The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LN907827	Erwinia gerundensis isolate E_g_EM595 chromosome 1	3775020	1784277	1794476	3775020	tRNA	Tupanvirus(16.67%)	12	NA	NA
WP_067430235.1|1784277_1786206_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	8.8e-128
WP_067430238.1|1786209_1786761_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.5	2.2e-15
WP_004157374.1|1786853_1787051_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_067430241.1|1787154_1787511_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_157883913.1|1787628_1787673_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_067430244.1|1787828_1788812_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	42.6	4.9e-34
WP_067430246.1|1788826_1791214_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	31.2	2.1e-09
WP_017802142.1|1791218_1791518_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	5.5e-13
WP_067430249.1|1791715_1792066_+	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_067430252.1|1792160_1793144_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_067430255.1|1793181_1793727_+	glutathione peroxidase	NA	NA	NA	NA	NA
WP_067430258.1|1793729_1794476_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	W5SAS9	Pithovirus	28.8	1.7e-07
>prophage 2
NZ_LN907827	Erwinia gerundensis isolate E_g_EM595 chromosome 1	3775020	2164244	2230105	3775020	integrase,plate,tRNA,terminase,protease,capsid,portal,tail,head	Erwinia_phage(70.0%)	76	2190057:2190074	2211262:2211279
WP_067431189.1|2164244_2164946_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_067431192.1|2165006_2166917_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.4	1.9e-90
WP_173645369.1|2167005_2167173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157883864.1|2167437_2167698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067431195.1|2167705_2167993_-	type V toxin-antitoxin system endoribonuclease antitoxin GhoS	NA	NA	NA	NA	NA
WP_067431198.1|2168274_2168619_+	RidA family protein	NA	NA	NA	NA	NA
WP_067431201.1|2168630_2168816_-	YoaH family protein	NA	NA	NA	NA	NA
WP_067431204.1|2168919_2170290_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	31.7	1.6e-46
WP_067431207.1|2170279_2170861_+	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_067431210.1|2171032_2172397_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_067431213.1|2172613_2174176_+	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_067431216.1|2174219_2175785_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	44.4	4.7e-39
WP_067431219.1|2176261_2177224_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_067431222.1|2177281_2178079_+	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_067431225.1|2178094_2178940_+	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
WP_067431228.1|2178996_2179452_+	DUF986 domain-containing protein	NA	NA	NA	NA	NA
WP_067435358.1|2179825_2180386_+	manganese efflux pump MntP	NA	NA	NA	NA	NA
WP_067431231.1|2180382_2181198_-	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
WP_001062678.1|2181334_2181544_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
WP_157883919.1|2181625_2181700_-	DUF2627 domain-containing protein	NA	NA	NA	NA	NA
WP_067431234.1|2182230_2183226_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_067431237.1|2183243_2183498_-	YebO family protein	NA	NA	NA	NA	NA
WP_067431240.1|2183672_2183909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067431243.1|2183926_2184718_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_157883865.1|2185169_2185805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067431249.1|2186058_2187441_+	MFS transporter	NA	NA	NA	NA	NA
WP_067431253.1|2187489_2188371_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_067431255.1|2188569_2190597_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.4	3.0e-86
2190057:2190074	attL	TGCCGGTCAGCTTCAGGC	NA	NA	NA	NA
WP_067431258.1|2190616_2191303_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_067431261.1|2191408_2191900_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_067435361.1|2192121_2193366_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_067431263.1|2193334_2195974_+	PqiB family protein	NA	NA	NA	NA	NA
WP_157883866.1|2195943_2197488_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_067431266.1|2197489_2198137_-	metallophosphoesterase	NA	K7P6H8	Enterobacteria_phage	49.3	1.6e-57
WP_067431269.1|2198624_2199689_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4S6G4	Salmonella_phage	57.5	1.5e-116
WP_157883867.1|2200047_2200755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067431275.1|2200922_2201141_-	ogr/Delta-like zinc finger family protein	NA	F1BUT0	Erwinia_phage	83.3	8.0e-30
WP_067431279.1|2201212_2202403_-	phage late control D family protein	NA	S4TRX8	Salmonella_phage	70.0	5.6e-149
WP_067431282.1|2202396_2202924_-|tail	phage tail protein	tail	F1BUT6	Erwinia_phage	84.8	3.4e-58
WP_067431284.1|2202926_2205365_-|tail	phage tail tape measure protein	tail	S4TP64	Salmonella_phage	62.4	8.7e-181
WP_067431287.1|2205354_2205480_-|tail	GpE family phage tail protein	tail	Q858U8	Yersinia_virus	61.5	8.4e-08
WP_067431290.1|2205512_2205791_-|tail	phage tail assembly protein	tail	F1BUU0	Erwinia_phage	75.0	1.9e-31
WP_067431293.1|2205848_2206361_-|tail	phage major tail tube protein	tail	F1BUU2	Erwinia_phage	87.6	6.6e-83
WP_067431297.1|2206373_2207543_-|tail	phage tail sheath protein	tail	F1BUU3	Erwinia_phage	93.1	2.3e-208
WP_067435367.1|2207706_2207952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067431301.1|2207992_2208583_-|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	49.5	1.4e-47
WP_067431304.1|2208582_2209650_-|tail	phage tail protein	tail	A0A2I8TVA9	Erwinia_phage	56.6	3.9e-101
WP_067431307.1|2209646_2210255_-|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	85.1	1.2e-99
WP_067431310.1|2210247_2211156_-|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	86.8	6.2e-140
WP_067431313.1|2211160_2211508_-	GPW/gp25 family protein	NA	F1BUP4	Erwinia_phage	83.3	4.2e-49
2211262:2211279	attR	TGCCGGTCAGCTTCAGGC	NA	NA	NA	NA
WP_067431316.1|2211504_2212089_-|plate	phage baseplate assembly protein V	plate	F1BUP5	Erwinia_phage	82.0	1.3e-87
WP_067431319.1|2212178_2213258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067431322.1|2213259_2213709_-	phage virion morphogenesis protein	NA	F1BUP7	Erwinia_phage	74.1	2.9e-50
WP_067431325.1|2213705_2214173_-|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	81.3	2.0e-65
WP_067431328.1|2214247_2214697_-	LysB family transcriptional regulator	NA	F1BUQ1	Erwinia_phage	69.4	3.3e-46
WP_067431331.1|2214693_2215203_-	lysozyme	NA	E5G6N1	Salmonella_phage	66.3	1.8e-56
WP_067435370.1|2215186_2215411_-	hypothetical protein	NA	F1BUQ4	Erwinia_phage	86.5	4.0e-32
WP_067431334.1|2215416_2215620_-|tail	tail protein X	tail	F1BUQ5	Erwinia_phage	79.1	1.5e-25
WP_067431337.1|2215619_2216090_-|head	head completion/stabilization protein	head	F1BUQ6	Erwinia_phage	76.5	1.6e-59
WP_067431340.1|2216179_2216848_-	hypothetical protein	NA	F1BUQ7	Erwinia_phage	83.8	3.5e-100
WP_067431343.1|2216851_2217928_-|capsid	phage major capsid protein, P2 family	capsid	F1BUQ8	Erwinia_phage	83.9	4.7e-171
WP_067431346.1|2217976_2218822_-|capsid	GPO family capsid scaffolding protein	capsid	F1BUR1	Erwinia_phage	78.4	8.0e-118
WP_067435373.1|2218967_2220731_+|terminase	terminase ATPase subunit family protein	terminase	F1BUR2	Erwinia_phage	93.0	0.0e+00
WP_067431349.1|2220730_2221753_+|portal	phage portal protein	portal	F1BUR7	Erwinia_phage	90.9	3.6e-181
WP_067435379.1|2221786_2222527_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_067431352.1|2222519_2223440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173645370.1|2223909_2224086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082691659.1|2224194_2226492_-	replication endonuclease	NA	F1BUS0	Erwinia_phage	74.2	0.0e+00
WP_067431355.1|2226492_2227104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067431361.1|2227106_2227328_-	TraR/DksA family transcriptional regulator	NA	F1BUS2	Erwinia_phage	52.8	8.7e-16
WP_067431364.1|2227327_2227555_-	DUF2732 domain-containing protein	NA	F1BUS3	Erwinia_phage	69.3	1.6e-20
WP_157883868.1|2227624_2228008_-	hypothetical protein	NA	F1BUS4	Erwinia_phage	77.2	4.1e-53
WP_071852509.1|2228010_2228196_-	DUF2724 domain-containing protein	NA	F1BUS5	Erwinia_phage	67.2	1.3e-17
WP_067431367.1|2228203_2228713_-	phage regulatory CII family protein	NA	F1BUS6	Erwinia_phage	70.4	5.1e-59
WP_067431370.1|2228744_2229146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067431373.1|2229259_2230105_+	phage repressor protein CI	NA	Q6K1G0	Salmonella_virus	53.0	2.5e-79
>prophage 1
NZ_LN907828	Erwinia gerundensis isolate E_g_EM595 plasmid pEM01, complete sequence	571293	495984	503258	571293	holin	Bacillus_phage(33.33%)	8	NA	NA
WP_067436798.1|495984_498015_+|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	28.0	1.5e-21
WP_082691706.1|498102_498648_-	flavin reductase	NA	Q9KX93	Enterobacteria_phage	51.6	8.5e-20
WP_067436801.1|498640_499231_-	malonic semialdehyde reductase	NA	NA	NA	NA	NA
WP_067436804.1|499595_499808_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	80.0	1.7e-24
WP_067436807.1|500544_500799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067436810.1|500965_501307_-	multidrug efflux SMR transporter	NA	E5E3Y9	Acinetobacter_phage	32.7	5.7e-06
WP_067436812.1|501399_502566_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	26.2	2.4e-19
WP_067436815.1|502562_503258_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	30.8	1.7e-25
>prophage 1
NZ_LN907829	Erwinia gerundensis isolate E_g_EM595 plasmid pEM02, complete sequence	134943	8182	72936	134943	integrase	uncultured_Caudovirales_phage(22.22%)	58	56930:56957	86607:86634
WP_067437072.1|8182_8860_-|integrase	integrase	integrase	A0A2K9V411	Faecalibacterium_phage	35.5	6.4e-25
WP_067437075.1|8949_9258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067437078.1|10306_11293_-	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	39.8	7.6e-51
WP_067437081.1|11367_11970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067437084.1|12062_12689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157883956.1|12768_13131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157883957.1|13200_13527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067437096.1|13981_14329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067437375.1|14638_15532_-|integrase	integrase domain-containing protein	integrase	NA	NA	NA	NA
WP_067437098.1|16475_16826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067437378.1|17662_18559_+	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	52.5	5.4e-72
WP_067437381.1|19067_20342_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	60.0	1.7e-143
WP_067437383.1|20350_20764_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	50.8	1.6e-26
WP_067437104.1|21150_21486_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_162265774.1|21512_22205_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	75.7	9.3e-96
WP_067437109.1|22267_22696_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	71.4	1.3e-52
WP_067437112.1|22745_24029_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	75.1	1.7e-175
WP_067437115.1|24126_24480_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	56.1	3.8e-21
WP_082691721.1|24734_25616_-	arsenic resistance protein	NA	NA	NA	NA	NA
WP_067437126.1|26415_26874_-	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_082691722.1|27199_29584_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	44.8	1.9e-135
WP_067437128.1|29698_31822_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_067437131.1|32879_33116_-	hypothetical protein	NA	A0A218MNF2	uncultured_virus	72.4	3.4e-26
WP_067437134.1|33492_34266_-	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	26.2	2.3e-10
WP_064691134.1|34330_35032_-	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_067437136.1|35085_36201_-	alkene reductase	NA	NA	NA	NA	NA
WP_064691136.1|36438_36768_+	thioredoxin family protein	NA	V9SJ74	Achromobacter_phage	37.2	1.8e-09
WP_067437142.1|36798_37137_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_067437145.1|37141_37720_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_067437148.1|38513_39377_+	EamA family transporter	NA	NA	NA	NA	NA
WP_067437149.1|39517_40729_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_029571183.1|40762_42118_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.2	1.0e-34
WP_029571184.1|42280_42838_-	OsmC family protein	NA	NA	NA	NA	NA
WP_071852582.1|43392_44841_+	xylulokinase	NA	NA	NA	NA	NA
WP_067437154.1|44837_45863_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_067437157.1|45904_46885_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_067437160.1|48649_48934_+	DUF3892 domain-containing protein	NA	NA	NA	NA	NA
WP_067437163.1|48979_49540_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_067437389.1|49553_50306_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	27.7	2.4e-12
WP_067437166.1|50410_51055_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_067437169.1|51079_52333_-	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_067437177.1|52356_52650_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_067437179.1|52668_53118_-	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_067437182.1|53568_54537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067437391.1|55068_56196_+	MFS transporter	NA	NA	NA	NA	NA
WP_067437184.1|56475_56886_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
56930:56957	attL	CAACGTCCGCTTTTGGCACAAAGCGGAC	NA	NA	NA	NA
WP_067437186.1|57068_57395_-	NIPSNAP family protein	NA	NA	NA	NA	NA
WP_067437394.1|59745_60744_-|integrase	site-specific integrase	integrase	A0A166YH27	Gordonia_phage	30.8	3.4e-06
WP_061716752.1|61120_61543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039389851.1|62394_62625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039389849.1|62921_64763_+	copper resistance system multicopper oxidase	NA	NA	NA	NA	NA
WP_039389843.1|65780_66161_+	copper homeostasis periplasmic binding protein CopC	NA	NA	NA	NA	NA
WP_061716749.1|66165_67098_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_067437192.1|67129_67810_+	heavy metal response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.1	3.5e-31
WP_067437195.1|67806_69216_+	heavy metal sensor histidine kinase	NA	NA	NA	NA	NA
WP_039389835.1|69344_69695_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	58.4	1.4e-15
WP_067437198.1|69844_71950_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_064740974.1|71949_72936_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
86607:86634	attR	GTCCGCTTTGTGCCAAAAGCGGACGTTG	NA	NA	NA	NA
