The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP007491	Escherichia coli strain ACN002 chromosome, complete genome	4879931	252112	344220	4879931	integrase,tail,plate,capsid,head,terminase,holin,transposase,portal,protease	Shigella_phage(45.0%)	102	265768:265826	307483:307541
WP_000006256.1|252112_252610_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_000952760.1|252927_254667_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_000207589.1|254611_255397_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226155.1|255467_256523_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_001059874.1|256519_256972_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001295204.1|257704_257845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001293003.1|257901_259359_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291992.1|259619_260078_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189539.1|260169_261414_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174677.1|261471_261873_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749881.1|261911_262967_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_001285288.1|263254_264358_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893260.1|264369_265623_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.0	1.7e-95
265768:265826	attL	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTTAAATCAATAA	NA	NA	NA	NA
WP_000051887.1|265827_266991_-|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_000206810.1|267217_267523_-	hypothetical protein	NA	U5P0J0	Shigella_phage	97.0	2.2e-49
WP_001242717.1|267522_267885_-	phage protein	NA	K7PH61	Enterobacteria_phage	99.1	2.0e-65
WP_000008183.1|267875_268412_-	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
WP_059309162.1|268539_269364_-	DUF2303 family protein	NA	K7PJQ6	Enterobacteria_phage	98.5	5.6e-148
WP_000135680.1|269429_269792_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000917896.1|270392_270689_-	hypothetical protein	NA	Q8SBF7	Shigella_phage	100.0	1.2e-52
WP_059309163.1|271139_271424_-	hypothetical protein	NA	A0A2H4FNB7	Salmonella_phage	48.9	2.1e-14
WP_000135661.1|271491_271839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023145979.1|271854_272559_-	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	59.0	2.2e-68
WP_000098317.1|272666_272930_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	51.7	1.1e-09
WP_059309164.1|272958_273510_+	hypothetical protein	NA	K7PGU3	Enterobacteria_phage	96.7	1.9e-96
WP_001250269.1|273685_273865_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104969.1|273854_274796_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	99.7	3.9e-153
WP_077871628.1|274792_275287_+	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	98.8	9.6e-87
WP_000066917.1|275286_275940_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_000210154.1|275936_276263_+	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	99.1	2.7e-53
WP_000767124.1|276259_276649_+	RusA family crossover junction endodeoxyribonuclease	NA	Q8SBE7	Shigella_phage	100.0	7.1e-69
WP_001061380.1|276668_277478_+	KilA-N domain-containing protein	NA	Q8SBE6	Shigella_phage	98.9	2.8e-152
WP_001433852.1|277485_278475_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.7	1.9e-195
WP_001205457.1|278493_278838_+	antitermination protein Q	NA	A0A0P0ZCW0	Stx2-converting_phage	89.4	7.2e-57
WP_001542079.1|278863_279478_-	hypothetical protein	NA	A0A2D1GNI4	Pseudomonas_phage	35.9	2.2e-32
WP_125282403.1|279481_279826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000907077.1|279841_280591_-	TIGR04255 family protein	NA	NA	NA	NA	NA
WP_001120496.1|280991_281318_+|holin	phage holin, lambda family	holin	U5P0K7	Shigella_phage	99.1	1.2e-56
WP_001197764.1|281321_281798_+	glycoside hydrolase family 104 protein	NA	S5FV07	Shigella_phage	95.6	1.7e-85
WP_001367630.1|281781_282174_+	DUF2570 domain-containing protein	NA	Q8SBD9	Shigella_phage	82.9	5.7e-50
WP_000651448.1|282420_282741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001135203.1|282836_283187_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	97.4	1.4e-63
WP_059309166.1|283312_283807_+|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	98.8	1.5e-87
WP_122986317.1|284040_285537_+|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.6	9.7e-300
WP_000605604.1|285548_285731_+	hypothetical protein	NA	M1FJ83	Enterobacteria_phage	100.0	1.7e-25
WP_059309167.1|285730_286972_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.3	1.0e-241
WP_001193634.1|286949_287600_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	99.1	3.6e-118
WP_059309168.1|287614_288820_+|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	99.3	1.6e-223
WP_000601360.1|288869_289070_+	hypothetical protein	NA	S5FNU1	Shigella_phage	97.0	3.8e-26
WP_000927711.1|289072_289396_+|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_024215340.1|289392_289803_+|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	97.1	1.7e-73
WP_024215338.1|289777_290284_+	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	89.9	8.9e-80
WP_059309169.1|290280_290841_+	hypothetical protein	NA	U5P4H6	Shigella_phage	98.4	7.5e-104
WP_000497751.1|290849_291020_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_059309170.1|291003_292500_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	M1FN90	Enterobacteria_phage	99.8	1.1e-274
WP_000090998.1|292499_292856_+|tail	phage tail tube protein	tail	U5P076	Shigella_phage	100.0	5.3e-63
WP_000661047.1|292855_293125_+|tail	phage tail assembly protein	tail	S5FNR3	Shigella_phage	100.0	3.5e-43
WP_059309171.1|293266_295102_+|tail	phage tail tape measure protein	tail	S5FM63	Shigella_phage	99.3	2.9e-306
WP_059309172.1|295162_296491_+	DNA circularization N-terminal domain-containing protein	NA	Q8SBG8	Shigella_phage	98.6	1.6e-245
WP_000999503.1|296487_297567_+|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.7	3.4e-206
WP_001259082.1|297566_298115_+|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	98.9	1.5e-96
WP_059309173.1|298114_298540_+	phage GP46 family protein	NA	U5P0R9	Shigella_phage	97.9	3.7e-79
WP_000785342.1|298526_299585_+|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	98.9	3.1e-199
WP_000383549.1|299575_300160_+	YmfQ family protein	NA	O22003	Shigella_phage	99.5	1.8e-113
WP_015364405.1|300163_300814_+	hypothetical protein	NA	M1FN94	Enterobacteria_phage	65.1	7.9e-65
WP_000376429.1|300817_301237_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	54.4	5.0e-36
WP_001030519.1|301208_301811_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	88.5	1.1e-97
WP_021574459.1|301810_302344_-|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	69.1	4.1e-59
WP_015364430.1|302373_302928_+	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	86.7	1.8e-86
WP_059309174.1|303270_303768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015364432.1|304155_304260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001104032.1|304366_307120_-	hypothetical protein	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	26.0	3.3e-27
WP_001111345.1|307654_308065_-	hypothetical protein	NA	NA	NA	NA	NA
307483:307541	attR	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTTAAATCAATAA	NA	NA	NA	NA
WP_048943132.1|308043_309000_-	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000667031.1|309009_311208_-	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.8	1.1e-38
WP_000643336.1|311204_312161_-	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_000070694.1|312157_312847_-	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_001019920.1|313264_313879_+	YagU family protein	NA	NA	NA	NA	NA
WP_001305432.1|314769_315480_-	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001323478.1|315448_317092_-	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001131091.1|317081_319607_-	fimbrial usher EcpC	NA	NA	NA	NA	NA
WP_000716398.1|319618_320287_-	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_000730974.1|320344_320932_-	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_024179291.1|321006_321549_-	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_001147279.1|322371_322599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000866436.1|322633_322774_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_000803998.1|322773_323037_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000662258.1|323400_323502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000020228.1|324616_328867_+	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
WP_000621009.1|329006_329858_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001306921.1|330448_331042_-	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000474091.1|331053_331290_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001046317.1|331398_332724_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	2.5e-113
WP_000339586.1|332949_333804_+	DNA-binding transcriptional regulator RclR	NA	NA	NA	NA	NA
WP_001102099.1|334331_335051_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000023927.1|335061_336489_+	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001323770.1|336481_337177_+	lactate utilization protein C	NA	NA	NA	NA	NA
WP_001209100.1|337419_338088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001159094.1|338300_339971_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_000089055.1|339984_341457_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001299022.1|341470_342058_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000131044.1|342186_344220_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
>prophage 2
NZ_CP007491	Escherichia coli strain ACN002 chromosome, complete genome	4879931	567847	580287	4879931	lysis,integrase,holin	Enterobacteria_phage(43.75%)	18	567788:567834	589322:589368
567788:567834	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001298992.1|567847_569011_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
WP_000206733.1|569237_569543_-	hypothetical protein	NA	U5P0J0	Shigella_phage	99.0	3.4e-50
WP_001242748.1|569542_569905_-	hypothetical protein	NA	U5P092	Shigella_phage	99.2	1.0e-66
WP_000008200.1|569895_570432_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	100.0	4.3e-101
WP_000081308.1|570559_571384_-	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	5.0e-149
WP_000135682.1|571449_571812_-	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_000453587.1|571909_572455_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_000881608.1|573019_573202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000830178.1|573408_573735_-	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_000738425.1|574215_574509_+	increased serum survival lipoprotein Iss	NA	C6ZCX3	Enterobacteria_phage	91.8	1.6e-44
WP_001228695.1|574599_574782_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000992107.1|574998_575532_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	95.5	1.1e-99
WP_000370549.1|575637_575910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000250557.1|575875_576220_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	90.5	3.5e-35
WP_000284486.1|576224_576440_-|holin	class II holin family protein	holin	M1FN85	Enterobacteria_phage	95.8	1.0e-32
WP_077249175.1|577533_578598_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	98.0	1.0e-202
WP_000917724.1|578744_578948_-	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_000357056.1|579267_580287_+	hypothetical protein	NA	A0A0R6PIZ6	Moraxella_phage	32.5	2.4e-39
589322:589368	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
>prophage 3
NZ_CP007491	Escherichia coli strain ACN002 chromosome, complete genome	4879931	817436	836522	4879931	integrase,tail,terminase,lysis,transposase,protease	Enterobacteria_phage(62.96%)	27	808937:808951	846228:846242
808937:808951	attL	CTGGAAGATGGCCTG	NA	NA	NA	NA
WP_000533642.1|817436_818507_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	100.0	5.1e-202
WP_001303849.1|818484_818703_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545745.1|818742_818910_-	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.9e-27
WP_088895425.1|819182_820410_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_000208005.1|820730_821528_-	DUF550 domain-containing protein	NA	A0A075B8H2	Enterobacteria_phage	41.1	5.7e-49
WP_000582229.1|821538_822294_-	hypothetical protein	NA	A0A1R3Y5Q7	Salmonella_virus	92.4	5.5e-142
WP_001289862.1|822295_822703_-	ead/Ea22-like family protein	NA	A0A125RPT9	Escherichia_phage	97.0	3.1e-67
WP_000763386.1|822699_822921_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	98.6	6.4e-35
WP_000188870.1|823019_823235_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
WP_000548531.1|823311_823503_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_072216179.1|823475_823661_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	95.1	1.6e-26
WP_000186798.1|823657_824338_-	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	1.3e-131
WP_000372938.1|824527_824680_-	host cell division inhibitory peptide Kil	NA	A0A0P0ZC96	Stx2-converting_phage	98.0	2.4e-20
WP_001198861.1|824648_824813_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065371.1|824885_825254_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	99.2	4.5e-65
WP_000213968.1|825436_825637_-	antirestriction Ral family protein	NA	A0A0K2FJE6	Enterobacteria_phage	98.5	2.4e-33
WP_029403297.1|826152_827235_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	78.4	4.4e-161
WP_000839596.1|827824_828040_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135294.1|828039_828537_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.6	1.9e-90
WP_012738274.1|828753_828936_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	100.0	1.7e-17
WP_000738492.1|829026_829320_-	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	100.0	4.0e-48
WP_001403557.1|829610_830021_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	99.3	9.4e-72
WP_001031427.1|830306_830513_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001421937.1|830677_830872_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_000453576.1|831260_831806_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	99.4	4.7e-95
WP_001700483.1|831780_832884_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	7.8e-214
WP_024179294.1|834311_836522_+|tail	tail fiber domain-containing protein	tail	K7PGT9	Enterobacteria_phage	57.6	7.7e-237
846228:846242	attR	CTGGAAGATGGCCTG	NA	NA	NA	NA
>prophage 4
NZ_CP007491	Escherichia coli strain ACN002 chromosome, complete genome	4879931	920684	929266	4879931	integrase	Salmonella_phage(84.62%)	14	915704:915716	922560:922572
915704:915716	attL	TGGGAATGAGTCA	NA	NA	NA	NA
WP_000290933.1|920684_921737_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
WP_001321204.1|921923_922115_-	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	68.2	4.0e-09
WP_001047324.1|922130_922700_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	42.9	4.2e-38
922560:922572	attR	TGGGAATGAGTCA	NA	NA	NA	NA
WP_001247707.1|922825_923047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460893.1|923079_923589_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000956182.1|923596_923797_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
WP_000963472.1|923760_924102_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.3e-55
WP_001244230.1|924169_924403_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	1.1e-32
WP_000752619.1|924402_924630_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	3.5e-36
WP_000104150.1|924626_925481_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	90.5	7.5e-148
WP_001420002.1|925486_926308_+	hypothetical protein	NA	A0A0M4RCP6	Salmonella_phage	75.7	1.1e-122
WP_001109970.1|926307_928680_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.2	0.0e+00
WP_001154433.1|928833_929022_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	100.0	1.4e-27
WP_001217579.1|929032_929266_+	DinI family protein	NA	E5G6M1	Salmonella_phage	98.7	1.0e-35
>prophage 5
NZ_CP007491	Escherichia coli strain ACN002 chromosome, complete genome	4879931	1476100	1530178	4879931	tail,terminase,lysis,portal,protease	Enterobacteria_phage(33.33%)	57	NA	NA
WP_001260840.1|1476100_1476922_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|1477021_1477105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743951.1|1477197_1477533_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091819.1|1477929_1479183_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|1479289_1480183_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|1480317_1481538_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|1481662_1482358_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071606760.1|1482310_1483603_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|1483761_1484376_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526490.1|1484418_1485273_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|1485274_1485892_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001342404.1|1485902_1488326_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	9.8e-209
WP_000041556.1|1488386_1490813_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	7.7e-214
WP_001307224.1|1491011_1491317_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|1491424_1492135_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|1492137_1492698_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705211.1|1492732_1493074_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|1493208_1493535_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|1493740_1494955_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836058.1|1494966_1495986_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001389342.1|1496043_1496172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001459782.1|1496173_1497454_-	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.6	2.3e-156
WP_000005552.1|1497488_1497740_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_041520819.1|1497812_1500284_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.1	1.2e-57
WP_001083276.1|1500377_1500569_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000854559.1|1500565_1500754_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000344950.1|1501240_1501816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379589.1|1501817_1501973_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_048943200.1|1502165_1502573_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	3.3e-24
WP_000476993.1|1502650_1502878_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_023567544.1|1502861_1503383_+	phage regulatory protein CII	NA	NA	NA	NA	NA
WP_000054505.1|1503363_1504329_+	hypothetical protein	NA	U5P0A0	Shigella_phage	61.2	2.9e-55
WP_001151189.1|1504369_1504771_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	95.5	2.4e-64
WP_022645725.1|1504970_1505993_+	hypothetical protein	NA	Q858S2	Enterobacteria_phage	62.4	2.5e-105
WP_000887491.1|1507007_1507220_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	97.1	1.7e-29
WP_000980999.1|1507436_1507688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032140164.1|1507754_1508033_+	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	6.1e-06
WP_023567547.1|1508034_1509084_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	1.4e-108
WP_000904112.1|1509096_1509471_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	8.4e-35
WP_023567548.1|1509467_1510289_+	antitermination protein	NA	K7PKS8	Enterobacteria_phage	54.0	4.5e-81
WP_000562553.1|1511191_1511323_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	3.7e-06
WP_000506934.1|1511689_1512118_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_072162994.1|1512289_1512664_+	tolA family protein	NA	NA	NA	NA	NA
WP_000839561.1|1512915_1513131_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	95.8	5.9e-33
WP_000192451.1|1513135_1513480_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.2e-37
WP_000370545.1|1513445_1513718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101168.1|1513823_1514366_+	lysozyme	NA	Q08J98	Stx2-converting_phage	87.8	3.0e-94
WP_059309187.1|1514362_1514899_+	hypothetical protein	NA	K7PHH7	Enterobacteria_phage	82.9	3.2e-72
WP_059309188.1|1515067_1515760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373426.1|1516331_1516826_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	99.4	2.2e-83
WP_001700320.1|1516825_1518928_+|terminase	phage terminase large subunit family protein	terminase	K7PH40	Enterobacteria_phage	99.9	0.0e+00
WP_001072975.1|1518924_1519137_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_077688660.1|1519064_1520645_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	2.4e-288
WP_000090847.1|1521773_1522376_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.1	1.8e-87
WP_048943199.1|1522436_1525916_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.5	0.0e+00
WP_032236520.1|1525983_1526583_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.5	1.7e-106
WP_071886289.1|1526647_1530178_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	35.5	1.9e-11
>prophage 6
NZ_CP007491	Escherichia coli strain ACN002 chromosome, complete genome	4879931	2291137	2299446	4879931		Enterobacteria_phage(83.33%)	9	NA	NA
WP_001374182.1|2291137_2293138_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.3	0.0e+00
WP_001295429.1|2293262_2293724_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|2293764_2294235_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_059309194.1|2294281_2295001_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2294997_2296683_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|2296904_2297636_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|2297695_2297803_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|2297783_2298515_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569361.1|2298519_2299446_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
>prophage 7
NZ_CP007491	Escherichia coli strain ACN002 chromosome, complete genome	4879931	2903600	2916783	4879931		Escherichia_phage(50.0%)	12	NA	NA
WP_001272924.1|2903600_2906162_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
WP_001141340.1|2906267_2906924_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	8.0e-49
WP_001297141.1|2906974_2907742_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_000847985.1|2907937_2908846_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590392.1|2908842_2910105_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278994.1|2910101_2910740_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001136918.1|2910744_2911521_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_000104456.1|2911609_2912974_+	GntP family transporter	NA	NA	NA	NA	NA
WP_048943255.1|2913067_2914060_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	4.6e-32
WP_001272592.1|2914122_2915262_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|2915401_2916028_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_059309200.1|2916021_2916783_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	2.9e-58
>prophage 8
NZ_CP007491	Escherichia coli strain ACN002 chromosome, complete genome	4879931	4376189	4424407	4879931	tail,integrase,capsid,head,terminase,lysis,portal,tRNA	Enterobacteria_phage(43.64%)	60	4408423:4408437	4430293:4430307
WP_001535325.1|4376189_4376771_+	SocA family protein	NA	A0A139ZPG5	Marinitoga_camini_virus	29.6	8.8e-07
WP_000900143.1|4376776_4377238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001093914.1|4377271_4377544_-	pyocin activator PrtN family protein	NA	S5MQM5	Escherichia_phage	96.6	5.7e-41
WP_001061348.1|4377580_4378153_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	99.5	1.2e-109
WP_000206745.1|4378152_4378962_-	hypothetical protein	NA	Q8HAA7	Salmonella_phage	61.8	3.3e-76
WP_001565177.1|4378961_4379324_-	phage protein	NA	U5P092	Shigella_phage	97.5	1.5e-65
WP_000008210.1|4379314_4379851_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	99.4	9.7e-101
WP_001569327.1|4379978_4380803_-	DUF2303 family protein	NA	U5P439	Shigella_phage	99.3	1.7e-149
WP_000135691.1|4380868_4381231_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	98.3	1.2e-59
WP_001513551.1|4381799_4382294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000859462.1|4382636_4383311_-	LexA family transcriptional repressor	NA	Q8SBF6	Shigella_phage	100.0	1.2e-132
WP_000649477.1|4383401_4383602_+	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_039268521.1|4383645_4384197_+	hypothetical protein	NA	Q8SBF4	Shigella_phage	99.5	9.9e-101
WP_059309219.1|4384193_4385030_+	ash family protein	NA	Q8SBF3	Shigella_phage	92.4	3.7e-139
WP_047668166.1|4385022_4385259_+	hypothetical protein	NA	A0A291AX25	Escherichia_phage	97.4	8.7e-38
WP_000061529.1|4385255_4386074_+	helix-turn-helix domain-containing protein	NA	Q8SBF1	Shigella_phage	100.0	1.8e-122
WP_074014899.1|4386070_4386565_+	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	98.8	4.3e-87
WP_000066917.1|4386564_4387218_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_000210154.1|4387214_4387541_+	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	99.1	2.7e-53
WP_000767114.1|4387537_4387927_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PH72	Enterobacteria_phage	99.2	4.6e-68
WP_001532217.1|4387946_4388744_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.2	2.6e-150
WP_071887085.1|4388751_4389741_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	1.4e-193
WP_085949407.1|4389755_4390124_+	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	87.5	9.4e-55
WP_001208502.1|4390159_4390609_-	hypothetical protein	NA	A5LH78	Enterobacteria_phage	43.8	8.0e-24
WP_001446998.1|4390630_4391572_-	hypothetical protein	NA	A5LH79	Enterobacteria_phage	44.2	5.0e-68
WP_000917724.1|4391840_4392044_+	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_000799656.1|4392194_4393247_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	100.0	2.7e-208
WP_000839597.1|4393314_4393530_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	2.6e-33
WP_059309221.1|4393529_4394027_+	lysozyme RrrD	NA	A0A291AWW2	Escherichia_phage	98.2	2.4e-90
WP_000079508.1|4394095_4394506_-	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_001663509.1|4394562_4394796_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	2.5e-21
WP_000453587.1|4395184_4395730_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_059309222.1|4395704_4397630_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
WP_000198153.1|4397626_4397833_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_059309223.1|4397829_4399431_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	1.6e-308
WP_023278094.1|4399411_4400731_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.6	6.2e-234
WP_001345004.1|4400740_4401073_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	5.0e-55
WP_000063265.1|4401128_4402154_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_001695575.1|4402195_4402591_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	8.2e-57
WP_059309224.1|4402602_4402956_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	99.1	3.4e-62
WP_059309225.1|4402967_4403543_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	61.2	1.1e-52
WP_059309226.1|4403539_4403935_+|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	96.9	5.5e-69
WP_032082990.1|4403942_4404683_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	1.7e-127
WP_032082986.1|4404698_4405121_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	5.3e-70
WP_000459464.1|4405102_4405537_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	98.3	1.7e-63
WP_059309227.1|4405529_4408091_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	88.2	0.0e+00
WP_000847352.1|4408087_4408417_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	97.2	1.1e-57
WP_001152632.1|4408416_4409115_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	9.5e-133
4408423:4408437	attL	GATATCCGGCAGGAA	NA	NA	NA	NA
WP_059309228.1|4409120_4409864_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.0	1.6e-149
WP_071887086.1|4409800_4410433_+|tail	tail assembly protein	tail	C6ZCZ4	Enterobacteria_phage	95.2	1.1e-92
WP_059309230.1|4410493_4413889_+	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	89.0	0.0e+00
WP_052940550.1|4413956_4414556_+	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	97.0	5.3e-108
WP_071887089.1|4414620_4418151_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	36.4	8.5e-12
WP_059309232.1|4418150_4418735_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.8	6.6e-103
WP_001217539.1|4418850_4419099_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
WP_021557428.1|4419160_4420258_-|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.7	1.1e-212
WP_000543828.1|4420346_4421384_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000891389.1|4421517_4421760_+	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000235522.1|4421925_4422909_-	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000918363.1|4422991_4424407_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
4430293:4430307	attR	GATATCCGGCAGGAA	NA	NA	NA	NA
>prophage 9
NZ_CP007491	Escherichia coli strain ACN002 chromosome, complete genome	4879931	4510851	4572139	4879931	integrase,protease,tRNA,transposase	Acinetobacter_phage(23.08%)	48	4513018:4513032	4573421:4573435
WP_001295074.1|4510851_4512369_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
WP_000856841.1|4512605_4514063_-	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.4	8.9e-48
4513018:4513032	attL	AAGCCAAAGGCAAAC	NA	NA	NA	NA
WP_001295383.1|4514121_4516269_-	lysine decarboxylase CadA	NA	NA	NA	NA	NA
WP_000092909.1|4516348_4517683_-	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
WP_001187182.1|4518048_4519587_-	lysine decarboxylation/transport transcriptional activator CadC	NA	NA	NA	NA	NA
WP_085975623.1|4521262_4521460_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_059309235.1|4521647_4522058_-	toxin	NA	NA	NA	NA	NA
WP_039023579.1|4522148_4522517_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_059309237.1|4523214_4523436_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	44.4	7.2e-10
WP_059309238.1|4523498_4523975_-	RadC family protein	NA	NA	NA	NA	NA
WP_057109541.1|4523990_4524470_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.0	5.2e-13
WP_001175153.1|4524735_4525554_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.5	1.4e-47
WP_001278287.1|4525643_4525877_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_001097368.1|4525882_4526560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059309239.1|4526678_4527563_-	50S ribosome-binding GTPase	NA	NA	NA	NA	NA
WP_021573508.1|4527668_4528658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021527174.1|4528654_4529509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000573211.1|4531171_4531420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001075462.1|4531524_4532256_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_001100706.1|4532765_4533218_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_001126811.1|4535869_4536436_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_059309240.1|4536682_4537258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000958149.1|4537326_4537563_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_153275897.1|4537591_4537744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088895425.1|4538245_4539473_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_059309241.1|4539575_4540700_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_021527151.1|4540841_4542116_-	esterase family protein	NA	NA	NA	NA	NA
WP_001554632.1|4542653_4543088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001554634.1|4543900_4544110_+	microcin H47 immunity protein MchI	NA	NA	NA	NA	NA
WP_071780941.1|4544137_4544365_+	microcin H47	NA	NA	NA	NA	NA
WP_001554635.1|4544636_4546187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021527076.1|4546212_4546665_+	toxin-activating lysine-acyltransferase	NA	NA	NA	NA	NA
WP_000489615.1|4546817_4548092_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_112030617.1|4548066_4550187_+	microcin export transporter peptidase/ATP-binding subunit MchF	NA	F2Y165	Organic_Lake_phycodnavirus	24.2	1.2e-13
WP_001390454.1|4550247_4550571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021527187.1|4551182_4551869_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_021527186.1|4551968_4552415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021527185.1|4552872_4553421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001255836.1|4557116_4557449_+	DUF600 family protein	NA	NA	NA	NA	NA
WP_059309242.1|4557545_4560959_+	DEAD/DEAH box helicase family protein	NA	Q6NDX2	Leptospira_phage	26.2	2.5e-16
WP_021527170.1|4561022_4562657_+	N-6 DNA methylase	NA	J7I0U9	Acinetobacter_phage	30.9	2.6e-32
WP_021527169.1|4562665_4563760_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_085962211.1|4564447_4565616_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_170983259.1|4566934_4567324_+|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	98.4	3.9e-67
WP_000587837.1|4567583_4568126_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_059309245.1|4568171_4568999_-	aminoglycoside 3-N-acetyltransferase	NA	NA	NA	NA	NA
WP_001339175.1|4569141_4570350_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	99.8	2.3e-235
WP_001218753.1|4570876_4572139_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	42.6	1.1e-78
4573421:4573435	attR	GTTTGCCTTTGGCTT	NA	NA	NA	NA
