The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP008868	Pseudomonas aeruginosa strain T63266 chromosome, complete genome	6456866	582119	620279	6456866	integrase,tRNA,coat	Pseudomonas_phage(57.14%)	41	609075:609134	620824:620905
WP_003117437.1|582119_582668_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_033940940.1|582686_583220_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_004355220.1|583219_583762_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_003114703.1|583780_584569_+	molecular chaperone	NA	NA	NA	NA	NA
WP_034020400.1|584585_586958_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_003099330.1|586954_587902_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_003099328.1|587903_589277_-	MFS transporter	NA	NA	NA	NA	NA
WP_034020402.1|589556_590579_-	ferrochelatase	NA	NA	NA	NA	NA
WP_023111870.1|590575_591493_-	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_003094987.1|591906_592890_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003099314.1|593042_593999_+	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_003094990.1|594008_594908_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	39.1	8.5e-17
WP_003121048.1|594904_596350_+	deoxyribodipyrimidine photo-lyase	NA	A0A167RC11	Powai_lake_megavirus	27.8	1.8e-45
WP_003099307.1|596475_596997_-	acyloxyacyl hydrolase	NA	A0A2H4J0I5	uncultured_Caudovirales_phage	69.8	1.4e-59
WP_003117431.1|597130_597928_-	glutamate racemase	NA	NA	NA	NA	NA
WP_003099296.1|597917_598676_-	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_003121049.1|598669_599500_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_003099290.1|599501_600584_-	peptide chain release factor 1	NA	A0A0S4KWG0	Pseudomonas_phage	48.3	5.6e-07
WP_003095001.1|600601_601870_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_004347799.1|602013_603786_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_003095005.1|603790_604408_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_003099284.1|604409_605258_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_003099281.1|605424_606366_+	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	35.4	4.1e-46
WP_003099279.1|606482_607097_+	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_003099278.1|607138_607723_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_003099270.1|607763_608864_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
609075:609134	attL	ATTCATAATGCTGATGTCCCAGGTTCAAGTCCCGGTGTAGCCACCATATTTTTCAAGGGG	NA	NA	NA	NA
WP_124169905.1|609259_609670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004352688.1|609650_610652_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	46.8	7.6e-75
WP_023087821.1|610648_611941_-	hypothetical protein	NA	Q56VN8	Pseudomonas_phage	92.0	3.0e-241
WP_059318921.1|612170_613445_-	zonular occludens toxin family protein	NA	Q56VN9	Pseudomonas_phage	88.7	6.1e-202
WP_059318922.1|613448_613805_-	DUF2523 domain-containing protein	NA	Q56VP0	Pseudomonas_phage	99.2	2.3e-58
WP_080712459.1|613809_615066_-	attachment protein	NA	Q56VP1	Pseudomonas_phage	54.9	2.0e-48
WP_003125072.1|615201_615450_-|coat	phage coat protein B	coat	Q56VP2	Pseudomonas_phage	92.7	2.0e-32
WP_003115979.1|615462_615714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003140508.1|615835_616270_-	hypothetical protein	NA	Q56VP5	Pseudomonas_phage	100.0	3.8e-63
WP_042931660.1|616785_617076_-	DUF5447 family protein	NA	Q56VP7	Pseudomonas_phage	97.9	1.1e-55
WP_042931662.1|617287_617560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023088595.1|617669_617936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042931664.1|617991_618327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144440650.1|618364_619126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079387228.1|619070_620279_-	RNA-directed DNA polymerase	NA	A0A0F7LDS3	Escherichia_phage	45.3	7.5e-93
620824:620905	attR	ATTCATAATGCTGATGTCCCAGGTTCAAGTCCCGGTGTAGCCACCATATTTTTCAAGGGGTTAGCGCAAGCTAACCCCTTTT	NA	NA	NA	NA
>prophage 2
NZ_CP008868	Pseudomonas aeruginosa strain T63266 chromosome, complete genome	6456866	2293618	2346398	6456866	plate,tRNA,tail	uncultured_Caudovirales_phage(28.0%)	55	NA	NA
WP_003099590.1|2293618_2294644_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.1	1.4e-108
WP_003085061.1|2294722_2295292_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_003099587.1|2295375_2295729_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_003099585.1|2295719_2296262_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_016252918.1|2296234_2297467_-	multifunctional CCA addition/repair protein	NA	A0A076G5T8	Escherichia_phage	43.1	2.6e-77
WP_017148719.1|2297510_2298017_-	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_003099581.1|2298110_2299664_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_003099579.1|2299660_2300932_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	37.2	4.2e-09
WP_003085078.1|2301032_2302955_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_003099577.1|2303233_2303566_-	thiosulfate sulfurtransferase GlpE	NA	NA	NA	NA	NA
WP_003113213.1|2303609_2304461_-	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	33.3	1.1e-08
WP_003085085.1|2304460_2304841_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_023119537.1|2304877_2305684_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_003117956.1|2305799_2306786_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_003109024.1|2306782_2308075_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_023128361.1|2308055_2310845_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_003099554.1|2310971_2311988_+	phosphotransferase	NA	NA	NA	NA	NA
WP_003099549.1|2311984_2312659_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_003099547.1|2312660_2313419_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_034020507.1|2313419_2314481_-	alpha/beta hydrolase family protein	NA	NA	NA	NA	NA
WP_003109040.1|2314632_2317026_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_003085103.1|2317071_2317704_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003085106.1|2317832_2318867_+	polyamine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003085109.1|2319100_2320210_+	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.4	7.8e-28
WP_019682040.1|2320265_2321312_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003109044.1|2321426_2322674_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003099535.1|2322779_2323610_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003085122.1|2323733_2324408_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_003099532.1|2324407_2325226_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_015649712.1|2325298_2326777_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_003113203.1|2327094_2327409_-	transcription regulatory protein PrtN	NA	NA	NA	NA	NA
WP_003113202.1|2327508_2328279_-	helix-turn-helix transcriptional regulator	NA	A0A1B0Z078	Pseudomonas_phage	59.1	1.4e-71
WP_003085132.1|2328736_2328937_+	repressor PtrB	NA	W6ATC1	Enterobacter_phage	58.3	3.7e-05
WP_003118907.1|2328984_2329344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003118908.1|2329706_2330156_+	hypothetical protein	NA	B5TK61	Pseudomonas_phage	53.3	5.0e-26
WP_003101620.1|2330177_2330693_+	hypothetical protein	NA	A0A2H4J881	uncultured_Caudovirales_phage	43.4	1.8e-32
WP_003121844.1|2330689_2331247_+|plate	phage baseplate assembly protein V	plate	A0A2H4JG06	uncultured_Caudovirales_phage	70.3	6.0e-45
WP_003085143.1|2331399_2331726_+	GPW/gp25 family protein	NA	A0A2H4JA09	uncultured_Caudovirales_phage	60.2	3.2e-30
WP_003161928.1|2331722_2332610_+	bacteriophage protein	NA	S4TNY7	Salmonella_phage	59.8	4.1e-88
WP_003118911.1|2332602_2333136_+|tail	phage tail protein I	tail	Q9ZXK7	Pseudomonas_virus	64.6	3.9e-62
WP_003161927.1|2333137_2335243_+|tail	phage tail protein	tail	Q9ZXK6	Pseudomonas_virus	52.7	3.0e-222
WP_016852415.1|2335250_2335691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003085173.1|2335733_2336894_+|tail	phage tail sheath family protein	tail	Q38068	Phage_PS17	83.4	1.2e-188
WP_003085175.1|2336906_2337410_+|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	73.5	8.0e-65
WP_003085178.1|2337424_2337769_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_023083951.1|2337938_2340176_+|tail	phage tail length determinator protein	tail	NA	NA	NA	NA
WP_003085182.1|2340185_2341058_+|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	51.7	3.9e-75
WP_003101635.1|2341032_2341239_+|tail	tail protein X	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	64.2	2.3e-18
WP_003113193.1|2341296_2342286_+	phage late control D family protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	55.8	7.5e-107
WP_003113192.1|2342318_2342948_+	glycoside hydrolase family 19 protein	NA	A0A125RNP1	Pseudomonas_phage	78.0	1.6e-86
WP_003121852.1|2342944_2343307_+	hypothetical protein	NA	H2BDA0	Pseudomonas_phage	47.9	4.2e-15
WP_003118919.1|2343303_2343561_+	hypothetical protein	NA	A0A125RNP3	Pseudomonas_phage	64.6	8.3e-18
WP_003117978.1|2343908_2344514_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	66.3	2.1e-75
WP_003085203.1|2344515_2345565_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	57.8	1.8e-111
WP_034020508.1|2345561_2346398_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	56.5	3.6e-70
>prophage 3
NZ_CP008868	Pseudomonas aeruginosa strain T63266 chromosome, complete genome	6456866	3092056	3101085	6456866		Bacillus_phage(33.33%)	8	NA	NA
WP_003098558.1|3092056_3092692_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	52.3	1.0e-40
WP_003115226.1|3092737_3093631_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A0S2SXL7	Bacillus_phage	34.3	3.0e-06
WP_003113871.1|3093735_3094740_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.3	7.0e-36
WP_003092272.1|3095166_3095490_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_003113873.1|3095556_3098124_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.1	3.2e-24
WP_034020223.1|3098249_3099257_-	TolB family protein	NA	NA	NA	NA	NA
WP_003092262.1|3099404_3099911_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	76.0	8.1e-57
WP_003092260.1|3100044_3101085_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	59.5	1.5e-113
>prophage 4
NZ_CP008868	Pseudomonas aeruginosa strain T63266 chromosome, complete genome	6456866	4169320	4279320	6456866	plate,tail,holin,portal,head,protease,lysis,terminase,tRNA,integrase,capsid	Pseudomonas_virus(38.46%)	129	4242386:4242415	4280308:4280337
WP_003119971.1|4169320_4170448_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_003090438.1|4170491_4170962_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_003116719.1|4171048_4173274_-	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_003090436.1|4173632_4174889_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	81.5	3.1e-17
WP_003090435.1|4174961_4175234_-	cold shock domain-containing protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	58.8	1.1e-15
WP_003097649.1|4175459_4175828_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	41.6	4.9e-11
WP_003090432.1|4175855_4178132_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.8	3.4e-163
WP_002553999.1|4178213_4178432_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_003108766.1|4178536_4179244_-	arginyltransferase	NA	NA	NA	NA	NA
WP_003108768.1|4179298_4179979_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_003097640.1|4180016_4180967_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.0	1.2e-61
WP_003131123.1|4181194_4183630_+	DNA translocase FtsK	NA	G1D482	Mycobacterium_virus	52.8	1.9e-87
WP_003090414.1|4183655_4184282_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_003097632.1|4184291_4185617_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	39.2	1.2e-80
WP_003097631.1|4185738_4187019_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.4	8.2e-98
WP_003160439.1|4187020_4188418_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_003097628.1|4188422_4189397_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_003097625.1|4189484_4190468_-	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	74.0	3.5e-141
WP_003119979.1|4190464_4190800_-	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	69.4	1.5e-38
WP_003090391.1|4190796_4191102_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_034020147.1|4191101_4191461_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	61.7	8.9e-34
WP_003090387.1|4191457_4191853_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	72.1	2.7e-47
WP_003090386.1|4191963_4192632_-	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	82.1	1.5e-90
WP_038820290.1|4192967_4194035_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JDJ8	uncultured_Caudovirales_phage	68.7	3.7e-136
WP_003116724.1|4194036_4194273_-	DUF4224 domain-containing protein	NA	A0A2H4JF29	uncultured_Caudovirales_phage	53.2	3.8e-17
WP_049874125.1|4194430_4194727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038826006.1|4195048_4195588_-	hypothetical protein	NA	Q9MC60	Pseudomonas_phage	37.4	2.1e-23
WP_124131805.1|4196759_4197443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049874127.1|4197423_4198776_-	site-specific DNA-methyltransferase	NA	A0A060D598	Salmonella_phage	46.5	2.8e-80
WP_059318939.1|4198919_4200665_-	AAA family ATPase	NA	H2BD46	Pseudomonas_phage	87.8	1.4e-270
WP_047106177.1|4200668_4201649_-	cell division protein FtsK	NA	H2BD47	Pseudomonas_phage	62.2	4.2e-94
WP_009314053.1|4201661_4201862_-	hypothetical protein	NA	J7I437	Pseudomonas_phage	100.0	1.9e-30
WP_033945329.1|4201868_4202798_-	hypothetical protein	NA	J7HXB6	Pseudomonas_phage	99.6	1.2e-151
WP_033945330.1|4202794_4203010_-	hypothetical protein	NA	J7I4L3	Pseudomonas_phage	100.0	1.4e-34
WP_059318940.1|4203018_4203822_-	PD-(D/E)XK nuclease family protein	NA	H2BD50	Pseudomonas_phage	97.0	9.9e-150
WP_003116743.1|4203829_4203967_-	hypothetical protein	NA	J7I432	Pseudomonas_phage	100.0	8.3e-17
WP_003116744.1|4203950_4204142_-	hypothetical protein	NA	H2BD52	Pseudomonas_phage	98.4	9.5e-27
WP_003099037.1|4204138_4204360_-	hypothetical protein	NA	H2BD53	Pseudomonas_phage	100.0	1.2e-33
WP_160330060.1|4204343_4204499_-	hypothetical protein	NA	A0A2K8HR67	Pseudomonas_phage	100.0	6.3e-13
WP_048764766.1|4204495_4204999_-	hypothetical protein	NA	J7I0S8	Pseudomonas_phage	98.8	3.8e-99
WP_059318941.1|4205496_4205868_-	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	98.4	5.5e-63
WP_031673425.1|4205903_4206116_-	hypothetical protein	NA	L7TKR9	Pseudomonas_virus	98.6	6.8e-34
WP_143176659.1|4206207_4207164_+	hypothetical protein	NA	A0A1B5FPB0	Escherichia_phage	33.9	6.1e-13
WP_073670967.1|4207279_4208050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049874141.1|4208932_4209739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038819734.1|4209768_4210500_-	helix-turn-helix transcriptional regulator	NA	B5TK58	Pseudomonas_phage	59.2	1.7e-71
WP_023109489.1|4210605_4210827_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_009314063.1|4210921_4211518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059318942.1|4211521_4212484_+	hypothetical protein	NA	A0A2H4JCW9	uncultured_Caudovirales_phage	47.5	1.6e-13
WP_059319021.1|4212611_4213025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059318943.1|4213017_4213461_+	RusA family crossover junction endodeoxyribonuclease	NA	J7I4J7	Pseudomonas_phage	98.6	1.0e-76
WP_023083723.1|4213489_4214359_+	hypothetical protein	NA	J7HXH6	Pseudomonas_phage	91.7	1.6e-153
WP_033994418.1|4215201_4215381_-	type II toxin-antitoxin system HicA family toxin	NA	A0A2H4JDU5	uncultured_Caudovirales_phage	56.7	1.9e-08
WP_033994419.1|4215466_4215847_+	membrane protein	NA	H2BDJ3	Pseudomonas_virus	68.4	1.7e-38
WP_079383295.1|4215821_4216172_+|holin	phage holin family protein	holin	Q9MC42	Pseudomonas_phage	62.4	3.3e-25
WP_033994420.1|4216188_4216398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033994421.1|4216497_4217094_+|terminase	terminase small subunit	terminase	H2BD75	Pseudomonas_phage	63.9	8.6e-50
WP_043504461.1|4217080_4218367_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	58.8	3.1e-145
WP_059318944.1|4218366_4220175_+	DUF1073 domain-containing protein	NA	A0A2H4J4I9	uncultured_Caudovirales_phage	61.2	3.4e-214
WP_033950383.1|4220177_4221299_+	DUF2213 domain-containing protein	NA	A0A2H4J6J7	uncultured_Caudovirales_phage	65.7	4.8e-94
WP_003116762.1|4221298_4221754_+	DUF2190 family protein	NA	A0A2R3UAC1	Siphoviridae_environmental_samples	59.7	3.4e-38
WP_059318945.1|4221763_4222693_+	DUF2184 domain-containing protein	NA	L7TMZ5	Rhizobium_phage	59.5	2.1e-103
WP_059318946.1|4222705_4223149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033994425.1|4223325_4223847_+	hypothetical protein	NA	A0A059VG19	Pseudomonas_phage	53.8	4.3e-37
WP_033994426.1|4223843_4224836_+	hypothetical protein	NA	A0A2H4IY91	uncultured_Caudovirales_phage	49.9	4.0e-84
WP_029982117.1|4224840_4225215_+	hypothetical protein	NA	A0A059VA70	Pseudomonas_phage	49.2	7.9e-25
WP_038819718.1|4225214_4225610_+	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	49.2	1.8e-27
WP_033994428.1|4225606_4226014_+	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_033977281.1|4226075_4227245_+	Ig-like domain-containing protein	NA	A0A059VG08	Pseudomonas_phage	39.4	7.6e-58
WP_033977283.1|4227303_4227792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071536105.1|4227911_4228187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059318947.1|4228137_4231419_+|tail	phage tail length tape measure family protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	35.3	1.3e-94
WP_049874140.1|4231418_4231889_+	hypothetical protein	NA	A0A125RNN3	Pseudomonas_phage	40.4	1.9e-28
WP_003116774.1|4231890_4232376_+	DUF1833 family protein	NA	A0A2H4J983	uncultured_Caudovirales_phage	45.0	5.4e-34
WP_058147101.1|4232379_4232793_+	hypothetical protein	NA	B5WZT7	Pseudomonas_phage	60.7	1.9e-40
WP_080712466.1|4232758_4235506_+	hypothetical protein	NA	A0A0H5ART3	Pseudomonas_phage	48.0	7.9e-239
WP_080712467.1|4235572_4237252_+	hypothetical protein	NA	A0A2H5BQA0	Pseudomonas_phage	71.3	7.3e-179
WP_059318949.1|4237316_4238573_+	oligosaccharide repeat unit polymerase	NA	NA	NA	NA	NA
WP_059318950.1|4239016_4239646_+	glycoside hydrolase family 19 protein	NA	J7I4M6	Pseudomonas_phage	90.9	4.4e-105
WP_003116780.1|4239642_4240023_+	hypothetical protein	NA	J7HXL1	Pseudomonas_phage	88.8	5.9e-44
WP_080712468.1|4240019_4240346_+	hypothetical protein	NA	A0A125RNP3	Pseudomonas_phage	95.4	2.8e-50
WP_048764667.1|4240381_4240648_+	hypothetical protein	NA	L7TP56	Pseudomonas_virus	97.7	4.1e-44
WP_059318951.1|4240629_4241316_-	SOS response-associated peptidase family protein	NA	A0A2K8I970	Pseudomonas_phage	88.6	2.2e-118
WP_059318952.1|4241606_4242122_-	hypothetical protein	NA	L7TIE6	Pseudomonas_virus	92.9	1.9e-93
4242386:4242415	attL	TGAGTTCGAATCTCACCGCCTCCGCCATAT	NA	NA	NA	NA
WP_058139353.1|4242533_4243703_-|integrase	site-specific integrase	integrase	A0A2H4JGM5	uncultured_Caudovirales_phage	65.8	1.2e-151
WP_059319023.1|4243923_4245096_-	phosphoadenosine phosphosulfate reductase family protein	NA	R9TRT5	Rhizobium_phage	71.0	3.1e-168
WP_034070815.1|4245152_4245437_-	hypothetical protein	NA	Q9ZXI5	Pseudomonas_virus	98.7	9.8e-36
WP_034086370.1|4245496_4245703_-	TraR/DksA family transcriptional regulator	NA	Q9ZXI6	Pseudomonas_virus	98.5	1.6e-32
WP_059318953.1|4245714_4246068_-	hypothetical protein	NA	Q9ZXI7	Pseudomonas_virus	95.7	1.6e-59
WP_022580408.1|4246127_4246400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059318954.1|4246444_4249165_-	toprim domain-containing protein	NA	Q9ZXI8	Pseudomonas_virus	96.6	0.0e+00
WP_003098410.1|4249161_4249395_-	hypothetical protein	NA	Q9ZXI9	Pseudomonas_virus	100.0	7.8e-39
WP_058128949.1|4249466_4249817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034063875.1|4249813_4250107_-	ogr/Delta-like zinc finger family protein	NA	Q9ZXJ1	Pseudomonas_virus	96.9	9.4e-50
WP_034086376.1|4250103_4250574_-	hypothetical protein	NA	Q9ZXJ2	Pseudomonas_virus	92.9	1.6e-75
WP_023876135.1|4250603_4250816_-	DNA-binding protein	NA	A0A2H4JE67	uncultured_Caudovirales_phage	48.4	1.1e-07
WP_059319024.1|4250900_4251242_+	helix-turn-helix transcriptional regulator	NA	A0A2H4JFL3	uncultured_Caudovirales_phage	53.3	2.5e-22
WP_059318955.1|4251560_4251911_+	hypothetical protein	NA	Q9ZXJ5	Pseudomonas_virus	90.5	4.4e-54
WP_080712470.1|4251976_4253959_+	ATP-binding protein	NA	A0A2H4J2R8	uncultured_Caudovirales_phage	35.0	3.3e-05
WP_080712471.1|4253993_4254389_+	DNA mismatch endonuclease Vsr	NA	I6NSG0	Burkholderia_phage	56.3	9.2e-32
WP_080712472.1|4254342_4255404_-	DNA cytosine methyltransferase	NA	A0A0R6PG08	Moraxella_phage	63.9	3.2e-124
WP_059318957.1|4255896_4257192_-	phage late control D family protein	NA	Q9ZXJ8	Pseudomonas_virus	97.9	2.1e-234
WP_015967206.1|4257188_4257629_-|tail	phage tail protein	tail	Q9ZXJ9	Pseudomonas_virus	100.0	6.1e-77
WP_059318958.1|4257634_4260394_-|tail	phage tail tape measure protein	tail	Q9ZXK0	Pseudomonas_virus	96.5	0.0e+00
WP_003098394.1|4260383_4260503_-|tail	GpE family phage tail protein	tail	Q9ZXK1	Pseudomonas_virus	100.0	1.8e-15
WP_059318959.1|4260511_4260841_-|tail	phage tail assembly protein	tail	Q9ZXK2	Pseudomonas_virus	95.4	2.6e-48
WP_016852040.1|4260895_4261411_-|tail	phage major tail tube protein	tail	Q9ZXK3	Pseudomonas_virus	94.7	7.4e-90
WP_059318960.1|4261467_4262643_-|tail	phage tail sheath protein	tail	Q9ZXK4	Pseudomonas_virus	99.0	7.8e-220
WP_059318961.1|4262733_4263198_-|tail	phage tail protein	tail	Q9ZXK5	Pseudomonas_virus	74.2	3.2e-44
WP_015967199.1|4265553_4266090_-|tail	phage tail protein I	tail	Q9ZXK7	Pseudomonas_virus	100.0	1.4e-99
WP_015967198.1|4266089_4267004_-|plate	baseplate assembly protein	plate	Q9ZXK8	Pseudomonas_virus	100.0	3.3e-165
WP_022580424.1|4267000_4267345_-	GPW/gp25 family protein	NA	Q9ZXK9	Pseudomonas_virus	98.2	1.6e-56
WP_015967196.1|4267341_4267914_-|plate	phage baseplate assembly protein V	plate	Q9ZXL0	Pseudomonas_virus	100.0	4.2e-94
WP_079755963.1|4267993_4268722_-	hypothetical protein	NA	Q9ZXL1	Pseudomonas_virus	99.6	8.1e-135
WP_049247388.1|4268755_4269226_-	phage virion morphogenesis protein	NA	Q9ZXL2	Pseudomonas_virus	99.4	1.2e-78
WP_023093068.1|4269218_4269755_-|tail	phage tail protein	tail	Q9ZXL3	Pseudomonas_virus	98.3	6.7e-94
WP_033943380.1|4269832_4270294_-|lysis	LysB family phage lysis regulatory protein	lysis	Q9ZXL5	Pseudomonas_virus	98.7	3.6e-72
WP_033943377.1|4270290_4271097_-	DUF3380 domain-containing protein	NA	Q9ZXL6	Pseudomonas_virus	100.0	6.2e-152
WP_015967189.1|4271093_4271366_-|holin	phage holin family protein	holin	Q9ZXL7	Pseudomonas_virus	100.0	2.4e-39
WP_003098379.1|4271367_4271721_-	hypothetical protein	NA	Q9ZXL8	Pseudomonas_virus	100.0	6.0e-59
WP_015967188.1|4271745_4271955_-|tail	tail protein X	tail	Q9ZXL9	Pseudomonas_virus	100.0	1.4e-34
WP_015967187.1|4271954_4272152_-	hypothetical protein	NA	Q9ZXM0	Pseudomonas_virus	100.0	2.4e-33
WP_015967186.1|4272151_4272613_-|head	head completion/stabilization protein	head	Q9ZXM1	Pseudomonas_virus	100.0	9.5e-81
WP_015967185.1|4272716_4273418_-|terminase	terminase endonuclease subunit	terminase	Q9ZXM2	Pseudomonas_virus	100.0	3.3e-125
WP_015967184.1|4273423_4274440_-|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	100.0	9.2e-193
WP_015967183.1|4274475_4275297_-|capsid	GPO family capsid scaffolding protein	capsid	Q9ZXM4	Pseudomonas_virus	100.0	8.9e-130
WP_031275675.1|4275452_4277216_+|terminase	terminase ATPase subunit family protein	terminase	Q9ZXM5	Pseudomonas_virus	100.0	0.0e+00
WP_015967181.1|4277212_4278265_+|portal	phage portal protein	portal	Q9ZXM6	Pseudomonas_virus	100.0	2.7e-203
WP_015967180.1|4278459_4279320_-	ETX/MTX2 family pore-forming toxin	NA	Q787C9	Pseudomonas_virus	100.0	9.9e-164
4280308:4280337	attR	TGAGTTCGAATCTCACCGCCTCCGCCATAT	NA	NA	NA	NA
>prophage 5
NZ_CP008868	Pseudomonas aeruginosa strain T63266 chromosome, complete genome	6456866	4523376	4614996	6456866	plate,tail,transposase	Tupanvirus(27.27%)	55	NA	NA
WP_094775766.1|4523376_4524538_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	53.6	3.3e-85
WP_003139228.1|4524583_4525558_-	type I-F CRISPR-associated endonuclease Cas1	NA	A0A2D0YFC9	Vibrio_phage	38.1	2.8e-50
WP_023084221.1|4527427_4527742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003111281.1|4528446_4529367_-	transporter	NA	NA	NA	NA	NA
WP_034019958.1|4529399_4530818_-	OprD family porin	NA	NA	NA	NA	NA
WP_003111283.1|4530899_4531580_-	hydrolase	NA	NA	NA	NA	NA
WP_003089646.1|4531677_4532538_-	pirin family protein	NA	NA	NA	NA	NA
WP_003105956.1|4532638_4533577_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010793032.1|4534098_4534524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023114419.1|4534516_4535836_+	sorbosone dehydrogenase family protein	NA	NA	NA	NA	NA
WP_003089638.1|4536014_4537424_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	23.8	9.9e-20
WP_003089636.1|4537501_4537720_+	MbtH family protein	NA	NA	NA	NA	NA
WP_003105945.1|4537720_4538485_+	thioesterase	NA	NA	NA	NA	NA
WP_023088358.1|4538584_4539502_-	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003106903.1|4539498_4540404_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_003116923.1|4540400_4541156_-	metal ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.0	7.7e-11
WP_023084228.1|4541152_4542106_-	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003143983.1|4542138_4542699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003089624.1|4542695_4543025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019726231.1|4543556_4544759_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_019726230.1|4544929_4545883_-	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_059318965.1|4546027_4557070_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	26.5	1.2e-99
WP_059318966.1|4557071_4560443_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	26.4	1.1e-93
WP_059318967.1|4560455_4573559_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	22.6	3.3e-117
WP_023082193.1|4573735_4576183_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_012614134.1|4576583_4578236_-	cyclic peptide export ABC transporter	NA	G9BWD6	Planktothrix_phage	27.7	1.3e-15
WP_012614135.1|4578595_4579423_+	pyoverdine synthetase F	NA	NA	NA	NA	NA
WP_034020675.1|4579483_4580338_-	formylglycine-generating enzyme family protein	NA	A0A7H6	Microcystis_virus	41.4	3.6e-41
WP_034020678.1|4580366_4581644_-|tail	pyoverdine-tailoring periplasmic protein PvdN	tail	NA	NA	NA	NA
WP_012614138.1|4581655_4583014_-|tail	pyoverdine-tailoring dipeptidase-like protein PvdM	tail	NA	NA	NA	NA
WP_019726224.1|4583228_4584866_+	pyoverdine maturation tyrosinase PvdP	NA	NA	NA	NA	NA
WP_012614140.1|4584914_4586339_-	pyoverdine export/recycling transporter outer membrane subunit OmpQ	NA	NA	NA	NA	NA
WP_023089148.1|4586344_4588336_-	pyoverdine export/recycling transporter ATP-binding/permease subunit PvdT	NA	G9BWD6	Planktothrix_phage	39.3	6.9e-35
WP_003089547.1|4588335_4589511_-	pyoverdine export/recycling transporter periplasmic adaptor subunit PvdR	NA	NA	NA	NA	NA
WP_034011465.1|4589611_4590607_-	FecR family protein	NA	NA	NA	NA	NA
WP_003103620.1|4590770_4591250_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_003114509.1|4591382_4592714_+	L-ornithine N(5)-monooxygenase	NA	NA	NA	NA	NA
WP_034003783.1|4592836_4595125_+	acylase	NA	NA	NA	NA	NA
WP_003089535.1|4595305_4595629_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_003114511.1|4595670_4596591_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003104946.1|4596687_4597839_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_003089526.1|4597905_4598148_-	DUF1654 domain-containing protein	NA	NA	NA	NA	NA
WP_003104944.1|4598442_4598679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023091315.1|4598944_4599415_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_023091316.1|4599411_4601727_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	NA	NA	NA	NA
WP_023089145.1|4602143_4603349_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003110901.1|4603549_4604191_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003089513.1|4604467_4604863_+	DUF4280 domain-containing protein	NA	NA	NA	NA	NA
WP_003114514.1|4604885_4605422_-	toxin-antitoxin system YwqK family antitoxin	NA	NA	NA	NA	NA
WP_016253420.1|4605432_4607436_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	29.8	1.2e-42
WP_003116945.1|4607442_4608228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003116944.1|4608297_4609173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023089143.1|4611813_4612830_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_009876463.1|4612793_4614587_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_003122696.1|4614570_4614996_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
