCCATATATACATAGTCTTCAAAACCTTTATATATCAAGGATTTAAAGGCTATGTATTACAATACCACGTA	NA	NA	NA	NA
>prophage 4
NZ_CP011145	Bacillus cereus strain FORC_013 chromosome, complete genome	5418913	3255031	3263164	5418913		Bacillus_phage(83.33%)	7	NA	NA
WP_059303919.1|3255031_3255904_-	aminoglycoside 6-adenylyltransferase	NA	E4ZFP8	Streptococcus_phage	44.4	9.6e-66
WP_059303920.1|3256194_3256914_-	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	99.2	1.3e-60
WP_059303921.1|3257203_3258277_-	HAMP domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	97.2	1.1e-185
WP_059303922.1|3258273_3258951_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	98.2	9.6e-122
WP_000453886.1|3259036_3260797_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	98.4	6.3e-274
WP_059303923.1|3261037_3261802_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_059303924.1|3261901_3263164_-	C40 family peptidase	NA	A0A217EQL1	Bacillus_phage	44.4	3.6e-13
>prophage 5
NZ_CP011145	Bacillus cereus strain FORC_013 chromosome, complete genome	5418913	4183344	4193409	5418913		Bacillus_phage(50.0%)	9	NA	NA
WP_059304085.1|4183344_4184631_-	replicative DNA helicase	NA	D2XR44	Bacillus_phage	59.6	1.8e-140
WP_000312052.1|4184627_4185488_-	DnaD domain protein	NA	A6M985	Geobacillus_virus	37.8	3.3e-50
WP_059304086.1|4185680_4186007_-	nucleoside triphosphate pyrophosphohydrolase	NA	A0A2I7SAA6	Vibrio_phage	39.1	1.7e-07
WP_059304087.1|4186059_4186803_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000808317.1|4186811_4187063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000859132.1|4187066_4187405_-	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
WP_059304088.1|4187502_4189944_-	DEAD/DEAH box helicase family protein	NA	Q5YA94	Bacillus_phage	27.1	3.1e-37
WP_001143695.1|4189936_4190263_-	nucleoside triphosphate pyrophosphohydrolase	NA	A0A2I7SAA6	Vibrio_phage	37.8	1.9e-06
WP_059304089.1|4190508_4193409_-	DEAD/DEAH box helicase	NA	Q5YA94	Bacillus_phage	27.7	3.7e-29
>prophage 6
NZ_CP011145	Bacillus cereus strain FORC_013 chromosome, complete genome	5418913	4458115	4466227	5418913		Bacillus_phage(66.67%)	8	NA	NA
WP_059304143.1|4458115_4459567_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	54.0	9.8e-140
WP_000831286.1|4459954_4460299_-	DUF4064 domain-containing protein	NA	A0A0S2MVJ2	Bacillus_phage	78.1	8.5e-42
WP_000277062.1|4460311_4460842_-	DUF4352 domain-containing protein	NA	A0A0S2MVG4	Bacillus_phage	33.7	5.5e-16
WP_059304144.1|4460975_4462223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000565476.1|4462398_4463076_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.6	1.4e-32
WP_000822528.1|4463087_4464479_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	29.5	5.0e-32
WP_059304145.1|4464644_4465166_-	dihydrofolate reductase	NA	NA	NA	NA	NA
WP_154609159.1|4465240_4466227_+	WYL domain-containing protein	NA	A0A1B0RXM1	Streptococcus_phage	29.9	3.2e-17
>prophage 7
NZ_CP011145	Bacillus cereus strain FORC_013 chromosome, complete genome	5418913	4800076	4808452	5418913		Synechococcus_phage(50.0%)	8	NA	NA
WP_000088589.1|4800076_4800664_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.4	9.1e-28
WP_001262439.1|4800660_4801701_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	45.9	1.2e-67
WP_000879025.1|4801806_4803222_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.4	3.3e-55
WP_000055563.1|4803206_4805426_-	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	41.3	3.0e-164
WP_000666774.1|4805409_4806093_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_000278823.1|4806089_4806344_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_059304194.1|4806336_4807056_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3HI61	Synechococcus_phage	45.2	4.0e-49
WP_000625682.1|4807144_4808452_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.3	4.9e-21
>prophage 1
NZ_CP011146	Bacillus cereus strain FORC_013 plasmid pFORC13, complete sequence	259749	19719	98451	259749	integrase,transposase	Bacillus_phage(54.55%)	42	39450:39499	88993:89042
WP_172794569.1|19719_20070_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	80.0	7.1e-44
WP_059304342.1|20102_20495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059304343.1|20585_20843_-	HU family DNA-binding protein	NA	NA	NA	NA	NA
WP_059304344.1|21051_23937_+	collagenase ColA	NA	NA	NA	NA	NA
WP_140158417.1|28746_28992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059304348.1|29036_29813_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	41.8	7.6e-22
WP_140158658.1|33060_33351_+	hypothetical protein	NA	A0A1C8E971	Bacillus_phage	89.1	1.3e-22
WP_059304482.1|33380_33689_-	hypothetical protein	NA	A0A2H4J859	uncultured_Caudovirales_phage	72.3	1.3e-36
WP_172794564.1|34243_34705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059304356.1|38035_39316_+	hypothetical protein	NA	NA	NA	NA	NA
39450:39499	attL	AAAAAATACGCTATTCTTTCTGTAGAATCATAGGAAAGGATGGCGTTTTT	NA	NA	NA	NA
WP_059304359.1|40430_40913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087971361.1|41150_42593_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_059304361.1|44210_45539_+	DUF1727 domain-containing protein	NA	NA	NA	NA	NA
WP_059304362.1|45704_46427_+	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_154609171.1|46588_46747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172794565.1|47390_48362_+	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_059304365.1|53824_54355_-	hypoxanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_059304366.1|55551_56472_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	30.9	1.5e-21
WP_059304367.1|57178_57880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059304368.1|57888_58524_+	class D sortase	NA	NA	NA	NA	NA
WP_059304369.1|58743_59241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059304370.1|59813_60062_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_059304371.1|60736_61234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059304372.1|62498_63491_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_059304373.1|63893_65066_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0E3T6D9	Bacillus_phage	24.1	1.1e-08
WP_154609172.1|66541_66700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059304374.1|67985_68519_+	DUF1282 family protein	NA	NA	NA	NA	NA
WP_059304375.1|69318_69708_+	DUF4064 domain-containing protein	NA	A0A0S2MVJ2	Bacillus_phage	65.1	7.9e-36
WP_059304377.1|70293_71724_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_059304378.1|72053_73130_-	tyrosine recombinase XerS	NA	NA	NA	NA	NA
WP_059304379.1|74386_75295_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_059304380.1|75546_76977_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_154609177.1|77603_78773_-	MFS transporter	NA	NA	NA	NA	NA
WP_059304483.1|80278_80533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059304484.1|81475_81952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059304382.1|84591_85713_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	79.9	7.0e-170
WP_059304383.1|86113_87226_-	helix-turn-helix domain-containing protein	NA	A0A286QQB7	Streptococcus_phage	45.2	1.1e-79
WP_059304384.1|87249_87636_-|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	68.0	6.2e-49
WP_048563148.1|89045_90476_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
88993:89042	attR	AAAAAATACGCTATTCTTTCTGTAGAATCATAGGAAAGGATGGCGTTTTT	NA	NA	NA	NA
WP_059304386.1|94552_95002_+	DUF3862 domain-containing protein	NA	U5J9H5	Bacillus_phage	56.8	8.6e-18
WP_059304387.1|95916_96750_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_154609173.1|97020_98451_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP011146	Bacillus cereus strain FORC_013 plasmid pFORC13, complete sequence	259749	105182	185410	259749	protease,transposase	Bacillus_phage(47.06%)	46	NA	NA
WP_059304392.1|105182_106304_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	80.2	6.4e-171
WP_059304393.1|106984_108163_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_059304394.1|108943_109399_-	DUF3221 domain-containing protein	NA	NA	NA	NA	NA
WP_059304395.1|109843_111286_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_082188976.1|112110_112272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059304396.1|112715_113111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059304397.1|113451_113778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059304398.1|117882_118251_-	response regulator	NA	NA	NA	NA	NA
WP_059304399.1|119901_120432_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	32.2	4.4e-13
WP_059304400.1|121299_122421_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	75.9	1.3e-160
WP_059304401.1|123287_125144_+	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	28.7	8.5e-11
WP_059304402.1|125667_126594_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	61.2	1.1e-104
WP_059304403.1|126646_127213_-	cysteine dioxygenase family protein	NA	NA	NA	NA	NA
WP_059304404.1|127850_128321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059304405.1|135159_136335_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_059304406.1|136337_137012_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.5	3.6e-36
WP_059304407.1|137008_138112_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_059304408.1|139528_140440_-	EamA family transporter	NA	NA	NA	NA	NA
WP_059304409.1|140665_141169_-	hypoxanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_059304411.1|144674_146171_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_059304412.1|148139_150860_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_059304414.1|152501_152780_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	57.4	9.7e-12
WP_059304415.1|154719_154986_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_059304416.1|155260_155467_+|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	57.1	4.3e-09
WP_059304417.1|155625_156189_-	undecaprenyl-diphosphatase	NA	NA	NA	NA	NA
WP_059304418.1|157215_158232_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	51.2	1.6e-96
WP_059304419.1|158433_159756_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	41.1	9.1e-92
WP_059304420.1|159819_160608_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	32.4	1.4e-10
WP_059304421.1|160640_161447_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_059304422.1|161852_163169_-	flippase	NA	NA	NA	NA	NA
WP_059304423.1|163170_164115_-	glycosyltransferase family 2 protein	NA	A0A0N7G7L1	Chrysochromulina_ericina_virus	30.2	3.5e-05
WP_059304424.1|164133_165039_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_059304425.1|165095_166271_-	oligosaccharide repeat unit polymerase	NA	NA	NA	NA	NA
WP_059304426.1|166443_167433_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_059304427.1|167717_168377_-	exopolysaccharide biosynthesis polyprenyl glycosylphosphotransferase	NA	NA	NA	NA	NA
WP_059304428.1|168395_169274_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	54.8	1.6e-81
WP_059304429.1|169955_170642_-	CpsD/CapB family tyrosine-protein kinase	NA	A0A1X9I5D6	Streptococcus_phage	34.8	8.5e-25
WP_059304430.1|170631_171372_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_059304431.1|172416_173034_-|protease	collagenolytic protease	protease	NA	NA	NA	NA
WP_059304432.1|174991_176716_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_059304434.1|177809_179510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059304486.1|181229_181805_-	replication-relaxation family protein	NA	W8CZ47	Bacillus_phage	76.2	4.4e-83
WP_059304435.1|181827_182994_-	DNA translocase FtsK	NA	A0A0S2GLG9	Bacillus_phage	80.9	2.3e-184
WP_059304436.1|183004_183325_-	hypothetical protein	NA	A0A0S2GLK1	Bacillus_phage	63.2	1.8e-30
WP_059304437.1|183616_183847_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_059304438.1|184741_185410_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
