The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013990	Leclercia adecarboxylata strain USDA-ARS-USMARC-60222 chromosome, complete genome	4803917	634038	722212	4803917	integrase,terminase,capsid,holin,plate,head,tRNA,tail,lysis,portal	Salmonella_phage(74.47%)	87	680886:680937	715779:715830
WP_032614329.1|634038_634437_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_032614327.1|634439_634745_-	DUF883 family protein	NA	NA	NA	NA	NA
WP_032614325.1|634773_635142_-	DUF1090 domain-containing protein	NA	NA	NA	NA	NA
WP_032614323.1|635297_635678_-	EnvZ/OmpR regulon moderator MzrA	NA	NA	NA	NA	NA
WP_059307126.1|635682_636345_-	DedA family protein	NA	NA	NA	NA	NA
WP_059307127.1|636696_637473_-	transcriptional regulator ExuR	NA	NA	NA	NA	NA
WP_032614319.1|637648_638947_-	MFS transporter	NA	NA	NA	NA	NA
WP_032614318.1|639426_640839_+	glucuronate isomerase	NA	NA	NA	NA	NA
WP_059307128.1|640857_642345_+	altronate dehydratase	NA	NA	NA	NA	NA
WP_059307129.1|642421_643663_-	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_059307130.1|643902_644871_-	TerC family protein	NA	A0A291LBC5	Escherichia_phage	34.4	2.1e-37
WP_032614310.1|645149_646148_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_032614308.1|646218_646707_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_059307131.1|646917_648054_+	23S rRNA (guanine(1835)-N(2))-methyltransferase RlmG	NA	NA	NA	NA	NA
WP_059307132.1|648288_650310_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_059307133.1|650865_652449_-	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_032614299.1|652481_653453_-	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_059307134.1|653667_655155_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	F2Y302	Organic_Lake_phycodnavirus	29.7	4.3e-13
WP_059307135.1|655151_656183_+	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_059307136.1|656183_657167_+	autoinducer 2 import system permease LsrD	NA	NA	NA	NA	NA
WP_059307137.1|657163_658165_+	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_059307138.1|658176_659064_+	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_032614283.1|659060_659354_+	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_071886412.1|659443_660823_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	27.8	1.7e-32
WP_032614277.1|661253_662774_+	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	47.8	1.9e-32
WP_032614275.1|663110_664670_+	MCP four helix bundle domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	28.8	1.5e-08
WP_059307139.1|664666_665212_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_059307140.1|665449_666214_+	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_059307141.1|666214_667384_-	DNA repair protein	NA	NA	NA	NA	NA
WP_059307142.1|667622_667925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059307143.1|668332_668986_+	cellulose biosynthesis protein BcsO	NA	NA	NA	NA	NA
WP_032614263.1|668976_669783_+	cellulose synthase operon protein YhjQ	NA	NA	NA	NA	NA
WP_059307144.1|669803_671924_+	UDP-forming cellulose synthase catalytic subunit	NA	NA	NA	NA	NA
WP_156424718.1|671929_674395_+	cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB	NA	NA	NA	NA	NA
WP_059307146.1|674408_678275_+	cellulose biosynthesis protein BcsC	NA	NA	NA	NA	NA
WP_032614257.1|678274_678742_+	cellulose synthase	NA	NA	NA	NA	NA
WP_059307147.1|678751_679741_+	endoglucanase	NA	NA	NA	NA	NA
WP_158251932.1|679893_680070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059307148.1|680007_680445_-	hypothetical protein	NA	NA	NA	NA	NA
680886:680937	attL	AAATTTGGTGGCCCCTGCTGGACTTGAACCAGCGACCAAGCGATTATGAGTC	NA	NA	NA	NA
WP_059307149.1|681182_682532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059307150.1|682569_683589_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	61.7	3.0e-119
WP_059307151.1|683591_684131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071886413.1|684134_684785_-	phage repressor protein CI	NA	F1BUN8	Cronobacter_phage	33.5	6.6e-27
WP_059307152.1|684873_685110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059307153.1|685144_685654_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	88.2	2.3e-80
WP_071886414.1|685661_685862_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	86.2	3.4e-27
WP_059307154.1|685825_686167_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	83.2	3.0e-47
WP_059307155.1|686234_686468_+	DUF2732 domain-containing protein	NA	A0A1S6L021	Salmonella_phage	77.9	3.5e-23
WP_059307156.1|686467_686695_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	64.0	2.1e-20
WP_059307157.1|686691_687546_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	72.9	1.2e-116
WP_059307158.1|687542_689936_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.5	0.0e+00
WP_059307159.1|690092_690281_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	93.5	2.0e-24
WP_059307160.1|690291_690525_+	DinI family protein	NA	A0A1S6L014	Salmonella_phage	81.8	1.5e-29
WP_059307161.1|690594_690852_+	hypothetical protein	NA	J9Q7T5	Salmonella_phage	57.5	7.5e-19
WP_059307162.1|691076_692729_+	hypothetical protein	NA	X2KLG0	Campylobacter_phage	26.9	1.5e-14
WP_059307163.1|692758_693787_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	93.8	2.2e-178
WP_059307164.1|693786_695553_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	95.1	0.0e+00
WP_059307165.1|695695_696529_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	87.7	1.6e-118
WP_059307166.1|696545_697607_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	94.6	5.4e-188
WP_059307167.1|697610_698261_+|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	96.3	3.3e-111
WP_059307168.1|698354_698819_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	88.3	6.4e-77
WP_059307169.1|698818_699022_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	95.5	1.2e-32
WP_059307170.1|699025_699241_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	87.3	3.3e-28
WP_059307171.1|699221_699731_+	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	95.3	4.3e-90
WP_059307172.1|699735_700113_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	47.9	1.8e-24
WP_167347885.1|700109_700538_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	92.9	2.9e-63
WP_059307174.1|700633_701065_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	91.6	1.2e-69
WP_059307175.1|701057_701504_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	82.4	6.2e-61
WP_059307176.1|701507_702536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059307177.1|702614_703193_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	90.6	6.8e-100
WP_059307178.1|703189_703549_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	89.1	5.5e-52
WP_059307179.1|703535_704444_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	77.2	7.1e-120
WP_059307180.1|704436_704958_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	61.3	1.2e-58
WP_059307182.1|707907_708324_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	52.7	5.3e-14
WP_059307183.1|708528_709701_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	92.6	1.6e-209
WP_059307184.1|709710_710226_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	91.2	1.3e-86
WP_059307185.1|710280_710583_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	95.0	6.7e-43
WP_007848878.1|710597_710717_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	92.3	3.3e-14
WP_059307186.1|710709_713784_+|tail	phage tail tape measure protein	tail	A0A1S6L010	Salmonella_phage	76.6	0.0e+00
WP_059307187.1|713780_714266_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	83.9	9.4e-63
WP_059307188.1|714262_715363_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	87.4	6.7e-181
WP_071886516.1|715431_715650_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	79.2	4.4e-28
WP_032614250.1|715984_716491_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
715779:715830	attR	AAATTTGGTGGCCCCTGCTGGACTTGAACCAGCGACCAAGCGATTATGAGTC	NA	NA	NA	NA
WP_032614248.1|716845_718693_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_032614246.1|718842_720588_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.8	1.3e-77
WP_001144069.1|720746_720962_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_032614244.1|721198_722212_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.9	5.3e-108
>prophage 2
NZ_CP013990	Leclercia adecarboxylata strain USDA-ARS-USMARC-60222 chromosome, complete genome	4803917	1065815	1073263	4803917		Mycobacterium_phage(33.33%)	7	NA	NA
WP_082697320.1|1065815_1067963_+	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	24.4	1.0e-28
WP_032613504.1|1068406_1068619_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	78.6	1.7e-24
WP_059307331.1|1068808_1069429_-	LysE family translocator	NA	NA	NA	NA	NA
WP_059307332.1|1069509_1070469_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	71.9	8.2e-135
WP_059307333.1|1070478_1072623_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	48.2	8.4e-196
WP_032613493.1|1072595_1073006_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	43.9	1.3e-17
WP_071886424.1|1073002_1073263_-	glutaredoxin-like protein NrdH	NA	A0A222ZNS6	Mycobacterium_phage	42.9	1.1e-06
>prophage 3
NZ_CP013990	Leclercia adecarboxylata strain USDA-ARS-USMARC-60222 chromosome, complete genome	4803917	2515089	2532007	4803917		Escherichia_phage(33.33%)	17	NA	NA
WP_059307993.1|2515089_2517135_-	peptidyl-dipeptidase Dcp	NA	A0A1V0SIU1	Klosneuvirus	21.8	7.6e-21
WP_032618025.1|2517287_2518034_+	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_032618024.1|2518125_2518812_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032618023.1|2518852_2519284_-	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	36.6	5.3e-17
WP_032618022.1|2519548_2519752_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	61.2	2.6e-14
WP_059307994.1|2519796_2521260_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	30.1	1.1e-42
WP_059307995.1|2521541_2522921_-	MHS family MFS transporter	NA	Q6JIH2	Burkholderia_virus	25.2	2.2e-27
WP_059307996.1|2522974_2523988_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.9	3.9e-18
WP_032617959.1|2523999_2525214_-	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	29.7	2.8e-47
WP_032617958.1|2525324_2525651_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	1.4e-22
WP_059307997.1|2525799_2526129_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_082697367.1|2526168_2526879_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_032617956.1|2526985_2527291_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_059307998.1|2527441_2529880_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.6	3.6e-219
WP_059307999.1|2529890_2530508_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.1	4.7e-75
WP_059308000.1|2530509_2531364_+	dimethyl sulfoxide reductase anchor subunit family protein	NA	A0A077SK59	Escherichia_phage	34.9	5.2e-24
WP_059308001.1|2531407_2532007_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	38.7	2.2e-29
>prophage 4
NZ_CP013990	Leclercia adecarboxylata strain USDA-ARS-USMARC-60222 chromosome, complete genome	4803917	2594890	2686114	4803917	terminase,protease,holin,coat,tail	Escherichia_phage(42.0%)	93	NA	NA
WP_032617890.1|2594890_2595715_+|protease	serine protease	protease	NA	NA	NA	NA
WP_059308036.1|2595716_2597879_-	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	32.5	2.8e-13
WP_032617889.1|2597965_2598295_-	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_059308037.1|2598281_2598644_-	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_032617887.1|2599060_2600098_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_059308038.1|2600094_2601051_-	zinc-dependent alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_032617885.1|2601054_2601618_-	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_059308039.1|2601964_2602873_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_059308040.1|2603048_2604359_+	M20 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_059308041.1|2604358_2605804_+	amidohydrolase	NA	NA	NA	NA	NA
WP_032617881.1|2605840_2607367_+	p-aminobenzoyl-glutamate transporter	NA	NA	NA	NA	NA
WP_032617880.1|2607377_2607893_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	43.7	5.9e-23
WP_032617879.1|2608075_2608828_+	fumarate/nitrate reduction transcriptional regulator Fnr	NA	NA	NA	NA	NA
WP_032617878.1|2608963_2609914_+	universal stress protein UspE	NA	NA	NA	NA	NA
WP_032617877.1|2609949_2611065_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_032617876.1|2611179_2612568_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit beta	NA	NA	NA	NA	NA
WP_032617875.1|2612578_2614108_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_059308042.1|2614644_2615598_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_059308043.1|2615783_2617166_+	amino acid permease	NA	NA	NA	NA	NA
WP_059308044.1|2617204_2617927_+	dihydromonapterin reductase	NA	NA	NA	NA	NA
WP_032617871.1|2617923_2618259_-	GlpM family protein	NA	NA	NA	NA	NA
WP_032617870.1|2618387_2619104_+	two-component system response regulator RstA	NA	NA	NA	NA	NA
WP_059308045.1|2619245_2620265_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_156424701.1|2620321_2621311_+	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_032617867.1|2621310_2622081_+	ABC transporter ATP-binding protein	NA	R4TX06	Phaeocystis_globosa_virus	28.1	1.9e-09
WP_059308047.1|2622160_2623459_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	23.9	1.4e-15
WP_059308048.1|2623532_2624462_+	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
WP_059308049.1|2624462_2625854_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_059308050.1|2626018_2627665_-	fumarate hydratase	NA	NA	NA	NA	NA
WP_059308051.1|2627865_2629038_+	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_059308052.1|2629139_2630705_+	YdgA family protein	NA	NA	NA	NA	NA
WP_032617860.1|2630783_2631812_-	Mal regulon transcriptional regulator MalI	NA	NA	NA	NA	NA
WP_032617859.1|2631990_2633583_+	PTS maltose transporter subunit IICB	NA	NA	NA	NA	NA
WP_059308053.1|2633631_2634804_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_059308054.1|2635353_2636196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059308055.1|2636693_2637011_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	48.0	3.3e-16
WP_156424702.1|2637597_2638284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059308057.1|2638306_2639305_-|tail	tail fiber domain-containing protein	tail	O64338	Escherichia_phage	48.3	2.5e-41
WP_059308058.1|2639316_2639619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059308059.1|2639618_2641280_-	hypothetical protein	NA	A0A0F7L427	uncultured_marine_virus	37.4	1.5e-27
WP_082697335.1|2641352_2646365_-	DUF1983 domain-containing protein	NA	G8C7R4	Escherichia_phage	35.5	5.1e-10
WP_059308060.1|2646420_2647014_-|tail	tail assembly protein	tail	G8C7R3	Escherichia_phage	87.5	1.4e-89
WP_059308061.1|2647001_2647733_-	C40 family peptidase	NA	G8C7R2	Escherichia_phage	91.3	1.5e-141
WP_059308062.1|2647745_2648516_-|tail	phage minor tail protein L	tail	G8C7R1	Escherichia_phage	87.5	1.1e-132
WP_059308063.1|2648515_2648866_-|tail	phage tail protein	tail	G8C7R0	Escherichia_phage	91.4	9.8e-54
WP_059309113.1|2649118_2649517_+	hypothetical protein	NA	A0A077K9U2	Edwardsiella_phage	38.3	7.8e-15
WP_059308064.1|2649778_2650261_-	hypothetical protein	NA	M9NZH8	Enterobacteria_phage	57.9	1.0e-40
WP_059308065.1|2650362_2653410_-|tail	phage tail tape measure protein	tail	G8C7Q6	Escherichia_phage	70.4	0.0e+00
WP_059308066.1|2653409_2653697_-	DUF1799 domain-containing protein	NA	I6PD79	Cronobacter_phage	60.0	7.9e-17
WP_059308067.1|2653714_2654053_-	hypothetical protein	NA	G8C7Q5	Escherichia_phage	83.9	1.3e-50
WP_059308068.1|2654117_2654321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059308069.1|2654464_2655397_-	immunoglobulin domain-containing protein	NA	G8C7Q3	Escherichia_phage	94.2	1.0e-158
WP_059308070.1|2655443_2655893_-	DUF4128 domain-containing protein	NA	G8C7Q2	Escherichia_phage	91.9	8.4e-74
WP_059308071.1|2655882_2656482_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	88.9	1.3e-98
WP_059308072.1|2656484_2656838_-	hypothetical protein	NA	G8C7Q0	Escherichia_phage	89.7	1.6e-51
WP_059308073.1|2656839_2657322_-	hypothetical protein	NA	G8C7P9	Escherichia_phage	83.8	6.7e-77
WP_059308074.1|2657324_2657546_-	hypothetical protein	NA	G8C7P8	Escherichia_phage	72.6	1.0e-19
WP_059308075.1|2657586_2658723_-|coat	P22 coat - protein 5 family protein	coat	G8C7P7	Escherichia_phage	92.3	1.9e-194
WP_059308076.1|2658739_2659492_-	hypothetical protein	NA	G8C7P6	Escherichia_phage	92.4	8.4e-127
WP_156424703.1|2659627_2659813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059308077.1|2661538_2662942_-	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	90.1	8.1e-240
WP_059308078.1|2662946_2664251_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	60.5	1.6e-149
WP_059308079.1|2664228_2665218_-|terminase	terminase small subunit	terminase	I6X6R5	Burkholderia_virus	44.0	1.2e-43
WP_059308080.1|2665271_2665742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167347882.1|2665839_2666367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059308082.1|2667095_2667374_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	67.1	7.4e-20
WP_174521481.1|2667370_2668027_-	glycoside hydrolase family 108 protein	NA	A0A0U2I1S0	Escherichia_phage	71.3	2.1e-73
WP_032611845.1|2667912_2668185_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_051916024.1|2668181_2668559_-	hypothetical protein	NA	F1C592	Cronobacter_phage	40.5	6.7e-08
WP_059308084.1|2668905_2669370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059308085.1|2669668_2670499_-	antitermination protein	NA	K7PKS8	Enterobacteria_phage	84.4	5.6e-132
WP_032611850.1|2670495_2670636_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	76.3	2.1e-07
WP_059308086.1|2670632_2670995_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	83.1	5.6e-52
WP_059308087.1|2670991_2671282_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	91.6	1.4e-45
WP_059308088.1|2671284_2671485_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	57.6	1.9e-17
WP_059308089.1|2671489_2672086_-	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	90.3	1.4e-100
WP_059308090.1|2672120_2672360_-	hypothetical protein	NA	K7PHG9	Enterobacteria_phage	55.6	1.9e-16
WP_156424705.1|2673114_2673555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059308093.1|2674152_2674395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059308094.1|2674387_2674651_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	66.2	2.7e-24
WP_059308095.1|2674664_2675417_-	ATP-binding protein	NA	S4TNF5	Salmonella_phage	77.6	1.9e-110
WP_059309114.1|2675413_2676337_-	replication protein	NA	H6WRX7	Salmonella_phage	74.8	1.4e-123
WP_059308096.1|2676418_2676988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568772.1|2676999_2677218_-	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	64.8	1.5e-20
WP_082697338.1|2677290_2677704_+	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	75.8	3.1e-46
WP_059308097.1|2677837_2678311_+	hypothetical protein	NA	K7PLT9	Enterobacteria_phage	59.9	4.7e-51
WP_059308098.1|2678307_2679240_+	hypothetical protein	NA	K7PGT0	Enterobacteria_phage	50.8	2.8e-79
WP_156424706.1|2679539_2679872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156424721.1|2681417_2683268_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	H6WRX1	Salmonella_phage	46.0	2.6e-161
WP_059309116.1|2683282_2684323_+	recombinase RecT	NA	K7PKR8	Enterobacteria_phage	73.2	4.9e-149
WP_059308101.1|2684360_2684600_+	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	83.3	2.7e-31
WP_059308102.1|2684664_2684883_+	excisionase family protein	NA	A0A0U2RY08	Escherichia_phage	56.3	7.8e-17
WP_059308103.1|2684884_2686114_+	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	49.8	6.2e-111
>prophage 5
NZ_CP013990	Leclercia adecarboxylata strain USDA-ARS-USMARC-60222 chromosome, complete genome	4803917	2858035	2955937	4803917	integrase,terminase,protease,holin,tRNA,tail,portal	Enterobacteria_phage(26.53%)	94	2942068:2942085	2962831:2962848
WP_059308190.1|2858035_2861176_-|tail	phage tail tape measure protein	tail	G8C7Q6	Escherichia_phage	39.7	8.6e-165
WP_059308191.1|2861187_2861523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059308192.1|2861510_2861789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167347883.1|2861785_2861959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059308193.1|2862093_2862636_-	zinc ribbon domain-containing protein	NA	I6PDJ9	Cronobacter_phage	42.9	3.2e-27
WP_059308194.1|2864166_2864616_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_059308195.1|2864804_2867564_-	TOPRIM and DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	55.6	2.0e-282
WP_059308196.1|2867556_2867910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059308197.1|2867906_2868116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059308198.1|2868112_2868295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082697343.1|2868291_2868843_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_059308199.1|2868835_2869630_-	antA/AntB antirepressor family protein	NA	A0A0R6PJV6	Moraxella_phage	35.7	3.3e-20
WP_156424708.1|2869641_2870094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059308200.1|2870090_2870297_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_059308202.1|2871456_2872710_-|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	59.7	3.9e-145
WP_032617683.1|2872930_2873677_-	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_032617681.1|2874110_2876045_+	protein kinase YeaG	NA	NA	NA	NA	NA
WP_032617680.1|2876170_2877457_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	1.0e-10
WP_059308203.1|2877496_2879533_-	TonB-dependent copper receptor	NA	NA	NA	NA	NA
WP_059308204.1|2879781_2880678_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	34.2	6.7e-14
WP_032617676.1|2881025_2881472_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_174521483.1|2881455_2882247_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_059308205.1|2882343_2883531_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_032617674.1|2883539_2884250_-	CTP synthase	NA	NA	NA	NA	NA
WP_059308206.1|2884388_2884733_+	DUF488 family protein	NA	NA	NA	NA	NA
WP_032617672.1|2884734_2885040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059308207.1|2885394_2886423_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	29.4	5.9e-14
WP_032617670.1|2886467_2886566_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_032617669.1|2886693_2886942_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_071886459.1|2887304_2887397_+	stress response membrane protein YncL	NA	NA	NA	NA	NA
WP_059308208.1|2887433_2887697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059308209.1|2887862_2890553_-	sulfotransferase family protein	NA	NA	NA	NA	NA
WP_167347884.1|2890549_2900914_-	cadherin domain-containing protein	NA	NA	NA	NA	NA
WP_082697346.1|2900994_2902245_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_082697347.1|2902234_2904460_-	ATP-binding cassette domain-containing protein	NA	F2Y302	Organic_Lake_phycodnavirus	36.3	3.4e-14
WP_059308211.1|2904459_2905647_-	TolC family protein	NA	NA	NA	NA	NA
WP_071886461.1|2906221_2906524_+	hypothetical protein	NA	A0A2H4J144	uncultured_Caudovirales_phage	39.2	1.7e-06
WP_059308212.1|2906510_2906837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032617657.1|2907272_2907473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023292711.1|2908191_2908344_-	isocitrate dehydrogenase (NADP(+))	NA	Q77Z09	Phage_21	94.0	3.4e-19
WP_059308213.1|2908524_2908728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059309124.1|2909521_2910703_+	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_059308214.1|2911211_2911529_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	50.0	7.6e-21
WP_059308215.1|2911852_2913961_-|tail	tail fiber domain-containing protein	tail	A0A1V0E5M2	Salmonella_phage	40.3	2.9e-31
WP_059308216.1|2914025_2914988_-	hypothetical protein	NA	A0A2P1CKS0	Pantoea_phage	35.4	5.9e-40
WP_059308217.1|2914984_2918395_-	host specificity protein J	NA	O64335	Escherichia_phage	71.3	0.0e+00
WP_059308218.1|2918448_2919039_-|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	79.6	1.4e-79
WP_059309125.1|2919099_2919513_-	hypothetical protein	NA	G8C7Q7	Escherichia_phage	65.7	9.8e-53
WP_059308219.1|2919542_2920253_-	C40 family peptidase	NA	K7PGV2	Enterobacterial_phage	85.6	2.9e-129
WP_059308220.1|2920254_2921010_-|tail	phage minor tail protein L	tail	K7PKU0	Enterobacteria_phage	85.7	7.7e-128
WP_059308221.1|2921006_2921354_-|tail	phage tail protein	tail	K7P7G7	Enterobacteria_phage	68.7	6.1e-40
WP_059308222.1|2921353_2923858_-|tail	phage tail tape measure protein	tail	K7PKR0	Enterobacteria_phage	66.3	6.4e-296
WP_059308223.1|2923838_2924147_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	54.1	1.8e-22
WP_059308224.1|2924167_2924578_-|tail	phage minor tail protein G	tail	M9NZD7	Enterobacteria_phage	43.1	1.9e-19
WP_059308225.1|2924619_2925357_-|tail	phage tail protein	tail	M9NYX0	Enterobacteria_phage	71.4	3.2e-94
WP_059308226.1|2925364_2925763_-|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	64.3	1.2e-44
WP_059308227.1|2925759_2926314_-|tail	phage tail protein	tail	K7PKQ5	Enterobacteria_phage	64.0	1.7e-44
WP_059308228.1|2926324_2926600_-	ATP-binding protein	NA	K7PH55	Enterobacterial_phage	50.0	3.2e-15
WP_059308229.1|2926592_2926916_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_156424709.1|2926996_2929057_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	K7PKX4	Enterobacterial_phage	84.3	0.0e+00
WP_059308231.1|2928938_2930444_-|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	73.3	9.7e-215
WP_059308232.1|2930440_2930662_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	67.6	8.5e-19
WP_059308233.1|2930658_2932758_-|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	77.3	0.0e+00
WP_059308234.1|2932757_2933246_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	82.1	5.8e-68
WP_059308235.1|2933487_2933829_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	37.8	6.5e-10
WP_059308236.1|2934488_2934686_-	hypothetical protein	NA	K7PHC3	Enterobacterial_phage	93.8	9.8e-27
WP_059308237.1|2935644_2936010_-	hypothetical protein	NA	R9TPM9	Aeromonas_phage	43.0	2.3e-13
WP_059309126.1|2935999_2936497_-	lysozyme	NA	A0A2H4JCH1	uncultured_Caudovirales_phage	77.0	3.2e-74
WP_051916132.1|2936504_2936735_-|holin	class II holin family protein	holin	A0A2H4JCI1	uncultured_Caudovirales_phage	59.2	1.3e-17
WP_059308238.1|2937300_2937909_-	hypothetical protein	NA	H9C175	Pectobacterium_phage	62.2	3.1e-63
WP_059308239.1|2937922_2938939_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.9	2.0e-107
WP_071886529.1|2938938_2939271_-	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	64.8	3.2e-38
WP_059308241.1|2939297_2939498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071886462.1|2939640_2939886_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	66.7	2.8e-23
WP_059308242.1|2939923_2940157_-	DinI family protein	NA	K7PM44	Enterobacteria_phage	77.9	1.6e-28
WP_059309127.1|2940729_2941812_+	DUF262 domain-containing protein	NA	A0A0R6PKN1	Moraxella_phage	32.1	2.4e-26
WP_059308243.1|2941811_2942606_+	hypothetical protein	NA	NA	NA	NA	NA
2942068:2942085	attL	AATATTTGGGTTTTGATG	NA	NA	NA	NA
WP_059308244.1|2942828_2943161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059308245.1|2943164_2943584_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_059308246.1|2943599_2944064_-	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	77.5	6.0e-67
WP_167347890.1|2944056_2944890_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	54.0	6.0e-49
WP_059308247.1|2945211_2945766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071886463.1|2945768_2945993_-	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	60.0	5.2e-16
WP_059308248.1|2946101_2946491_+	helix-turn-helix domain-containing protein	NA	A0A077KGZ5	Edwardsiella_phage	67.1	6.3e-17
WP_148568966.1|2946693_2946888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059308249.1|2946884_2947067_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_059308250.1|2947232_2947568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174521484.1|2947571_2947913_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_032617596.1|2950809_2951055_+	excisionase	NA	NA	NA	NA	NA
WP_059308252.1|2951035_2952163_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21925	Phage_21	62.6	1.7e-126
WP_059308253.1|2952280_2953531_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.8e-20
WP_059308254.1|2953648_2954302_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_059308255.1|2954312_2954786_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_059308256.1|2954827_2955937_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
2962831:2962848	attR	CATCAAAACCCAAATATT	NA	NA	NA	NA
