The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP008864	Pseudomonas aeruginosa strain W60856 chromosome, complete genome	6896700	645056	701433	6896700	tail,tRNA,integrase,holin	Pseudomonas_phage(56.0%)	55	679823:679837	701950:701964
WP_003099590.1|645056_646082_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.1	1.4e-108
WP_003085061.1|646160_646730_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_003099587.1|646813_647167_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_003142783.1|647157_647700_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_003117955.1|647672_648905_-	multifunctional CCA addition/repair protein	NA	A0A076G5T8	Escherichia_phage	43.3	2.0e-77
WP_014602427.1|648948_649455_-	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_031690189.1|649548_651102_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_003099579.1|651098_652370_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	37.2	4.2e-09
WP_003085078.1|652470_654393_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_003085081.1|654672_655005_-	thiosulfate sulfurtransferase GlpE	NA	NA	NA	NA	NA
WP_019681087.1|655048_655900_-	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	33.3	2.8e-09
WP_003085085.1|655899_656280_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_003161932.1|656316_657123_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_003117956.1|657238_658225_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_003109024.1|658221_659514_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_003459402.1|659494_662287_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_031634768.1|662419_664132_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	82.1	1.8e-281
WP_003085094.1|665403_666420_+	phosphotransferase	NA	NA	NA	NA	NA
WP_016852410.1|666416_667091_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_003085097.1|667092_667851_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_031690190.1|667851_668913_-	alpha/beta hydrolase family protein	NA	NA	NA	NA	NA
WP_059309842.1|669064_671458_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_003085103.1|671503_672136_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003085106.1|672264_673299_+	polyamine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003085109.1|673532_674642_+	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.4	7.8e-28
WP_003099539.1|674697_675744_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003459412.1|675858_677106_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003099535.1|677211_678042_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003085122.1|678165_678840_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_003099532.1|678839_679658_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_003085126.1|679730_681209_+	anthranilate synthase component I	NA	NA	NA	NA	NA
679823:679837	attL	GTCGATCTACCTGAA	NA	NA	NA	NA
WP_003121843.1|681525_681840_-	pyocin activator PrtN family protein	NA	NA	NA	NA	NA
WP_003113202.1|681939_682710_-	helix-turn-helix transcriptional regulator	NA	A0A1B0Z078	Pseudomonas_phage	59.1	1.4e-71
WP_003085132.1|683167_683368_+	repressor PtrB	NA	W6ATC1	Enterobacter_phage	58.3	3.7e-05
WP_003118907.1|683415_683775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017002346.1|684137_684581_+|holin	holin	holin	B5TK61	Pseudomonas_phage	51.8	6.5e-26
WP_031690192.1|684596_685226_+	glycoside hydrolase family 19 protein	NA	A0A125RNP1	Pseudomonas_phage	78.0	1.2e-86
WP_004355109.1|685222_685585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031690193.1|685581_685839_+	hypothetical protein	NA	A0A125RNP3	Pseudomonas_phage	63.4	1.9e-17
WP_003113190.1|686154_686649_+	hypothetical protein	NA	A0A286S1Q8	Klebsiella_phage	56.5	1.4e-45
WP_003113189.1|686660_687008_+|tail	phage tail assembly chaperone family protein, TAC	tail	NA	NA	NA	NA
WP_003113188.1|687037_687292_+	hypothetical protein	NA	A0A2H4PI34	Pseudomonas_phage	38.4	6.3e-10
WP_023102822.1|687338_689174_+|tail	phage tail tape measure protein	tail	A0A0S2SYD9	Pseudomonas_phage	35.8	2.0e-28
WP_003113186.1|689166_689508_+|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	40.0	1.4e-17
WP_003117971.1|689515_690211_+|tail	phage minor tail protein L	tail	A0A1B0VNE0	Pseudomonas_phage	50.2	1.1e-69
WP_003113184.1|690213_690984_+	C40 family peptidase	NA	A0A2D1GNP8	Pseudomonas_phage	55.6	4.2e-81
WP_016252934.1|691038_691641_+|tail	tail assembly protein	tail	A0A1V0E8A0	Vibrio_phage	57.3	4.9e-53
WP_058177419.1|691699_695353_+|tail	phage tail protein	tail	A0A0S2SYC5	Pseudomonas_phage	57.3	0.0e+00
WP_124132227.1|695573_696311_+	hypothetical protein	NA	A0A2K9VHT7	Pseudomonas_phage	25.8	3.3e-06
WP_031690309.1|696319_697372_+	hypothetical protein	NA	A0A0H5AXZ9	Pseudomonas_phage	50.6	6.4e-64
WP_003113177.1|697371_697674_+	hypothetical protein	NA	A0A0H5B141	Pseudomonas_phage	71.0	4.4e-34
WP_003161916.1|697670_697901_+	hypothetical protein	NA	C8ZKF3	Pseudomonas_phage	70.3	1.4e-24
WP_031690310.1|698497_699700_+|integrase	tyrosine-type recombinase/integrase	integrase	B7SYF8	Stenotrophomonas_phage	45.8	1.5e-88
WP_031690311.1|699848_700610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031690312.1|701232_701433_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	55.4	1.5e-14
701950:701964	attR	GTCGATCTACCTGAA	NA	NA	NA	NA
>prophage 2
NZ_CP008864	Pseudomonas aeruginosa strain W60856 chromosome, complete genome	6896700	1541879	1596373	6896700	integrase,protease,transposase	Pseudomonas_phage(42.86%)	58	1564951:1564972	1577805:1577826
WP_003098455.1|1541879_1542482_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016253826.1|1542645_1544280_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_003110841.1|1544303_1546151_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_003085366.1|1546161_1546581_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_014603257.1|1546589_1547336_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_003110840.1|1547403_1549110_+	putative porin	NA	NA	NA	NA	NA
WP_004352985.1|1549144_1549807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003085375.1|1549835_1550315_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_003120806.1|1550319_1551264_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_031690431.1|1551263_1551689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021264203.1|1551698_1552685_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003085387.1|1552756_1553422_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003085391.1|1553404_1554310_-	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_003112713.1|1554388_1555705_-	MFS transporter	NA	NA	NA	NA	NA
WP_023122330.1|1555775_1557170_-	amidase	NA	NA	NA	NA	NA
WP_003116522.1|1557296_1557917_-	CatB-related O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	39.6	2.2e-27
WP_003098436.1|1557950_1558853_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	40.8	1.1e-11
WP_009315223.1|1559107_1559746_-	type B chloramphenicol O-acetyltransferase	NA	M1HS53	Paramecium_bursaria_Chlorella_virus	31.7	4.1e-13
WP_003141130.1|1559838_1560618_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_003098432.1|1560903_1561758_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003085421.1|1561873_1562170_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_016253820.1|1562214_1562610_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_014603249.1|1562653_1563160_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_003085431.1|1563218_1563476_-	YjhX family toxin	NA	NA	NA	NA	NA
WP_020750424.1|1563815_1564109_+	DUF2845 domain-containing protein	NA	NA	NA	NA	NA
WP_025324727.1|1564340_1564817_+	hypothetical protein	NA	NA	NA	NA	NA
1564951:1564972	attL	GATCTGGAGCGGGCGAAGGGAA	NA	NA	NA	NA
WP_114230043.1|1565500_1567087_+	DUF4365 domain-containing protein	NA	NA	NA	NA	NA
WP_078451756.1|1567445_1568495_-	DUF4238 domain-containing protein	NA	NA	NA	NA	NA
WP_078451755.1|1568498_1569191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078451754.1|1569245_1569518_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_023084690.1|1569630_1569846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059309810.1|1570215_1570503_+	DUF5447 family protein	NA	Q56VP7	Pseudomonas_phage	93.6	6.4e-51
WP_003140508.1|1571018_1571453_+	hypothetical protein	NA	Q56VP5	Pseudomonas_phage	100.0	3.8e-63
WP_003124954.1|1571573_1571825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019725828.1|1571838_1572057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003163344.1|1572700_1573309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003159569.1|1573318_1573669_+	DUF2523 domain-containing protein	NA	Q56VP0	Pseudomonas_phage	41.1	5.5e-20
WP_023122387.1|1573670_1574933_+	hypothetical protein	NA	Q56VN9	Pseudomonas_phage	55.2	2.7e-117
WP_003454977.1|1575191_1576484_+	hypothetical protein	NA	Q56VN8	Pseudomonas_phage	94.2	2.8e-247
WP_031689770.1|1576483_1577479_+|integrase	tyrosine-type recombinase/integrase	integrase	Q56VN7	Pseudomonas_phage	52.6	3.6e-93
WP_073675491.1|1577462_1577687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003141085.1|1577994_1578903_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
1577805:1577826	attR	GATCTGGAGCGGGCGAAGGGAA	NA	NA	NA	NA
WP_012761372.1|1579135_1580287_-	trypsin-like peptidase domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	31.0	2.8e-28
WP_003141083.1|1580311_1581277_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_019485901.1|1581320_1581752_-	phosphate-starvation-inducible PsiE family protein	NA	NA	NA	NA	NA
WP_019485900.1|1581748_1583464_-	heat resistance system K+/H+ antiporter KefB-GI	NA	NA	NA	NA	NA
WP_023083191.1|1583467_1583908_-	heat resistance system thioredoxin Trx-GI	NA	A0A1J0GW78	Streptomyces_phage	37.2	5.8e-11
WP_023083190.1|1583897_1585043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023083189.1|1585122_1585734_-	heat resistance membrane protein HdeD-GI	NA	NA	NA	NA	NA
WP_023083188.1|1585830_1586718_-	heat resistance protein YfdX2	NA	NA	NA	NA	NA
WP_019485625.1|1586820_1587729_-	heat resistance protein YfdX1	NA	NA	NA	NA	NA
WP_019485624.1|1587750_1588209_-	small heat shock protein sHSP20-GI	NA	NA	NA	NA	NA
WP_023083187.1|1588287_1590117_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	C7U047	Ostreococcus_tauri_virus	41.3	9.9e-105
WP_023083186.1|1590144_1591575_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_023083185.1|1591591_1594441_-	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	40.8	3.4e-128
WP_023083184.1|1594534_1595104_-	Hsp20/alpha crystallin family protein	NA	A0A1D7SX46	Cyanophage	27.9	6.2e-05
WP_016446188.1|1595705_1596083_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_016446187.1|1596196_1596373_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP008864	Pseudomonas aeruginosa strain W60856 chromosome, complete genome	6896700	2353345	2397150	6896700	integrase,protease,head,transposase	Pseudomonas_phage(96.36%)	57	2360675:2360694	2401976:2401995
WP_003094291.1|2353345_2354140_-	DNA adenine methylase	NA	Q5ZQW7	Pseudomonas_phage	90.2	1.8e-143
WP_071534095.1|2354109_2354301_-	Com family DNA-binding transcriptional regulator	NA	Q5ZQW8	Pseudomonas_phage	74.6	3.0e-20
WP_003094290.1|2354439_2354730_-	hypothetical protein	NA	A0A0A7DJU8	Pseudomonas_phage	95.7	2.6e-44
WP_003094288.1|2354726_2355875_-	hypothetical protein	NA	J9SP76	Pseudomonas_phage	92.9	9.0e-213
WP_003094286.1|2355871_2358082_-	hypothetical protein	NA	Q5ZQV9	Pseudomonas_phage	97.8	0.0e+00
WP_016852456.1|2358068_2358299_-	hypothetical protein	NA	J9RWP7	Pseudomonas_phage	94.7	2.7e-36
WP_003094285.1|2358295_2358526_-	hypothetical protein	NA	Q5ZQW1	Pseudomonas_phage	100.0	1.2e-36
WP_016852455.1|2358535_2359354_-	phage BR0599 family protein	NA	J9SN93	Pseudomonas_phage	99.3	3.8e-165
WP_016852454.1|2359340_2361047_-	hypothetical protein	NA	J9STL4	Pseudomonas_phage	97.5	0.0e+00
2360675:2360694	attL	GCTGGCCGGCCAGGCTGATG	NA	NA	NA	NA
WP_016852453.1|2361049_2361973_-	hypothetical protein	NA	A0A0S4L5N6	Pseudomonas_phage	98.7	3.3e-181
WP_016852452.1|2361975_2362932_-	hypothetical protein	NA	J9RWP3	Pseudomonas_phage	95.0	3.1e-182
WP_016852451.1|2362931_2366573_-	tape measure protein	NA	J9SH65	Pseudomonas_phage	92.3	0.0e+00
WP_049967619.1|2366689_2366872_+	hypothetical protein	NA	J9SNJ6	Pseudomonas_phage	100.0	1.2e-26
WP_016852450.1|2366826_2367309_-	hypothetical protein	NA	J9STT8	Pseudomonas_phage	99.4	2.8e-83
WP_016852449.1|2367311_2368052_-	hypothetical protein	NA	J9SVZ4	Pseudomonas_phage	98.8	1.8e-134
WP_003127509.1|2368058_2368262_-	hypothetical protein	NA	J9RWG5	Pseudomonas_phage	100.0	1.7e-29
WP_003138162.1|2368258_2368711_-	hypothetical protein	NA	J9SH57	Pseudomonas_phage	99.3	2.1e-80
WP_003121492.1|2368707_2369223_-	DUF1320 domain-containing protein	NA	J9SNI4	Pseudomonas_phage	100.0	3.5e-92
WP_015649419.1|2369225_2369660_-	hypothetical protein	NA	J9STT1	Pseudomonas_phage	99.0	1.1e-49
WP_003127513.1|2369672_2370569_-|head	Mu-like prophage major head subunit gpT family protein	head	J9SVY7	Pseudomonas_phage	100.0	1.3e-171
WP_003121593.1|2370583_2370988_-	hypothetical protein	NA	J9RWG0	Pseudomonas_phage	100.0	1.8e-67
WP_003138161.1|2370993_2372103_-|protease	phage protease	protease	J9SH47	Pseudomonas_phage	99.2	2.9e-200
WP_016852448.1|2372313_2372889_-	phage virion morphogenesis protein	NA	J9SNH3	Pseudomonas_phage	99.0	2.9e-103
WP_016852447.1|2372890_2374129_-	hypothetical protein	NA	J9STS2	Pseudomonas_phage	99.5	5.8e-242
WP_023093201.1|2374118_2375693_-	DUF935 domain-containing protein	NA	J9SVY0	Pseudomonas_phage	96.2	7.6e-287
WP_003138156.1|2375686_2377360_-	hypothetical protein	NA	J9RWF2	Pseudomonas_phage	99.5	0.0e+00
WP_003121466.1|2377361_2377910_-	DUF3486 family protein	NA	J9SH37	Pseudomonas_phage	98.9	6.4e-76
WP_003121465.1|2377912_2378215_-	hypothetical protein	NA	J9SNG3	Pseudomonas_phage	99.0	4.1e-48
WP_003117315.1|2378211_2378532_-	DUF2730 family protein	NA	J9STR5	Pseudomonas_phage	100.0	5.1e-49
WP_015649412.1|2378531_2379155_-	hypothetical protein	NA	J9SVX5	Pseudomonas_phage	90.3	3.6e-99
WP_016852445.1|2379356_2379986_-	transglycosylase SLT domain-containing protein	NA	J9SH25	Pseudomonas_phage	98.6	1.9e-119
WP_003094227.1|2379982_2380141_-	hypothetical protein	NA	J9SNF4	Pseudomonas_phage	100.0	3.4e-22
WP_003094225.1|2380143_2380401_-	membrane protein	NA	A0A0S4L5C0	Pseudomonas_phage	100.0	7.2e-38
WP_157783244.1|2381111_2381372_-	hypothetical protein	NA	J9SH16	Pseudomonas_phage	82.6	1.8e-12
WP_003142304.1|2381556_2381787_+	DNA-binding protein	NA	J9RW65	Pseudomonas_phage	100.0	2.5e-37
WP_015649394.1|2382071_2382296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010791820.1|2382419_2382908_+	hypothetical protein	NA	J9SNL8	Pseudomonas_phage	99.4	2.8e-91
WP_003142306.1|2382900_2383161_+	hypothetical protein	NA	J9RWD0	Pseudomonas_phage	95.3	1.5e-38
WP_003142307.1|2383157_2383472_+	hypothetical protein	NA	J9SUN0	Pseudomonas_phage	98.1	2.9e-49
WP_023101705.1|2383481_2384456_+	hypothetical protein	NA	J9RW58	Pseudomonas_phage	97.8	8.9e-153
WP_016852442.1|2384459_2386244_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	J9SGQ3	Pseudomonas_phage	98.5	0.0e+00
WP_016852441.1|2386243_2387410_+	AAA family ATPase	NA	J9SVV1	Pseudomonas_phage	100.0	1.0e-216
WP_016852440.1|2387411_2387753_+	hypothetical protein	NA	J9RWC3	Pseudomonas_phage	99.1	3.5e-56
WP_014603990.1|2387749_2388034_+	hypothetical protein	NA	J9SGZ7	Pseudomonas_phage	100.0	3.4e-44
WP_016852439.1|2388033_2388714_+	hypothetical protein	NA	J9SNC1	Pseudomonas_phage	98.7	2.4e-128
WP_016852438.1|2388703_2389237_+	hypothetical protein	NA	J9STN6	Pseudomonas_phage	98.9	3.3e-93
WP_016852437.1|2389229_2389430_+	hypothetical protein	NA	J9SVU3	Pseudomonas_phage	97.0	6.7e-31
WP_016852436.1|2389422_2390046_+	DUF3164 family protein	NA	Q5ZR10	Pseudomonas_phage	99.5	1.3e-109
WP_016852435.1|2390047_2390737_+	DUF2786 domain-containing protein	NA	Q5ZR11	Pseudomonas_phage	98.7	4.2e-125
WP_016852434.1|2390738_2390930_+	hypothetical protein	NA	J9RW45	Pseudomonas_phage	100.0	5.0e-28
WP_016852433.1|2390929_2391397_+	hypothetical protein	NA	J9STM8	Pseudomonas_phage	100.0	8.5e-77
WP_015649391.1|2391383_2391950_+	regulatory protein GemA	NA	J9SVT5	Pseudomonas_phage	99.5	2.1e-101
WP_003117363.1|2391949_2392498_+	hypothetical protein	NA	J9RWB3	Pseudomonas_phage	100.0	2.1e-98
WP_003127781.1|2392494_2392863_+	hypothetical protein	NA	J9SGX4	Pseudomonas_phage	100.0	1.1e-63
WP_031689902.1|2393097_2395944_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	33.7	3.2e-17
WP_031689903.1|2396185_2396494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003115462.1|2396547_2397150_+	alpha-ketoglutarate-dependent dioxygenase AlkB	NA	A0A0B5J690	Pandoravirus	38.4	8.0e-19
2401976:2401995	attR	GCTGGCCGGCCAGGCTGATG	NA	NA	NA	NA
>prophage 4
NZ_CP008864	Pseudomonas aeruginosa strain W60856 chromosome, complete genome	6896700	3188512	3195406	6896700	tRNA	uncultured_Caudovirales_phage(85.71%)	9	NA	NA
WP_003097631.1|3188512_3189793_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.4	8.2e-98
WP_003097630.1|3189794_3191192_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_003097628.1|3191196_3192171_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_003097625.1|3192258_3193242_-	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	74.0	3.5e-141
WP_003119979.1|3193238_3193574_-	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	69.4	1.5e-38
WP_031690242.1|3193570_3193876_-	sulfurtransferase complex subunit TusB	NA	A0A2H4JG28	uncultured_Caudovirales_phage	59.6	3.0e-22
WP_016562012.1|3193875_3194235_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	61.7	1.1e-34
WP_031690243.1|3194231_3194627_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	70.5	1.0e-46
WP_003090386.1|3194737_3195406_-	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	82.1	1.5e-90
>prophage 5
NZ_CP008864	Pseudomonas aeruginosa strain W60856 chromosome, complete genome	6896700	3656113	3695478	6896700	tail,plate	Planktothrix_phage(33.33%)	33	NA	NA
WP_003122677.1|3656113_3657397_-|tail	pyoverdine-tailoring periplasmic protein PvdN	tail	NA	NA	NA	NA
WP_014602893.1|3657419_3658766_-|tail	pyoverdine-tailoring dipeptidase-like protein PvdM	tail	NA	NA	NA	NA
WP_003163333.1|3658979_3660626_+	pyoverdine maturation tyrosinase PvdP	NA	NA	NA	NA	NA
WP_031690295.1|3660674_3662099_-	pyoverdine export/recycling transporter outer membrane subunit OmpQ	NA	NA	NA	NA	NA
WP_003131508.1|3662104_3664096_-	pyoverdine export/recycling transporter ATP-binding/permease subunit PvdT	NA	G9BWD6	Planktothrix_phage	39.3	6.9e-35
WP_031690296.1|3664095_3665271_-	pyoverdine export/recycling transporter periplasmic adaptor subunit PvdR	NA	NA	NA	NA	NA
WP_012614142.1|3665370_3666366_-	FecR family protein	NA	NA	NA	NA	NA
WP_003103620.1|3666529_3667009_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_003103622.1|3667141_3668473_+	L-ornithine N(5)-monooxygenase	NA	NA	NA	NA	NA
WP_031690297.1|3668595_3670884_+	acylase	NA	NA	NA	NA	NA
WP_003089535.1|3671064_3671388_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_003114511.1|3671429_3672350_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003104946.1|3672446_3673598_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_031690298.1|3673674_3673917_-	DUF1654 domain-containing protein	NA	NA	NA	NA	NA
WP_003104944.1|3674211_3674448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003089521.1|3674713_3675184_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_003114512.1|3675180_3677496_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	NA	NA	NA	NA
WP_003115787.1|3677912_3679118_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003110901.1|3679318_3679960_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_031690299.1|3680236_3680632_+	DUF4280 domain-containing protein	NA	NA	NA	NA	NA
WP_003114514.1|3680654_3681191_-	toxin-antitoxin system YwqK family antitoxin	NA	NA	NA	NA	NA
WP_031690300.1|3681201_3683205_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	29.8	1.2e-42
WP_003116945.1|3683211_3683997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003116944.1|3684066_3684942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019371762.1|3685032_3687582_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	29.4	4.2e-77
WP_003104928.1|3687583_3688600_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_003122695.1|3688563_3690357_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_003122696.1|3690340_3690766_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_003089495.1|3690778_3691276_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_003089494.1|3691349_3692834_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_003089493.1|3692856_3693402_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_031690301.1|3693610_3694087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003124583.1|3694146_3695478_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 6
NZ_CP008864	Pseudomonas aeruginosa strain W60856 chromosome, complete genome	6896700	5852178	5860288	6896700	coat,integrase	Pseudomonas_phage(87.5%)	9	5851586:5851645	5863240:5863321
5851586:5851645	attL	ATTCATAATGCTGATGTCCCAGGTTCAAGTCCCGGTGTAGCCACCATATTTTTCAAGGGG	NA	NA	NA	NA
WP_003162405.1|5852178_5853186_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	47.1	3.7e-77
WP_033946423.1|5853182_5854475_-	hypothetical protein	NA	Q56VN8	Pseudomonas_phage	92.3	1.0e-241
WP_023085759.1|5854704_5855979_-	zonular occludens toxin family protein	NA	Q56VN9	Pseudomonas_phage	87.9	6.7e-201
WP_003114150.1|5855982_5856339_-	DUF2523 domain-containing protein	NA	Q56VP0	Pseudomonas_phage	100.0	7.9e-59
WP_078451727.1|5856343_5857618_-	attachment protein	NA	Q56VP1	Pseudomonas_phage	54.6	3.4e-43
WP_003125072.1|5857765_5858014_-|coat	phage coat protein B	coat	Q56VP2	Pseudomonas_phage	92.7	2.0e-32
WP_003115979.1|5858026_5858278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003140508.1|5858399_5858834_-	hypothetical protein	NA	Q56VP5	Pseudomonas_phage	100.0	3.8e-63
WP_031689773.1|5860000_5860288_-	DUF5447 family protein	NA	Q56VP7	Pseudomonas_phage	88.4	3.9e-48
5863240:5863321	attR	ATTCATAATGCTGATGTCCCAGGTTCAAGTCCCGGTGTAGCCACCATATTTTTCAAGGGGTTAGCGCAAGCTAACCCCTTTT	NA	NA	NA	NA
