The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP008859	Pseudomonas aeruginosa strain H5708 chromosome, complete genome	6334378	672433	726962	6334378	tRNA,tail,holin	Pseudomonas_phage(53.85%)	57	NA	NA
WP_003129196.1|672433_673459_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.1	8.3e-109
WP_003085061.1|673537_674107_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_003099587.1|674190_674544_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_059297723.1|674534_675077_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_003117955.1|675049_676282_-	multifunctional CCA addition/repair protein	NA	A0A076G5T8	Escherichia_phage	43.3	2.0e-77
WP_009875777.1|676325_676832_-	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_003099581.1|676925_678479_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_003099579.1|678475_679747_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	37.2	4.2e-09
WP_003085078.1|679847_681770_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_003099577.1|682048_682381_-	thiosulfate sulfurtransferase GlpE	NA	NA	NA	NA	NA
WP_003113213.1|682424_683276_-	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	33.3	1.1e-08
WP_003085085.1|683275_683656_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_003085087.1|683692_684499_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_003123920.1|684614_685601_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_003109024.1|685597_686890_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_049320792.1|686870_689654_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_003137370.1|689780_690797_+	phosphotransferase	NA	NA	NA	NA	NA
WP_016852410.1|690793_691468_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_049320790.1|691469_692228_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_023100177.1|692228_693290_-	alpha/beta hydrolase family protein	NA	NA	NA	NA	NA
WP_023100178.1|693441_695835_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_003085103.1|695880_696513_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003085106.1|696641_697676_+	polyamine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_021263059.1|697909_699019_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.4	7.8e-28
WP_003099539.1|699074_700121_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014604087.1|700235_701483_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003099535.1|701588_702419_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003085122.1|702542_703217_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_003099532.1|703216_704035_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_003085126.1|704107_705586_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_003113203.1|705903_706218_-	transcription regulatory protein PrtN	NA	NA	NA	NA	NA
WP_003113202.1|706317_707088_-	helix-turn-helix transcriptional regulator	NA	A0A1B0Z078	Pseudomonas_phage	59.1	1.4e-71
WP_003085132.1|707545_707746_+	repressor PtrB	NA	W6ATC1	Enterobacter_phage	58.3	3.7e-05
WP_003118907.1|707793_708153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073652111.1|708515_708959_+|holin	holin	holin	B5TK61	Pseudomonas_phage	50.9	4.2e-25
WP_016263867.1|708974_709604_+	glycoside hydrolase family 19 protein	NA	A0A125RNP1	Pseudomonas_phage	78.5	1.4e-87
WP_003142810.1|709600_709963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003137395.1|709959_710217_+	hypothetical protein	NA	A0A125RNP3	Pseudomonas_phage	64.6	6.4e-18
WP_003113190.1|710532_711027_+	hypothetical protein	NA	A0A286S1Q8	Klebsiella_phage	56.5	1.4e-45
WP_003113189.1|711038_711386_+|tail	phage tail assembly chaperone family protein, TAC	tail	NA	NA	NA	NA
WP_003113188.1|711415_711670_+	hypothetical protein	NA	A0A2H4PI34	Pseudomonas_phage	38.4	6.3e-10
WP_003113187.1|711716_713552_+|tail	phage tail tape measure protein	tail	A0A0S2SYD9	Pseudomonas_phage	36.2	1.2e-28
WP_003113186.1|713544_713886_+|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	40.0	1.4e-17
WP_003118922.1|713893_714589_+|tail	phage minor tail protein L	tail	A0A1B0VNE0	Pseudomonas_phage	50.2	1.5e-69
WP_003113184.1|714591_715362_+	C40 family peptidase	NA	A0A2D1GNP8	Pseudomonas_phage	55.6	4.2e-81
WP_003118924.1|715416_716019_+|tail	tail assembly protein	tail	A0A1V0E8A0	Vibrio_phage	57.3	4.9e-53
WP_003118925.1|716077_719692_+|tail	phage tail protein	tail	A0A0S2SYC5	Pseudomonas_phage	55.6	0.0e+00
WP_003118927.1|719927_720716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003115342.1|720739_721831_+	hypothetical protein	NA	A0A0S2SY45	Pseudomonas_phage	36.9	1.3e-46
WP_003113180.1|721830_722166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003118928.1|722146_722377_+	hypothetical protein	NA	A0A1W6JT87	Pseudomonas_phage	65.3	6.7e-19
WP_003118929.1|722472_723525_+	hypothetical protein	NA	A0A0H5AXZ9	Pseudomonas_phage	52.5	2.7e-62
WP_003113177.1|723524_723827_+	hypothetical protein	NA	A0A0H5B141	Pseudomonas_phage	71.0	4.4e-34
WP_003118930.1|723823_724054_+	hypothetical protein	NA	C8ZKF3	Pseudomonas_phage	71.6	1.4e-24
WP_003101640.1|724472_725078_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	65.8	6.0e-75
WP_003085203.1|725079_726129_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	57.8	1.8e-111
WP_003085205.1|726125_726962_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	56.9	2.1e-70
>prophage 2
NZ_CP008859	Pseudomonas aeruginosa strain H5708 chromosome, complete genome	6334378	1460565	1469593	6334378		Bacillus_phage(33.33%)	8	NA	NA
WP_003098558.1|1460565_1461201_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	52.3	1.0e-40
WP_003115226.1|1461246_1462140_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A0S2SXL7	Bacillus_phage	34.3	3.0e-06
WP_003113871.1|1462244_1463249_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.3	7.0e-36
WP_003092272.1|1463674_1463998_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_003113873.1|1464064_1466632_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.1	3.2e-24
WP_003098486.1|1466757_1467765_-	TolB family protein	NA	NA	NA	NA	NA
WP_003092262.1|1467912_1468419_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	76.0	8.1e-57
WP_003092260.1|1468552_1469593_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	59.5	1.5e-113
>prophage 3
NZ_CP008859	Pseudomonas aeruginosa strain H5708 chromosome, complete genome	6334378	2556025	2562919	6334378	tRNA	uncultured_Caudovirales_phage(85.71%)	9	NA	NA
WP_003097631.1|2556025_2557306_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.4	8.2e-98
WP_003097630.1|2557307_2558705_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_003097628.1|2558709_2559684_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_003097625.1|2559771_2560755_-	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	74.0	3.5e-141
WP_003119979.1|2560751_2561087_-	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	69.4	1.5e-38
WP_031690242.1|2561083_2561389_-	sulfurtransferase complex subunit TusB	NA	A0A2H4JG28	uncultured_Caudovirales_phage	59.6	3.0e-22
WP_016562012.1|2561388_2561748_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	61.7	1.1e-34
WP_031690243.1|2561744_2562140_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	70.5	1.0e-46
WP_003090386.1|2562250_2562919_-	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	82.1	1.5e-90
>prophage 4
NZ_CP008859	Pseudomonas aeruginosa strain H5708 chromosome, complete genome	6334378	2636590	2687855	6334378	integrase,tail,holin,terminase	Pseudomonas_phage(70.59%)	67	2636449:2636508	2688087:2688167
2636449:2636508	attL	GACTTAAAATCCCTCGGGGGTAACCCCGTGCCGGTTCGACCCCGGCTCCGGGCACCATCG	NA	NA	NA	NA
WP_016562002.1|2636590_2637619_-|integrase	tyrosine-type recombinase/integrase	integrase	C8CLF4	Xylella_phage	56.9	2.3e-98
WP_016562001.1|2637619_2637832_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_034058649.1|2639239_2639980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034058646.1|2640036_2640306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059298413.1|2640302_2642381_-	DNA cytosine methyltransferase	NA	A0A140IES2	Pseudomonas_phage	84.2	0.0e+00
WP_015975412.1|2642377_2643232_-	DNA adenine methylase	NA	Q5QF26	Pseudomonas_virus	100.0	8.0e-166
WP_059298411.1|2643376_2645119_-	AAA family ATPase	NA	J7HXJ7	Pseudomonas_phage	91.9	1.3e-279
WP_023105185.1|2645122_2646094_-	DNA translocase FtsK	NA	H2BD47	Pseudomonas_phage	96.0	7.5e-168
WP_003116739.1|2646106_2646307_-	hypothetical protein	NA	H2BD48	Pseudomonas_phage	100.0	4.3e-30
WP_014602814.1|2646313_2647213_-	recombination protein RecT	NA	Q858E1	Salmonella_phage	73.6	3.2e-104
WP_023103086.1|2647225_2648134_-	YqaJ viral recombinase family protein	NA	Q858E0	Salmonella_phage	71.6	3.6e-124
WP_047568210.1|2648144_2648354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014602818.1|2648350_2648572_-	hypothetical protein	NA	H2BD53	Pseudomonas_phage	98.6	4.6e-33
WP_023104434.1|2648555_2648708_-	hypothetical protein	NA	J7HXJ0	Pseudomonas_phage	100.0	2.6e-11
WP_003099041.1|2649207_2649579_-	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	100.0	8.5e-64
WP_033944862.1|2650496_2650709_-	hypothetical protein	NA	L7TKR9	Pseudomonas_virus	98.6	5.2e-34
WP_080712192.1|2650800_2650986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047568215.1|2651536_2651869_+	DUF1654 domain-containing protein	NA	H2BD60	Pseudomonas_phage	91.7	6.5e-47
WP_124131500.1|2651918_2652272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052174268.1|2652454_2653027_-	S24 family peptidase	NA	H2BD63	Pseudomonas_phage	90.0	1.4e-84
WP_003451709.1|2653404_2653623_+	helix-turn-helix domain-containing protein	NA	A0A2D1GND2	Pseudomonas_phage	64.7	2.9e-19
WP_047568221.1|2653654_2654227_+	hypothetical protein	NA	H2BD67	Pseudomonas_phage	98.4	3.9e-100
WP_059298409.1|2654229_2655192_+	hypothetical protein	NA	A0A2H4JCW9	uncultured_Caudovirales_phage	47.5	1.2e-13
WP_059298638.1|2655319_2655733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033992846.1|2655725_2656169_+	RusA family crossover junction endodeoxyribonuclease	NA	J7I4J7	Pseudomonas_phage	98.6	2.8e-77
WP_059298407.1|2656197_2657067_+	hypothetical protein	NA	J7HXH6	Pseudomonas_phage	95.8	7.2e-162
WP_023105198.1|2657203_2657395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023105199.1|2657479_2657863_+	hypothetical protein	NA	J7I0R6	Pseudomonas_phage	98.4	3.5e-60
WP_023083724.1|2657855_2658140_+|holin	phage holin family protein	holin	H2BD74	Pseudomonas_phage	98.9	2.7e-41
WP_145955294.1|2658547_2658805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059298405.1|2658791_2659058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023115879.1|2659340_2659763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145955295.1|2659899_2660331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059298403.1|2660459_2661056_+|terminase	terminase small subunit	terminase	H2BD75	Pseudomonas_phage	59.9	9.9e-46
WP_059298401.1|2661042_2662338_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	58.5	1.8e-145
WP_016263341.1|2662340_2663696_+	DUF4055 domain-containing protein	NA	A0A0H5AWC7	Pseudomonas_phage	45.8	9.6e-97
WP_059298398.1|2663692_2664772_+	hypothetical protein	NA	A0A0S2SY77	Pseudomonas_phage	98.1	1.7e-200
WP_016263343.1|2664900_2665644_+	hypothetical protein	NA	A0A0H5AWD1	Pseudomonas_phage	74.5	3.8e-87
WP_010793134.1|2665653_2666625_+	hypothetical protein	NA	A0A0M3LQL5	Mannheimia_phage	64.7	5.4e-110
WP_003103393.1|2666666_2667152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059298396.1|2667135_2667600_+	hypothetical protein	NA	H9EB35	Vibrio_phage	35.1	3.4e-09
WP_059298394.1|2667599_2667989_+	hypothetical protein	NA	A0A2H4JAS3	uncultured_Caudovirales_phage	54.3	8.2e-33
WP_003451670.1|2667992_2668667_+	hypothetical protein	NA	A0A0S2SY81	Pseudomonas_phage	96.4	4.6e-116
WP_003451667.1|2668663_2669074_+	DUF4128 domain-containing protein	NA	A0A1B0VMI0	Pseudomonas_phage	43.4	2.5e-24
WP_012075337.1|2669141_2669795_+|tail	phage tail protein	tail	A0A2H4IZV5	uncultured_Caudovirales_phage	52.8	7.7e-60
WP_059298393.1|2669804_2670185_+|tail	phage tail assembly chaperone	tail	A0A1S5R1H9	Pseudomonas_phage	44.4	9.4e-26
WP_012075338.1|2670247_2670511_+	DUF1799 domain-containing protein	NA	A0A2R3UAE2	Siphoviridae_environmental_samples	46.0	1.4e-15
WP_059298391.1|2670507_2673732_+|tail	phage tail tape measure protein	tail	A0A0S2SYD9	Pseudomonas_phage	37.0	9.6e-119
WP_012075340.1|2673737_2674076_+|tail	phage tail protein	tail	A0A0S2SYI2	Pseudomonas_phage	99.1	3.1e-60
WP_023911947.1|2674072_2674822_+|tail	phage minor tail protein L	tail	A0A0S2SY57	Pseudomonas_phage	99.2	8.6e-148
WP_059298389.1|2674824_2675580_+	C40 family peptidase	NA	A0A0S2SY75	Pseudomonas_phage	95.1	6.5e-143
WP_023087402.1|2675726_2675930_-	hypothetical protein	NA	A0A0S2SY70	Pseudomonas_phage	68.7	1.1e-17
WP_023087403.1|2676132_2677056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_124175358.1|2677665_2678229_+	hypothetical protein	NA	A0A0S2SYF4	Pseudomonas_phage	98.5	1.4e-30
WP_059298387.1|2678299_2678884_+|tail	tail assembly protein	tail	A0A0S2SYS2	Pseudomonas_phage	99.0	8.6e-103
WP_145955296.1|2678925_2679150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059298385.1|2679207_2682870_+|tail	phage tail protein	tail	A0A0S2SYC5	Pseudomonas_phage	86.4	0.0e+00
WP_004349473.1|2682866_2683151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080712191.1|2683147_2683813_+	hypothetical protein	NA	A0A0S2SYG5	Pseudomonas_phage	49.3	5.1e-59
WP_059298383.1|2683831_2684626_+	hypothetical protein	NA	A0A0S2SY45	Pseudomonas_phage	70.8	1.6e-88
WP_023087407.1|2684622_2684937_+	hypothetical protein	NA	A0A0U4K5I1	Pseudomonas_phage	94.2	6.3e-52
WP_059298381.1|2684996_2685626_+	glycoside hydrolase family 19 protein	NA	A0A125RNP1	Pseudomonas_phage	93.8	2.8e-107
WP_059298379.1|2685622_2685991_+	hypothetical protein	NA	H2BDD6	Pseudomonas_virus	82.0	2.2e-43
WP_059298636.1|2686068_2686332_+	hypothetical protein	NA	A0A125RNP3	Pseudomonas_phage	90.7	5.3e-36
WP_031652693.1|2686367_2686634_+	hypothetical protein	NA	L7TP56	Pseudomonas_virus	98.9	1.8e-44
WP_059298377.1|2686615_2687302_-	SOS response-associated peptidase	NA	A0A2K8I970	Pseudomonas_phage	88.6	1.6e-119
WP_059298375.1|2687339_2687855_-	hypothetical protein	NA	L7TIE6	Pseudomonas_virus	96.5	1.6e-97
2688087:2688167	attR	GACTTAAAATCCCTCGGGGGTAACCCCGTGCCGGTTCGACCCCGGCTCCGGGCACCATCGTGTTTCCTGGCGTTCAGCCGA	NA	NA	NA	NA
>prophage 5
NZ_CP008859	Pseudomonas aeruginosa strain H5708 chromosome, complete genome	6334378	2923475	2961947	6334378	tail,plate	Planktothrix_phage(33.33%)	33	NA	NA
WP_003122677.1|2923475_2924759_-|tail	pyoverdine-tailoring periplasmic protein PvdN	tail	NA	NA	NA	NA
WP_059298330.1|2924781_2926128_-|tail	pyoverdine-tailoring dipeptidase-like protein PvdM	tail	NA	NA	NA	NA
WP_059298328.1|2926343_2927978_+	pyoverdine maturation tyrosinase PvdP	NA	NA	NA	NA	NA
WP_059298326.1|2928026_2929451_-	pyoverdine export/recycling transporter outer membrane subunit OmpQ	NA	NA	NA	NA	NA
WP_003089549.1|2929456_2931448_-	pyoverdine export/recycling transporter ATP-binding/permease subunit PvdT	NA	G9BWD6	Planktothrix_phage	39.3	6.9e-35
WP_003089547.1|2931447_2932623_-	pyoverdine export/recycling transporter periplasmic adaptor subunit PvdR	NA	NA	NA	NA	NA
WP_029528736.1|2932723_2933719_-	FecR family protein	NA	NA	NA	NA	NA
WP_003103620.1|2933882_2934362_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_003114509.1|2934494_2935826_+	L-ornithine N(5)-monooxygenase	NA	NA	NA	NA	NA
WP_080712188.1|2935948_2938237_+	acylase	NA	NA	NA	NA	NA
WP_003089535.1|2938417_2938741_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_059298325.1|2938782_2939703_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003104946.1|2939799_2940951_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_003089526.1|2941027_2941270_-	DUF1654 domain-containing protein	NA	NA	NA	NA	NA
WP_003104944.1|2941564_2941801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003089521.1|2942065_2942536_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_059298323.1|2942532_2944848_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	NA	NA	NA	NA
WP_003115787.1|2945264_2946470_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003116947.1|2946670_2947312_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003089513.1|2947588_2947984_+	DUF4280 domain-containing protein	NA	NA	NA	NA	NA
WP_003114514.1|2948006_2948543_-	toxin-antitoxin system YwqK family antitoxin	NA	NA	NA	NA	NA
WP_003114515.1|2948553_2950560_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	29.5	7.7e-42
WP_003104930.1|2950559_2950748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003122693.1|2950907_2951480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003114516.1|2951501_2954051_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	29.4	1.2e-76
WP_003114517.1|2954052_2955069_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_003104926.1|2955032_2956826_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_003122696.1|2956809_2957235_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_003117302.1|2957247_2957745_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_003089494.1|2957818_2959303_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_003089493.1|2959325_2959871_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_034011584.1|2960079_2960556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023088798.1|2960615_2961947_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 6
NZ_CP008859	Pseudomonas aeruginosa strain H5708 chromosome, complete genome	6334378	5260444	5295466	6334378	integrase,tRNA,coat	Pseudomonas_phage(61.54%)	36	5287412:5287471	5300807:5300888
WP_003099340.1|5260444_5260993_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_004352709.1|5261023_5261557_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_004352708.1|5261556_5262099_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_004352706.1|5262117_5262906_+	molecular chaperone	NA	NA	NA	NA	NA
WP_059297970.1|5262922_5265295_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_003099330.1|5265291_5266239_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_003099328.1|5266240_5267614_-	MFS transporter	NA	NA	NA	NA	NA
WP_059297967.1|5267893_5268916_-	ferrochelatase	NA	NA	NA	NA	NA
WP_003114699.1|5268912_5269830_-	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_003099318.1|5270243_5271227_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_031805162.1|5271379_5272336_+	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_031805163.1|5272345_5273245_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	39.1	8.5e-17
WP_034025893.1|5273241_5274687_+	deoxyribodipyrimidine photo-lyase	NA	A0A167RC11	Powai_lake_megavirus	28.3	2.0e-44
WP_003099307.1|5274812_5275334_-	acyloxyacyl hydrolase	NA	A0A2H4J0I5	uncultured_Caudovirales_phage	69.8	1.4e-59
WP_034025903.1|5275467_5276265_-	glutamate racemase	NA	NA	NA	NA	NA
WP_003099296.1|5276254_5277013_-	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_003099293.1|5277006_5277837_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_059297965.1|5277838_5278921_-	peptide chain release factor 1	NA	A0A0S4KWG0	Pseudomonas_phage	48.3	5.6e-07
WP_003095001.1|5278938_5280207_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_004352693.1|5280350_5282123_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_003095005.1|5282127_5282745_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_003099284.1|5282746_5283595_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_003099281.1|5283761_5284703_+	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	35.4	4.1e-46
WP_003099279.1|5284819_5285434_+	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_003099278.1|5285475_5286060_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_003099270.1|5286100_5287201_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
5287412:5287471	attL	ATTCATAATGCTGATGTCCCAGGTTCAAGTCCCGGTGTAGCCACCATATTTTTCAAGGGG	NA	NA	NA	NA
WP_023120070.1|5287520_5287958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023116767.1|5288004_5289012_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	47.1	4.8e-77
WP_004352686.1|5289008_5290301_-	hypothetical protein	NA	Q56VN8	Pseudomonas_phage	92.3	1.8e-241
WP_059297962.1|5290530_5291805_-	zonular occludens toxin family protein	NA	Q56VN9	Pseudomonas_phage	88.5	1.8e-201
WP_003114150.1|5291808_5292165_-	DUF2523 domain-containing protein	NA	Q56VP0	Pseudomonas_phage	100.0	7.9e-59
WP_079388099.1|5292169_5293444_-	attachment protein	NA	Q56VP1	Pseudomonas_phage	86.7	1.8e-44
WP_003125072.1|5293591_5293840_-|coat	phage coat protein B	coat	Q56VP2	Pseudomonas_phage	92.7	2.0e-32
WP_003115979.1|5293852_5294104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025324669.1|5294225_5294660_-	hypothetical protein	NA	Q56VP5	Pseudomonas_phage	98.6	2.1e-61
WP_059297957.1|5295175_5295466_-	DUF5447 family protein	NA	Q56VP7	Pseudomonas_phage	95.8	2.5e-55
5300807:5300888	attR	ATTCATAATGCTGATGTCCCAGGTTCAAGTCCCGGTGTAGCCACCATATTTTTCAAGGGGTTAGCGCAAGCTAACCCCTTTT	NA	NA	NA	NA
