The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013921	Lacticaseibacillus paracasei strain KL1 chromosome, complete genome	2918888	68570	146640	2918888	tRNA,tail,protease,integrase,capsid,holin,terminase,portal,head	Lactobacillus_phage(75.44%)	91	65539:65556	99778:99795
65539:65556	attL	AACCAGCAAGTGCAGGCA	NA	NA	NA	NA
WP_040167006.1|68570_69785_-|integrase	site-specific integrase	integrase	A0A1X9I5L3	Streptococcus_phage	27.4	1.9e-35
WP_025376031.1|69874_70723_-	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
WP_059219777.1|70945_71506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011674693.1|71673_71877_-	hypothetical protein	NA	A0A0P0IQK8	Lactobacillus_phage	94.0	5.2e-31
WP_040167012.1|71900_72326_-	pyridoxamine 5'-phosphate oxidase family protein	NA	A0A0P0I7K6	Lactobacillus_phage	89.4	1.7e-63
WP_123837444.1|72460_72655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040167014.1|72626_73376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040167016.1|73475_74081_-	DUF4352 domain-containing protein	NA	A0A0P0IXE0	Lactobacillus_phage	98.0	1.3e-77
WP_040167018.1|74144_74564_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0P0IJN5	Lactobacillus_phage	99.3	2.6e-77
WP_003574523.1|74553_74892_-	helix-turn-helix transcriptional regulator	NA	A0A0P0IZG9	Lactobacillus_phage	98.2	6.6e-55
WP_003595437.1|75026_75269_+	helix-turn-helix transcriptional regulator	NA	A0A0P0HRP5	Lactobacillus_phage	95.0	1.2e-34
WP_155598324.1|75265_75415_+	hypothetical protein	NA	A0A1B0Y2Q8	Lactobacillus_phage	87.8	3.4e-16
WP_040167039.1|75411_75612_-	KTSC domain-containing protein	NA	A0A1S5S8T9	Streptococcus_phage	50.0	5.3e-12
WP_003595432.1|75700_75859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040167021.1|75921_76395_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_022671546.1|76385_76712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080772330.1|76831_77074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080772331.1|77075_77246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040167023.1|77259_78126_+	recombinase RecT	NA	A0A1X9I5N6	Streptococcus_phage	53.6	5.1e-59
WP_040167025.1|78145_78910_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A0P0IZH9	Lactobacillus_phage	55.2	3.9e-79
WP_019885634.1|78921_79365_+	HNH endonuclease	NA	A0A0R6PHK1	Moraxella_phage	50.0	1.2e-11
WP_040167027.1|79357_80314_+	DnaD domain protein	NA	A0A0P0HRQ2	Lactobacillus_phage	53.6	3.9e-76
WP_040167029.1|80325_80808_+	single-stranded DNA-binding protein	NA	U5U726	Lactobacillus_phage	90.1	1.0e-61
WP_040167030.1|80828_81377_+	HNH endonuclease	NA	A8YQL7	Lactobacillus_phage	78.2	5.6e-80
WP_040167032.1|81407_81623_+	helix-turn-helix transcriptional regulator	NA	A0A0P0IJY1	Lactobacillus_phage	90.0	3.9e-29
WP_040167036.1|82070_82454_+	DUF1064 domain-containing protein	NA	B4XYT1	Lactobacillus_phage	88.2	1.6e-60
WP_059219778.1|82473_82938_+	hypothetical protein	NA	A0A0P0IXF6	Lactobacillus_phage	97.4	5.0e-13
WP_059219780.1|83176_83584_+	hypothetical protein	NA	Q6J1U9	Lactobacillus_phage	96.3	6.9e-75
WP_040168007.1|83580_84096_+	DUF1642 domain-containing protein	NA	Q8LTB6	Lactobacillus_phage	63.7	1.1e-48
WP_040168005.1|84233_84665_+	hypothetical protein	NA	C1KFE8	Lactobacillus_virus	68.5	5.3e-49
WP_121497149.1|84658_85018_+	hypothetical protein	NA	B4XYT7	Lactobacillus_phage	48.5	2.1e-22
WP_040168001.1|85014_85461_+	hypothetical protein	NA	Q6J1U2	Lactobacillus_phage	88.6	5.3e-36
WP_040167999.1|85538_85757_+	helix-turn-helix transcriptional regulator	NA	A0A0P0IXA5	Lactobacillus_phage	97.2	5.0e-32
WP_040167997.1|86154_86583_+	DUF1492 domain-containing protein	NA	U5U7A6	Lactobacillus_phage	99.3	5.0e-76
WP_040167995.1|87190_88339_+	phage protein	NA	A0A0P0I3G0	Lactobacillus_phage	98.2	1.2e-220
WP_040167993.1|88724_89297_+|terminase	terminase small subunit	terminase	A0A0P0IUY4	Lactobacillus_phage	95.8	2.0e-80
WP_040167991.1|89280_90534_+|terminase	PBSX family phage terminase large subunit	terminase	A0A0P0I3B0	Lactobacillus_phage	98.6	2.7e-247
WP_040167989.1|90538_92203_+|portal	phage portal protein	portal	A0A0P0IJV3	Lactobacillus_phage	97.2	1.3e-257
WP_040167987.1|92168_93155_+|capsid	minor capsid protein	capsid	A0A0P0ID43	Lactobacillus_phage	96.3	9.5e-179
WP_040167985.1|93164_93491_+	hypothetical protein	NA	A0A0P0IJR5	Lactobacillus_phage	93.5	5.0e-52
WP_040167983.1|93487_93754_+	hypothetical protein	NA	A0A1Q1PVR6	Bacillus_phage	53.3	5.6e-17
WP_040167979.1|94138_94780_+	DUF4355 domain-containing protein	NA	A0A0P0ID10	Lactobacillus_phage	86.4	1.9e-79
WP_020751707.1|94792_95107_+	hypothetical protein	NA	A0A0P0IJQ8	Lactobacillus_phage	93.3	2.8e-47
WP_040167974.1|95120_96167_+|capsid	major capsid protein	capsid	A0A0P0IZJ7	Lactobacillus_phage	98.2	2.7e-187
WP_040167972.1|96235_97114_+	hypothetical protein	NA	A0A0P0IJL6	Lactobacillus_phage	84.6	1.9e-154
WP_040167970.1|97113_97488_+|head,tail	phage head-tail connector protein	head,tail	A0A0P0IZF6	Lactobacillus_phage	94.4	9.8e-60
WP_040167968.1|97492_97795_+	hypothetical protein	NA	A0A0P0HRN0	Lactobacillus_phage	91.0	3.1e-48
WP_040167966.1|97791_98157_+|head,tail	phage head-tail joining protein	head,tail	A0A0P0IUZ3	Lactobacillus_phage	96.7	3.1e-58
WP_040167964.1|98157_98562_+	DUF3168 domain-containing protein	NA	A0A0P0I3C8	Lactobacillus_phage	98.5	2.3e-70
WP_040167962.1|98573_99173_+|tail	phage tail protein	tail	A0A0N7IR90	Lactobacillus_phage	94.2	1.9e-97
WP_016376572.1|99250_99583_+|tail	tail assembly chaperone	tail	A0A0P0IQQ6	Lactobacillus_phage	98.2	6.7e-52
WP_040168009.1|99687_100041_+	hypothetical protein	NA	A0A0P0I7N9	Lactobacillus_phage	94.0	1.5e-54
99778:99795	attR	AACCAGCAAGTGCAGGCA	NA	NA	NA	NA
WP_040167960.1|103125_105141_+|tail	phage tail family protein	tail	A0A0P0I7K0	Lactobacillus_phage	48.4	2.0e-159
WP_040165995.1|108761_109052_+	hypothetical protein	NA	Q3L0S1	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	74.0	8.5e-35
WP_040165991.1|109044_109176_+	XkdX family protein	NA	A0A0P0HRS7	Lactobacillus_phage	93.0	1.6e-17
WP_040165988.1|109205_109496_+	hypothetical protein	NA	B4XYQ7	Lactobacillus_phage	83.3	1.4e-37
WP_040165986.1|109488_109935_+|holin	phage holin	holin	A8YQK6	Lactobacillus_phage	97.3	7.6e-67
WP_040165984.1|109945_111091_+	LysM peptidoglycan-binding domain-containing protein	NA	Q6J1W8	Lactobacillus_phage	53.3	2.1e-89
WP_025376236.1|111135_111360_+	hypothetical protein	NA	A0A0P0IUZ5	Lactobacillus_phage	97.3	1.8e-32
WP_003661851.1|111689_112589_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_016376309.1|112878_118587_+	PII-type proteinase	NA	NA	NA	NA	NA
WP_016376310.1|118696_119629_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003571317.1|119778_120192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003603175.1|120594_123204_+	bifunctional lysylphosphatidylglycerol flippase/synthetase MprF	NA	NA	NA	NA	NA
WP_003603173.1|123308_123905_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003567111.1|123961_124291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003567109.1|124432_124939_+	nucleoside deaminase	NA	NA	NA	NA	NA
WP_003567107.1|125411_127109_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	44.4	3.0e-55
WP_003567105.1|127125_127434_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_016377320.1|127749_128349_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_003567100.1|128348_128612_+	YaaL family protein	NA	NA	NA	NA	NA
WP_016365525.1|129122_129767_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	53.1	3.1e-53
WP_003567098.1|129801_130131_+	cyclic-di-AMP receptor	NA	NA	NA	NA	NA
WP_003588621.1|130130_131108_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	27.8	1.1e-25
WP_003567092.1|131112_131451_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	38.9	4.6e-16
WP_003603168.1|131452_132310_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	55.4	9.4e-74
WP_003567089.1|132404_133148_+	acyl-ACP thioesterase	NA	NA	NA	NA	NA
WP_003603167.1|133243_134224_-	asparaginase	NA	NA	NA	NA	NA
WP_003567081.1|134707_135226_+	folate family ECF transporter S component	NA	NA	NA	NA	NA
WP_003661866.1|135456_136062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003567077.1|136545_137268_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_003567075.1|137251_137785_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_003567073.1|137818_138844_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	42.0	5.4e-60
WP_003567071.1|138939_139275_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_003580616.1|139551_141504_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.8	7.4e-58
WP_016376635.1|141721_142375_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_003567064.1|142516_142882_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003603162.1|142878_143766_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_003580611.1|143766_144795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003576133.1|144856_145915_-	LCP family protein	NA	NA	NA	NA	NA
WP_003567053.1|145995_146640_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 2
NZ_CP013921	Lacticaseibacillus paracasei strain KL1 chromosome, complete genome	2918888	169240	229110	2918888	tRNA,bacteriocin,transposase	Bacillus_phage(25.0%)	49	NA	NA
WP_003661896.1|169240_170383_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_016365924.1|170668_171457_-	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_003566973.1|171684_172074_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003566971.1|172383_172830_+	universal stress protein	NA	NA	NA	NA	NA
WP_003661898.1|173116_173731_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_003661899.1|173761_174682_+	EamA family transporter	NA	NA	NA	NA	NA
WP_003566964.1|174784_174955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016376629.1|175080_175569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016376628.1|175569_175812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040167248.1|176030_177050_-	adenosine deaminase	NA	NA	NA	NA	NA
WP_003661902.1|177573_178878_+	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	50.5	5.8e-115
WP_003571231.1|179116_180541_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_003571229.1|180537_181551_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_003571227.1|181547_183290_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	22.6	5.3e-23
WP_003661903.1|183270_184998_+	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	22.4	1.3e-21
WP_003566944.1|185069_185393_-	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
WP_003568911.1|185599_187015_+|transposase	IS5-like element ISLca2 family transposase	transposase	NA	NA	NA	NA
WP_059219784.1|187168_188581_+|transposase	IS5-like element ISLca2 family transposase	transposase	NA	NA	NA	NA
WP_003661905.1|188596_188971_-	YxeA family protein	NA	NA	NA	NA	NA
WP_040166784.1|189194_190361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003580491.1|190361_191156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016365588.1|191536_192637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003571199.1|192787_193213_+	NusG domain II-containing protein	NA	NA	NA	NA	NA
WP_011674813.1|193409_195101_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_003661912.1|195097_196729_+	ABC transporter ATP-binding protein	NA	F2Y165	Organic_Lake_phycodnavirus	30.8	4.8e-18
WP_016377256.1|196866_197724_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_003661914.1|198176_200015_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_003661916.1|200185_201634_+	glycoside hydrolase family 1 protein	NA	NA	NA	NA	NA
WP_003661922.1|201760_202327_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016365659.1|202493_203912_+	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_003661925.1|204117_205449_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016365657.1|205550_206978_-	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_003566913.1|207114_207471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003661928.1|207484_209410_-	OPT/YSL family transporter	NA	NA	NA	NA	NA
WP_003661931.1|209526_210546_-	bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB	NA	NA	NA	NA	NA
WP_003661932.1|210558_211680_-	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_003605773.1|212308_213094_+	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	27.5	1.0e-13
WP_040166775.1|213201_213846_-	ABC-2 transporter permease	NA	NA	NA	NA	NA
WP_003566897.1|214693_215089_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003661940.1|215102_216374_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_016377049.1|217474_218473_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.5	3.0e-55
WP_003577841.1|218695_219940_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.6	8.8e-12
WP_003661944.1|220100_221306_-	acetate kinase	NA	NA	NA	NA	NA
WP_003571154.1|221596_222565_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_016365951.1|222640_223555_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_016377033.1|223580_224651_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_059219788.1|225933_227178_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.6	1.5e-11
WP_040166726.1|227475_228390_+	UPF0104 family protein	NA	NA	NA	NA	NA
WP_003603074.1|228990_229110_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
>prophage 3
NZ_CP013921	Lacticaseibacillus paracasei strain KL1 chromosome, complete genome	2918888	341180	398030	2918888	protease,tRNA,transposase	Faecalibacterium_phage(18.18%)	42	NA	NA
WP_001748085.1|341180_342356_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_003588334.1|342920_343838_+	tyrosine-protein kinase modulator	NA	NA	NA	NA	NA
WP_016376974.1|343853_344597_+	CpsD/CapB family tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_059219790.1|344741_345758_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.7	1.9e-36
WP_025376021.1|346019_346511_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_025375985.1|348467_349388_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_003570852.1|350381_351041_+	sugar transferase	NA	NA	NA	NA	NA
WP_003588306.1|352631_353525_-	LCP family protein	NA	NA	NA	NA	NA
WP_003570845.1|353702_354467_+	tyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_003662742.1|354680_356831_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A0A8J958	Klebsiella_phage	36.7	1.4e-121
WP_003570841.1|357463_357865_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_059219792.1|358296_360228_+	fructose-bisphosphatase class III	NA	NA	NA	NA	NA
WP_003662746.1|360694_361525_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	26.5	3.2e-18
WP_003662748.1|361882_362797_+	sortase	NA	NA	NA	NA	NA
WP_003566632.1|363063_364095_-	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
WP_016377244.1|364471_366571_+	1,4-alpha-glucan branching protein GlgB	NA	NA	NA	NA	NA
WP_016377243.1|366567_367710_+	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
WP_016377242.1|367706_368876_+	glucose-1-phosphate adenylyltransferase subunit GlgD	NA	NA	NA	NA	NA
WP_016377241.1|368868_370314_+	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_003600200.1|370529_372938_+	glycogen/starch/alpha-glucan phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.0	1.2e-12
WP_003600202.1|373187_374966_+	glycoside hydrolase family 13 protein	NA	NA	NA	NA	NA
WP_003580097.1|375413_376343_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_003566600.1|376517_376853_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003566598.1|377029_377974_+	cation transporter	NA	NA	NA	NA	NA
WP_003570829.1|378507_379782_+|tRNA	tyrosine--tRNA ligase	tRNA	A0A1L2CUL7	Pectobacterium_phage	43.1	2.7e-85
WP_003599333.1|380088_381303_+	C40 family peptidase	NA	D2KRB9	Lactobacillus_phage	37.0	6.5e-12
WP_003599331.1|381409_381817_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003585182.1|381933_382536_+	guanylate kinase	NA	U5J9X2	Bacillus_phage	31.0	3.6e-11
WP_003566579.1|382605_382719_-	putative metal homeostasis protein	NA	NA	NA	NA	NA
WP_003566577.1|382827_383274_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_003599330.1|383565_384006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003599329.1|384026_385013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004561979.1|385434_386166_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.3	2.7e-37
WP_003566568.1|386293_387118_+	glutamate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016376922.1|387119_387764_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_016372928.1|387779_388442_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_172618962.1|388567_389527_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SKV4	Klosneuvirus	33.9	1.2e-37
WP_016376385.1|389713_390919_+	serine hydrolase	NA	NA	NA	NA	NA
WP_012669553.1|391251_392268_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.4	1.4e-36
WP_016376012.1|392451_394038_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_003605561.1|394027_395074_+	acyltransferase family protein	NA	NA	NA	NA	NA
WP_003568911.1|396614_398030_+|transposase	IS5-like element ISLca2 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP013921	Lacticaseibacillus paracasei strain KL1 chromosome, complete genome	2918888	511504	563859	2918888	tRNA,tail,protease,capsid,holin,transposase,portal	Lactobacillus_phage(71.43%)	62	NA	NA
WP_004562115.1|511504_512788_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	47.7	2.3e-84
WP_003566817.1|518577_519102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003575678.1|519254_519767_-	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_003566819.1|519805_520444_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_003596308.1|521636_522653_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.7	1.9e-36
WP_040167758.1|523430_524102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040167761.1|524156_524804_-	helix-turn-helix domain-containing protein	NA	B4XYR6	Lactobacillus_phage	42.2	8.2e-38
WP_040167763.1|524952_525219_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_040167767.1|525215_525488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040167770.1|525484_526012_+	hypothetical protein	NA	D2XQ14	Bacillus_virus	46.1	2.8e-20
WP_040167772.1|526031_526238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010489711.1|526282_526639_+	DUF771 domain-containing protein	NA	U5U4L9	Lactobacillus_phage	97.5	2.6e-62
WP_162917948.1|526723_526876_+	hypothetical protein	NA	A0A0P0HRK6	Lactobacillus_phage	92.0	1.7e-18
WP_040167796.1|526880_527084_+	hypothetical protein	NA	Q6J1W0	Lactobacillus_phage	92.5	6.3e-29
WP_040167777.1|527102_527588_+	siphovirus Gp157 family protein	NA	B4XYS3	Lactobacillus_phage	96.9	1.4e-79
WP_040167779.1|527588_528311_+	AAA family ATPase	NA	A0A0P0IJT7	Lactobacillus_phage	96.7	2.1e-130
WP_080772343.1|528273_529650_+	DEAD/DEAH box helicase	NA	A0A0P0ID30	Lactobacillus_phage	91.9	1.7e-245
WP_040167782.1|529650_530259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040167785.1|530260_530779_+	DUF669 domain-containing protein	NA	A0A0P0IQI1	Lactobacillus_phage	95.3	8.5e-94
WP_040167787.1|530790_533091_+	DNA primase	NA	A0A0P0IX98	Lactobacillus_phage	98.0	0.0e+00
WP_040167789.1|533353_533680_+	VRR-NUC domain-containing protein	NA	A0A0P0IJK0	Lactobacillus_phage	97.2	4.9e-55
WP_040167792.1|533670_533850_+	hypothetical protein	NA	Q6J1V0	Lactobacillus_phage	94.9	1.2e-26
WP_040167694.1|533935_534400_+	hypothetical protein	NA	A0A0P0IXF6	Lactobacillus_phage	95.8	1.8e-18
WP_025013908.1|534533_534818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050894226.1|534814_535222_+	hypothetical protein	NA	Q6J1U9	Lactobacillus_phage	98.5	8.2e-76
WP_040167847.1|535218_535749_+	DUF1642 domain-containing protein	NA	B4XYT4	Lactobacillus_phage	69.7	1.6e-60
WP_032799897.1|535741_535948_+	hypothetical protein	NA	B4XYT6	Lactobacillus_phage	97.1	4.3e-33
WP_040167841.1|535944_536307_+	phage protein	NA	A0A2D1GPA2	Lactobacillus_phage	66.7	3.6e-35
WP_040167839.1|536303_536564_+	hypothetical protein	NA	C1KFT6	Lactobacillus_virus	68.6	9.9e-27
WP_040167837.1|536628_536811_+	hypothetical protein	NA	A0A0P0I365	Lactobacillus_phage	66.7	2.2e-17
WP_059219795.1|537207_537651_+	transcriptional regulator	NA	A0A0P0IZI6	Lactobacillus_phage	99.3	2.3e-79
WP_162917949.1|538291_538759_+	super-infection exclusion protein B	NA	NA	NA	NA	NA
WP_016377049.1|538922_539921_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.5	3.0e-55
WP_040167834.1|540139_541288_+	phage protein	NA	B4XYU0	Lactobacillus_phage	97.4	7.6e-220
WP_040167832.1|541280_541604_+	ribonucleoside-diphosphate reductase	NA	Q6J1T4	Lactobacillus_phage	82.7	2.8e-47
WP_040167831.1|541606_541930_+	hypothetical protein	NA	U5U7A9	Lactobacillus_phage	89.7	9.7e-48
WP_155598327.1|541949_542096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040167849.1|542117_542453_+	HNH endonuclease	NA	A0A2H4J5U5	uncultured_Caudovirales_phage	55.8	8.3e-26
WP_003572621.1|542686_542905_+	hypothetical protein	NA	D2XR14	Bacillus_phage	41.1	1.2e-06
WP_040167829.1|544607_545774_+|portal	phage portal protein	portal	A0A059T6F0	Listeria_phage	41.6	1.2e-82
WP_040167827.1|545751_546480_+|protease	Clp protease ClpP	protease	M1Q115	Streptococcus_phage	40.0	4.6e-37
WP_040167825.1|546501_547671_+|capsid	phage major capsid protein	capsid	A0A2P0ZLD6	Lactobacillus_phage	51.5	1.3e-102
WP_080772348.1|547667_547814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010489618.1|547806_548097_+	hypothetical protein	NA	A0A2P0ZLD5	Lactobacillus_phage	46.9	2.7e-17
WP_040167823.1|548089_548470_+	hypothetical protein	NA	M9QX19	Staphylococcus_phage	32.7	1.6e-09
WP_010489614.1|548466_548880_+	hypothetical protein	NA	A0A2P0ZLD7	Lactobacillus_phage	53.7	3.0e-33
WP_003572639.1|548876_549254_+	hypothetical protein	NA	A0A059T681	Listeria_phage	44.1	2.9e-19
WP_040167819.1|549268_549862_+|tail	phage major tail protein	tail	A0A2P0ZLF5	Lactobacillus_phage	40.7	3.1e-31
WP_080772347.1|549879_550116_+	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	60.3	1.2e-10
WP_040167815.1|550190_550508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040167813.1|550687_554656_+|tail	phage tail tape measure protein	tail	E9LUJ2	Lactobacillus_phage	38.1	2.6e-09
WP_040167811.1|554652_556617_+|tail	phage tail family protein	tail	Q7Y4B1	Lactobacillus_phage	47.4	1.1e-144
WP_059219797.1|556616_559550_+|tail	phage tail protein	tail	Q3L0S2	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	48.7	7.6e-240
WP_040165995.1|559559_559850_+	hypothetical protein	NA	Q3L0S1	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	74.0	8.5e-35
WP_040165991.1|559842_559974_+	XkdX family protein	NA	A0A0P0HRS7	Lactobacillus_phage	93.0	1.6e-17
WP_040165988.1|560003_560294_+	hypothetical protein	NA	B4XYQ7	Lactobacillus_phage	83.3	1.4e-37
WP_040165986.1|560286_560733_+|holin	phage holin	holin	A8YQK6	Lactobacillus_phage	97.3	7.6e-67
WP_040166161.1|560743_561889_+	LysM peptidoglycan-binding domain-containing protein	NA	Q6J1W8	Lactobacillus_phage	53.3	1.3e-89
WP_005711084.1|561933_562158_+	hypothetical protein	NA	A0A0P0IUZ5	Lactobacillus_phage	98.6	6.1e-33
WP_059219799.1|562359_562704_+	hypothetical protein	NA	A0A2D1GPG5	Lactobacillus_phage	94.8	9.4e-49
WP_052458363.1|562996_563413_+	hypothetical protein	NA	A0A2D1GPM5	Lactobacillus_phage	98.6	1.1e-67
WP_040166174.1|563409_563859_+	protein-export chaperone SecB	NA	A0A2D1GPE1	Lactobacillus_phage	98.7	2.3e-79
>prophage 5
NZ_CP013921	Lacticaseibacillus paracasei strain KL1 chromosome, complete genome	2918888	1443997	1453340	2918888		Streptococcus_phage(33.33%)	8	NA	NA
WP_003593905.1|1443997_1444660_+	Ltp family lipoprotein	NA	A0A097BY93	Leuconostoc_phage	75.0	1.1e-08
WP_003564255.1|1444982_1445573_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	52.3	1.1e-52
WP_003569571.1|1445689_1446145_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003593901.1|1446530_1447478_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	40.7	9.2e-54
WP_003564250.1|1447482_1448511_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	51.2	2.3e-90
WP_003564248.1|1448507_1449395_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	31.4	1.1e-08
WP_003564246.1|1449557_1450097_-	DUF308 domain-containing protein	NA	NA	NA	NA	NA
WP_003564244.1|1450448_1453340_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.2	1.9e-307
>prophage 6
NZ_CP013921	Lacticaseibacillus paracasei strain KL1 chromosome, complete genome	2918888	1646300	1702079	2918888	tRNA,tail,integrase,capsid,transposase,head	Streptococcus_phage(23.08%)	57	1699740:1699799	1703121:1704004
WP_003569308.1|1646300_1647443_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.0	2.7e-84
WP_003593650.1|1647877_1648951_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_003583784.1|1649255_1650272_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	27.1	8.2e-08
WP_003563967.1|1650382_1650979_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_003563965.1|1651071_1651668_+	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	43.4	5.4e-36
WP_003563944.1|1651768_1652242_-	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_003569302.1|1652367_1653501_-	vitamin B12 independent methionine synthase	NA	A0A218MNE0	uncultured_virus	42.1	4.0e-72
WP_003662934.1|1653583_1653769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003563939.1|1653993_1654455_+	DUF3290 domain-containing protein	NA	NA	NA	NA	NA
WP_003563937.1|1654464_1655118_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_012491192.1|1655127_1655973_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016387054.1|1655969_1656875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016377393.1|1657134_1657959_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_003583770.1|1658102_1658576_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	NA	NA	NA	NA
WP_003593634.1|1658585_1659518_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003593632.1|1659639_1660098_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003563923.1|1660185_1660854_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_003563921.1|1660971_1662126_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_003583765.1|1662155_1662677_-	acetyltransferase	NA	NA	NA	NA	NA
WP_003563917.1|1662944_1663292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003574094.1|1663343_1664267_-	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_040166083.1|1664444_1666793_+	cation-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	26.0	9.7e-28
WP_003563911.1|1666897_1667347_+	nucleoside-diphosphate kinase	NA	A0A2K9L595	Tupanvirus	36.3	6.1e-16
WP_003595697.1|1667374_1668109_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003577841.1|1668399_1669644_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.6	8.8e-12
WP_003563904.1|1669838_1670189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016365566.1|1670334_1672146_+	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	41.0	1.7e-125
WP_012491183.1|1672306_1673899_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.9	1.6e-13
WP_003662915.1|1674032_1674989_+	Rgg/GadR/MutR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003662913.1|1675045_1675537_-	flavodoxin	NA	NA	NA	NA	NA
WP_040166604.1|1675810_1676308_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_003563892.1|1676352_1677339_-	AEC family transporter	NA	NA	NA	NA	NA
WP_016365565.1|1677342_1679010_-	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_003593587.1|1679460_1680336_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003569257.1|1680560_1681496_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_003563881.1|1681699_1682056_+	DUF488 family protein	NA	NA	NA	NA	NA
WP_003593584.1|1682063_1682624_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_003593583.1|1682718_1683627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003593579.1|1683888_1684506_+	flavin reductase family protein	NA	NA	NA	NA	NA
WP_003578002.1|1684528_1685476_+	AEC family transporter	NA	NA	NA	NA	NA
WP_003593577.1|1685489_1685963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003563873.1|1686091_1686718_-	transcriptional repressor LexA	NA	A0A1B2APZ3	Phage_Wrath	35.9	4.9e-11
WP_003563872.1|1686846_1687041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003563871.1|1687544_1688711_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_003593574.1|1688703_1689183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016376186.1|1689320_1689683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003593573.1|1689935_1690958_+	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_003563851.1|1691018_1691318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003563849.1|1691473_1691779_+	membrane protein	NA	NA	NA	NA	NA
WP_003563847.1|1691939_1692278_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003662896.1|1692295_1693336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040166609.1|1693837_1694776_+	bacteriophage abortive infection AbiH family protein	NA	NA	NA	NA	NA
WP_059219812.1|1694817_1695747_+|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW61	unidentified_phage	29.5	1.5e-19
WP_003593566.1|1696452_1696746_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_003662889.1|1696809_1698354_-|capsid	phage major capsid protein	capsid	B8R651	Lactobacillus_phage	26.0	3.6e-39
1699740:1699799	attL	ATAAGAGCCTGTTTAGTGTCTTTTGAGCATGAAGCGAAGAAAGGCTAACGTTATCATCAT	NA	NA	NA	NA
WP_108299274.1|1699751_1700551_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_003593518.1|1700927_1702079_+|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	32.0	1.4e-48
1703121:1704004	attR	ATAAGAGCCTGTTTAGTGTCTTTTGAGCATGAAGCGAAGAAAGGCTAACGTTATCATCATTGTACTAGTGTGAAGCTTGCGTTCGCAGTTTTTCCAGAGGCGACGGCATTTTTCTAGCCAGCCAAAGCTTCGCTCAATCACCCAACGTTGTGGGGTTACATGGCCATGCTTTAAATCACTTTGCTTGGCAATGATGACATCTGCACCGATGCTATTGCCAACTAAGCTGGCAAACTTATCTCCCGTATAGCCGCCGTCAACCATGATTCGCTGGACAAGGTCAAATTGATCTGCATGTAACATCAATAGCGAACTAGCAGCGTCACGATCAGATACGTCACCAGTGGTGACGTGAATTCCTTGGGGCAATCCTTGATTATCAACAGCTAATGTCCGTTTGATACCTTTAATCTTTTTGCCGCCATCATAACCTGAATTCTCTGCTGTGTCCGTGTTTTTAACACTTTGAGCATCCAGTATCAGGAACGAAGTTCTAGTTGACCGGCCTTGGCTAAATCGTAGGAAAGCGACAGTTTTTTTAAAACCCTGGTTAATAGGGCCATCTCGATTGGGTTCTCTTGTTTTGTCCAAAGCACCCAGTAATAATAAACAGTTTGCCACTTTGGAAAATCACTCGGGAGATCACGCCAAGTACACCCATTTTTCATGGTATACAGCATTGCACAAAAGACATCGTACAAATCAATTTGTCTTGGTGCAGTATGTTTCCGTGCATCTTCAAGATCAGCTCGAATGAGGTTAAATTGGTCACGCGTAATATCGCTACCATATCGATGGGTAAAAGTTCGCATAGTTAGCTCCAGTTTTTGTGCAAAGCATACCTGAAATTTAGCTATTCCGTAAAGACACTAAACAGGCTCTAA	NA	NA	NA	NA
>prophage 7
NZ_CP013921	Lacticaseibacillus paracasei strain KL1 chromosome, complete genome	2918888	1816897	1913214	2918888	integrase,transposase	Lactobacillus_phage(53.12%)	86	1859930:1859949	1912102:1912121
WP_123837385.1|1816897_1817818_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_016377437.1|1817976_1818801_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_003662787.1|1818848_1819397_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_016365907.1|1819649_1820444_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.7	1.6e-27
WP_016377440.1|1820430_1822158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016377441.1|1822325_1823300_+	EamA family transporter	NA	NA	NA	NA	NA
WP_040167495.1|1823375_1825397_-	WxL domain-containing protein	NA	NA	NA	NA	NA
WP_016365554.1|1825547_1826249_-	WxL domain-containing protein	NA	NA	NA	NA	NA
WP_016365555.1|1826232_1826592_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_003563543.1|1826743_1827445_-	WxL domain-containing protein	NA	NA	NA	NA	NA
WP_016383833.1|1828284_1829979_-	WxL domain-containing protein	NA	NA	NA	NA	NA
WP_003662777.1|1830002_1830281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003662776.1|1830277_1830655_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_003563532.1|1830635_1831655_-	DUF916 and DUF3324 domain-containing protein	NA	NA	NA	NA	NA
WP_014271905.1|1832090_1833011_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	4.0e-22
WP_003662772.1|1834533_1835922_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_003662771.1|1836194_1837106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003597676.1|1837932_1838646_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003662770.1|1838677_1839490_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003662769.1|1839591_1840728_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_155598336.1|1841401_1841686_+|transposase	transposase	transposase	Q6J1X3	Lactobacillus_phage	97.5	5.2e-37
WP_003587178.1|1842755_1843862_+	anion permease	NA	NA	NA	NA	NA
WP_019728331.1|1844159_1845176_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.4	2.4e-36
WP_016387891.1|1845288_1847184_-	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_016387892.1|1847183_1847660_-	PcfB family protein	NA	NA	NA	NA	NA
WP_016387893.1|1847678_1849202_-	DUF5011 domain-containing protein	NA	NA	NA	NA	NA
WP_032799885.1|1849225_1849492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003586951.1|1849503_1849782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003663214.1|1850463_1851327_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	30.5	2.4e-24
WP_014951815.1|1851372_1852314_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	28.2	3.1e-17
WP_003582147.1|1852247_1852976_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	40.1	7.6e-32
WP_076626284.1|1853005_1853338_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_010493173.1|1853457_1853793_-	ribonucleoside-diphosphate reductase	NA	A0A0N7IRA2	Lactobacillus_phage	90.6	6.8e-52
WP_003573729.1|1855325_1855544_+	CsbD family protein	NA	NA	NA	NA	NA
WP_016387895.1|1855739_1856738_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.5	3.3e-54
WP_076626284.1|1856846_1857179_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003582147.1|1857208_1857937_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	40.1	7.6e-32
WP_014951815.1|1857870_1858812_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	28.2	3.1e-17
WP_003663214.1|1858857_1859721_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	30.5	2.4e-24
1859930:1859949	attL	TGTTGCACTTGAATTGTAAA	NA	NA	NA	NA
WP_040167539.1|1860096_1860744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010493154.1|1861257_1861701_-	autolysin regulatory protein arpU	NA	A0A0P0IZI6	Lactobacillus_phage	97.3	1.2e-77
WP_016383959.1|1862215_1862548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003661650.1|1862617_1862905_-	hypothetical protein	NA	Q8LTA8	Lactobacillus_phage	75.8	8.1e-38
WP_003597560.1|1863654_1864077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003574016.1|1864123_1864642_-	exonuclease domain-containing protein	NA	NA	NA	NA	NA
WP_040167531.1|1864641_1865466_-	ATP-binding protein	NA	A0A0P0I3L9	Lactobacillus_phage	74.7	7.3e-116
WP_003589923.1|1865480_1866227_-	DnaD domain protein	NA	A0A0N7IRA7	Lactobacillus_phage	56.1	5.8e-35
WP_003661649.1|1866219_1866534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016376262.1|1866714_1867260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003572201.1|1867242_1867446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003572199.1|1867530_1867887_-	DUF771 domain-containing protein	NA	U5U4L9	Lactobacillus_phage	98.3	2.0e-62
WP_003572196.1|1867952_1868204_+	DUF1883 domain-containing protein	NA	NA	NA	NA	NA
WP_003572193.1|1868196_1868376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032775698.1|1868376_1869135_-	ORF6C domain-containing protein	NA	A0A1B0YEA7	Lactobacillus_phage	56.4	1.6e-40
WP_003572188.1|1869195_1870029_+	TIGR02391 family protein	NA	A0A1S5SBU1	Streptococcus_phage	37.8	2.8e-46
WP_003572187.1|1869999_1870200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003574003.1|1870241_1870490_-	hypothetical protein	NA	A0A0P0ID24	Lactobacillus_phage	97.5	2.7e-37
WP_003572184.1|1870733_1871087_+	helix-turn-helix transcriptional regulator	NA	A0A141E1M3	Streptococcus_phage	40.9	7.7e-14
WP_003572182.1|1871079_1871502_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0P0IJN5	Lactobacillus_phage	39.1	7.8e-21
WP_059219815.1|1871727_1872744_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.4	3.2e-36
WP_040167528.1|1872852_1873560_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_003572177.1|1873752_1873989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003586911.1|1873972_1874593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003573997.1|1874682_1874943_+	hypothetical protein	NA	B4XYT0	Lactobacillus_phage	40.7	2.5e-09
WP_003569067.1|1875055_1876225_+|integrase	site-specific integrase	integrase	Q6J1W6	Lactobacillus_phage	98.2	6.6e-219
WP_003661641.1|1876545_1877091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016376449.1|1877280_1878210_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	63.4	3.0e-105
WP_003573694.1|1878243_1879059_-	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_003573692.1|1879503_1880403_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_016365578.1|1880421_1881639_-	MFS transporter	NA	NA	NA	NA	NA
WP_016383682.1|1881924_1882821_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_003563502.1|1882917_1883751_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003661635.1|1883767_1884634_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_003661634.1|1884788_1885682_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	23.2	3.0e-06
WP_003661633.1|1885860_1886364_+	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_016383681.1|1886472_1887915_-	amino acid permease	NA	NA	NA	NA	NA
WP_040167523.1|1888435_1890970_-	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	27.7	1.3e-67
WP_040167521.1|1891475_1896746_+	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_003574021.1|1901254_1902175_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_003661627.1|1905242_1905782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016365384.1|1905810_1906959_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003661624.1|1906955_1907837_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.1	6.6e-22
WP_003661623.1|1907939_1909055_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_003661621.1|1909042_1909741_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.8	1.7e-28
WP_016365382.1|1910036_1911653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059219815.1|1912197_1913214_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.4	3.2e-36
1912102:1912121	attR	TTTACAATTCAAGTGCAACA	NA	NA	NA	NA
>prophage 8
NZ_CP013921	Lacticaseibacillus paracasei strain KL1 chromosome, complete genome	2918888	1949804	2002912	2918888	holin,transposase	unidentified_phage(25.0%)	44	NA	NA
WP_003574021.1|1949804_1950725_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_003661576.1|1951229_1951658_+	OsmC family protein	NA	NA	NA	NA	NA
WP_003563420.1|1952048_1953068_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_003661574.1|1953054_1953636_+	dihydroxyacetone kinase subunit L	NA	NA	NA	NA	NA
WP_003563416.1|1953685_1954054_+	PTS-dependent dihydroxyacetone kinase phosphotransferase subunit DhaM	NA	NA	NA	NA	NA
WP_003577796.1|1954138_1954702_+	TetR/AcrR family transcriptional regulator C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_003661572.1|1954937_1956632_+	oleate hydratase	NA	NA	NA	NA	NA
WP_003563408.1|1956778_1957759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016383542.1|1957878_1958895_-	linear amide C-N hydrolase	NA	M1H9I8	Acanthocystis_turfacea_Chlorella_virus	29.5	1.5e-22
WP_016376911.1|1959051_1959918_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003574021.1|1960664_1961585_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_003659803.1|1962647_1962836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040168309.1|1963097_1965830_+	YhgE/Pip domain-containing protein	NA	NA	NA	NA	NA
WP_076665317.1|1966155_1966278_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_003593027.1|1966795_1968505_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.5	8.0e-40
WP_003661564.1|1968497_1970309_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.8	3.9e-45
WP_080772365.1|1970491_1972177_-	alpha-glucosidase	NA	NA	NA	NA	NA
WP_003661560.1|1972169_1972586_-	PTS N-acetylglucosamine transporter subunit IIBC	NA	NA	NA	NA	NA
WP_016383539.1|1972675_1974919_-	alpha-glucosidase	NA	NA	NA	NA	NA
WP_016383538.1|1974948_1975800_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_003563385.1|1976645_1977137_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_003563383.1|1977188_1978196_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003563382.1|1978436_1978706_+	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
WP_016376163.1|1979021_1979840_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_003573580.1|1980203_1981574_+	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.0	4.8e-11
WP_003563376.1|1981735_1982425_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.4	3.3e-29
WP_003661554.1|1982429_1983491_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003583259.1|1983495_1983999_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003661553.1|1984209_1984977_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A075KJD2	Lactobacillus_phage	51.5	2.7e-48
WP_003661552.1|1984986_1985139_-	YvrJ family protein	NA	NA	NA	NA	NA
WP_003573566.1|1985213_1985744_-	DNA-directed RNA polymerase subunit sigma-24	NA	NA	NA	NA	NA
WP_003574021.1|1987202_1988123_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_003604355.1|1988895_1989582_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003563355.1|1989578_1990247_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003661546.1|1990261_1991140_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016377399.1|1991149_1991899_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.0	1.1e-25
WP_040166367.1|1991895_1992945_+	NAD/NADP octopine/nopaline dehydrogenase family protein	NA	NA	NA	NA	NA
WP_040166364.1|1993180_1994365_-	mannitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_003583219.1|1996416_1996980_-	6-phospho-3-hexuloisomerase	NA	NA	NA	NA	NA
WP_003563340.1|1996995_1997643_-	3-hexulose-6-phosphate synthase	NA	NA	NA	NA	NA
WP_003604345.1|1997816_1998578_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_003661539.1|1998615_1999278_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_003577841.1|1999540_2000785_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.6	8.8e-12
WP_049175116.1|2001895_2002912_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.4	9.3e-36
>prophage 9
NZ_CP013921	Lacticaseibacillus paracasei strain KL1 chromosome, complete genome	2918888	2155658	2177579	2918888	transposase	unidentified_phage(50.0%)	21	NA	NA
WP_041091334.1|2155658_2156579_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	37.1	6.9e-22
WP_003568911.1|2157280_2158696_-|transposase	IS5-like element ISLca2 family transposase	transposase	NA	NA	NA	NA
WP_016376044.1|2158895_2159405_+	DUF308 domain-containing protein	NA	NA	NA	NA	NA
WP_001748085.1|2159584_2160760_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_003601979.1|2160912_2161563_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	37.6	1.5e-18
WP_003662076.1|2161639_2162008_-	YxeA family protein	NA	NA	NA	NA	NA
WP_003662080.1|2164240_2164810_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025375932.1|2164817_2167763_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003597463.1|2167853_2168078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059219827.1|2168208_2168586_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_103152732.1|2168612_2169400_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_040166863.1|2169517_2169631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567989.1|2169826_2170348_-	YjbQ family protein	NA	NA	NA	NA	NA
WP_016366313.1|2170344_2171037_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_040166869.1|2171070_2171934_-	class II fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_003567994.1|2171933_2172236_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_040166872.1|2172311_2173649_-	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_040166876.1|2173761_2174241_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_040166878.1|2174246_2174660_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_040166881.1|2174637_2176122_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_155598331.1|2176792_2177579_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP013921	Lacticaseibacillus paracasei strain KL1 chromosome, complete genome	2918888	2209893	2391728	2918888	tRNA,protease,holin,bacteriocin,transposase	Lactobacillus_phage(19.05%)	162	NA	NA
WP_003561810.1|2209893_2210823_-|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW61	unidentified_phage	29.9	6.5e-20
WP_025376351.1|2212065_2213082_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.1	1.6e-35
WP_080687539.1|2213763_2214000_-	diadenosine tetraphosphatase	NA	NA	NA	NA	NA
WP_003573999.1|2214250_2215669_+|transposase	IS5-like element ISLrh3 family transposase	transposase	NA	NA	NA	NA
WP_059219831.1|2216257_2216818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025375985.1|2216948_2217869_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_003662132.1|2218988_2219597_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016366216.1|2219611_2220307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003573004.1|2220533_2222717_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	59.9	6.6e-257
WP_003662136.1|2223030_2223792_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_003573002.1|2223788_2224718_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	37.3	3.6e-34
WP_003562727.1|2224714_2224930_-	PLDc N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_003662139.1|2224996_2226118_-	helix-turn-helix transcriptional regulator	NA	Q6J1N3	Burkholderia_virus	43.8	6.5e-06
WP_016365941.1|2226583_2227462_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003662146.1|2227706_2230127_+	plasma-membrane proton-efflux P-type ATPase	NA	M1INF1	Acanthocystis_turfacea_Chlorella_virus	25.1	1.6e-41
WP_003562714.1|2230213_2230564_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003662151.1|2230658_2232518_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	34.8	2.9e-88
WP_003562710.1|2232825_2234121_-	adenylosuccinate synthase	NA	A0A285PX35	Cedratvirus	35.6	3.9e-63
WP_040168289.1|2234350_2235406_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_003562702.1|2239117_2239822_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.6	7.1e-35
WP_003662164.1|2239951_2240557_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016377027.1|2240659_2241529_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_040168286.1|2241765_2242695_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_080772363.1|2242681_2244673_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_003577321.1|2245139_2246303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003562690.1|2246368_2247757_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	52.6	1.6e-126
WP_003562688.1|2247999_2248455_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_003572989.1|2248470_2250477_-	DHH family phosphoesterase	NA	NA	NA	NA	NA
WP_003562682.1|2250788_2251088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059219833.1|2251295_2252312_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.1	5.4e-36
WP_040168285.1|2252375_2252954_-	phospholipase	NA	NA	NA	NA	NA
WP_003662174.1|2253376_2254243_-	DMT family transporter	NA	NA	NA	NA	NA
WP_016376019.1|2254235_2254649_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_003562673.1|2254936_2255314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003662178.1|2255509_2256568_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_040168282.1|2256571_2257579_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_016365269.1|2257580_2258960_-	aspartate kinase	NA	NA	NA	NA	NA
WP_003662183.1|2259673_2261020_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_003572973.1|2261030_2261735_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase	NA	NA	NA	NA	NA
WP_003604079.1|2261742_2262894_+	N-acetyldiaminopimelate deacetylase	NA	NA	NA	NA	NA
WP_003572968.1|2263037_2263943_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_003662186.1|2263939_2264707_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_003597024.1|2264856_2265126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016365270.1|2265088_2265487_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_059219835.1|2266668_2268084_-|transposase	IS5-like element ISLca2 family transposase	transposase	NA	NA	NA	NA
WP_003662190.1|2268503_2268818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016383813.1|2268896_2269583_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.2	9.4e-24
WP_025375985.1|2269969_2270890_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_003662202.1|2271553_2272786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016365987.1|2272986_2273709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040168278.1|2273692_2274067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032781125.1|2274188_2274767_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003662210.1|2276870_2277053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025376335.1|2277690_2278830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003662216.1|2279166_2279880_+	SMUG2 DNA glycosylase family protein	NA	NA	NA	NA	NA
WP_003572950.1|2280541_2281567_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	38.3	4.6e-59
WP_059219837.1|2281802_2282759_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.0	6.2e-50
WP_155598332.1|2282808_2283595_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011674296.1|2283965_2285468_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_003585300.1|2285568_2285922_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_016376041.1|2285896_2286094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040168062.1|2286306_2287986_-	alpha-glucosidase	NA	NA	NA	NA	NA
WP_040168060.1|2288012_2289350_-	SLC45 family MFS transporter	NA	NA	NA	NA	NA
WP_003592282.1|2289501_2290452_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_059219842.1|2291058_2291310_+|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	94.0	7.8e-37
WP_155598337.1|2291471_2292206_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	98.8	2.6e-136
WP_002816607.1|2292596_2293280_+|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	51.8	2.1e-60
WP_060611715.1|2293791_2294079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012537722.1|2294098_2294602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059219844.1|2294714_2295365_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	34.1	1.9e-18
WP_032785273.1|2295370_2295658_+	BRCT domain-containing protein	NA	NA	NA	NA	NA
WP_003663214.1|2296293_2297157_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	30.5	2.4e-24
WP_014951815.1|2297202_2298144_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	28.2	3.1e-17
WP_003582147.1|2298077_2298806_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	40.1	7.6e-32
WP_076626284.1|2298835_2299168_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080772353.1|2300094_2301102_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_052458386.1|2301193_2302894_-	alpha-glucosidase	NA	NA	NA	NA	NA
WP_040168045.1|2302883_2303303_-	PTS N-acetylglucosamine transporter subunit IIBC	NA	NA	NA	NA	NA
WP_052458385.1|2303319_2304171_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_040168043.1|2304163_2304952_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_040168041.1|2304998_2305484_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_155598333.1|2305795_2306582_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_021353390.1|2306958_2307048_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_040168038.1|2307514_2308864_+	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	50.1	2.7e-123
WP_071799104.1|2308905_2309100_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_014951815.1|2309332_2310274_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	28.2	3.1e-17
WP_003582147.1|2310207_2310936_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	40.1	7.6e-32
WP_025375985.1|2311127_2312048_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_155598334.1|2312776_2313564_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_003589800.1|2314141_2315020_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_016377085.1|2315140_2316874_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_016377086.1|2316900_2318325_+	6-phospho-beta-galactosidase	NA	NA	NA	NA	NA
WP_003589792.1|2318373_2318709_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_155598335.1|2319243_2320031_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_040167892.1|2320840_2321440_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_003662226.1|2321423_2322644_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_016366059.1|2322636_2323428_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_003662235.1|2324042_2324702_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_003662237.1|2324750_2325335_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_003592581.1|2325482_2325710_-	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_016383902.1|2325729_2327586_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	32.9	1.3e-67
WP_003662242.1|2327622_2327808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059219833.1|2328110_2329127_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.1	5.4e-36
WP_016365705.1|2329410_2330064_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_016365706.1|2330296_2330632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003662250.1|2330683_2331937_+|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	Q6GZ03	Mycoplasma_phage	43.0	1.5e-14
WP_003568628.1|2331939_2332569_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003562594.1|2332580_2333510_+	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003562592.1|2333509_2334172_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_040165901.1|2334384_2334645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003572929.1|2334895_2335498_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016365800.1|2338987_2339311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016365799.1|2339488_2340862_+	MFS transporter	NA	NA	NA	NA	NA
WP_003662262.1|2341198_2342791_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.5	1.1e-11
WP_003577278.1|2342882_2343758_+	Rgg/GadR/MutR family transcriptional regulator	NA	A0A1X9I6E0	Streptococcus_phage	26.6	2.3e-11
WP_003562576.1|2343946_2344267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016383971.1|2344331_2344688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081321790.1|2345207_2346050_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	98.9	3.9e-157
WP_002816285.1|2346103_2346355_-|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	96.4	9.2e-38
WP_003577243.1|2347236_2347848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040166958.1|2348020_2348653_-	membrane protein	NA	NA	NA	NA	NA
WP_016376913.1|2348847_2350290_-	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_003562540.1|2350530_2350890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003562527.1|2350965_2351310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016376914.1|2351532_2352909_-	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_003568509.1|2353137_2353776_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_040166961.1|2353824_2354718_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_003600709.1|2354841_2355447_-	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_003662284.1|2355623_2356397_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_003662286.1|2356453_2356774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003662288.1|2356778_2357585_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_016366194.1|2357628_2358180_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003568488.1|2358476_2359178_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.5	3.9e-33
WP_003662290.1|2359190_2361764_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003577228.1|2361967_2363203_+	CHAP domain-containing protein	NA	NA	NA	NA	NA
WP_011673935.1|2363726_2364029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003584064.1|2364241_2364637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016377058.1|2365033_2365717_+	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_016366383.1|2365794_2366010_-|bacteriocin	Blp family class II bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003662299.1|2366194_2366413_-|bacteriocin	Blp family class II bacteriocin	bacteriocin	NA	NA	NA	NA
WP_016383835.1|2366830_2367028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041091277.1|2367124_2368141_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.1	2.7e-35
WP_003662302.1|2368243_2369263_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016377483.1|2369255_2370734_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_003574021.1|2370863_2371784_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_003568467.1|2372230_2372467_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_003662304.1|2372553_2373150_-	single-stranded DNA-binding protein	NA	U5U726	Lactobacillus_phage	64.6	8.6e-50
WP_003568460.1|2373180_2373477_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_003662305.1|2373604_2374036_-	single-stranded DNA-binding protein	NA	A0A2I2MUI5	uncultured_Caudovirales_phage	46.9	8.2e-26
WP_003568456.1|2374218_2374923_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_040166696.1|2375027_2377649_-	DNA gyrase subunit A	NA	A0A172JHV7	Bacillus_phage	33.4	1.9e-112
WP_003662308.1|2377710_2379672_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	46.6	9.5e-146
WP_003662310.1|2379924_2381040_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_003568449.1|2381036_2381249_-	S4 domain-containing protein YaaA	NA	NA	NA	NA	NA
WP_003568447.1|2381826_2382966_-	DNA polymerase III subunit beta	NA	D0R7I4	Paenibacillus_phage	33.1	5.0e-14
WP_003568444.1|2383138_2384488_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_003568442.1|2385296_2385437_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_012492235.1|2385765_2386122_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_016365313.1|2386266_2387103_+	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_003572793.1|2387120_2387885_+	protein jag	NA	NA	NA	NA	NA
WP_003568424.1|2388396_2389785_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_003572790.1|2389826_2391728_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
>prophage 11
NZ_CP013921	Lacticaseibacillus paracasei strain KL1 chromosome, complete genome	2918888	2506327	2564375	2918888	transposase	Lactobacillus_phage(40.0%)	56	NA	NA
WP_108299274.1|2506327_2507127_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_003662443.1|2507450_2507951_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003662444.1|2507987_2508647_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003568143.1|2508819_2509074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003662448.1|2509244_2509565_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_016365311.1|2509644_2510394_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003662450.1|2510973_2511906_-	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
WP_040167090.1|2512008_2513076_+	hydrolase	NA	NA	NA	NA	NA
WP_040167093.1|2513403_2514240_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003568131.1|2514232_2515069_+	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_003568129.1|2515135_2515621_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_003585938.1|2515617_2516550_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_080772334.1|2516476_2517394_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_003662453.1|2517380_2518403_+	serine hydrolase	NA	NA	NA	NA	NA
WP_003662454.1|2518390_2519458_+	dipeptide epimerase	NA	NA	NA	NA	NA
WP_016365307.1|2519447_2520233_+	serine hydrolase	NA	NA	NA	NA	NA
WP_071798850.1|2520244_2520424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016365306.1|2520646_2525962_-	DUF5110 domain-containing protein	NA	NA	NA	NA	NA
WP_003662464.1|2526358_2527090_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_003662465.1|2527183_2527744_+	cysteine hydrolase	NA	G3MA16	Bacillus_virus	41.8	7.1e-30
WP_040168202.1|2527777_2529214_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	44.6	7.5e-100
WP_016376456.1|2529470_2530616_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	40.4	4.1e-16
WP_003662470.1|2530578_2531511_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_003568106.1|2531507_2532323_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_003568103.1|2532319_2533696_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003576828.1|2533862_2534276_+	arsenate reductase (thioredoxin)	NA	A0A2H4PQT9	Staphylococcus_phage	48.9	8.1e-31
WP_003662474.1|2535777_2536335_+	helix-turn-helix domain-containing protein	NA	A0A1B1P888	Bacillus_phage	44.1	5.8e-08
WP_003576821.1|2536357_2536585_+	DUF3923 family protein	NA	NA	NA	NA	NA
WP_003662475.1|2536793_2537111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003662476.1|2537324_2537828_-	isochorismatase family protein	NA	NA	NA	NA	NA
WP_003662478.1|2537941_2538421_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_025376083.1|2539068_2540709_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_070099153.1|2540844_2541687_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	99.3	8.8e-157
WP_002816285.1|2541740_2541992_-|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	96.4	9.2e-38
WP_003662483.1|2542269_2542959_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_003571790.1|2543386_2544457_+	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_003568036.1|2544594_2545053_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_040168183.1|2545072_2546593_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_003568032.1|2546623_2546917_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_003568031.1|2547033_2547675_+	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_003568030.1|2547704_2548484_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_003662486.1|2548673_2549543_+	L-ribulose-5-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_003568028.1|2549636_2550458_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_003568027.1|2550657_2551386_+	L-ribulose-5-phosphate 4-epimerase	NA	NA	NA	NA	NA
WP_016377428.1|2551638_2552439_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003662491.1|2554334_2554844_+	transcriptional regulator GutM	NA	NA	NA	NA	NA
WP_003568023.1|2554861_2555431_+	PTS glucitol/sorbitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_003662492.1|2555572_2556691_+	PTS glucitol/sorbitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_016376134.1|2556717_2557098_+	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_003662499.1|2557226_2557898_+	transaldolase	NA	C7BV14	Synechococcus_phage	23.2	1.3e-14
WP_003662501.1|2558420_2560292_+	transcription antiterminator	NA	NA	NA	NA	NA
WP_003662503.1|2560266_2560623_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003576723.1|2560802_2561162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002816285.1|2561451_2561703_+|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	96.4	9.2e-38
WP_081321792.1|2561756_2562518_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	99.2	7.2e-142
WP_003568911.1|2562959_2564375_-|transposase	IS5-like element ISLca2 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP013921	Lacticaseibacillus paracasei strain KL1 chromosome, complete genome	2918888	2811786	2895019	2918888	protease,tRNA,bacteriocin,transposase	unidentified_phage(36.84%)	82	NA	NA
WP_003567500.1|2811786_2812530_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_003663015.1|2812624_2813386_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003567496.1|2813665_2813887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016377405.1|2814059_2814770_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.8	6.3e-31
WP_003663019.1|2815909_2816521_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003567485.1|2816764_2817211_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_003567483.1|2817224_2817617_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_016377049.1|2817789_2818788_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.5	3.0e-55
WP_003567474.1|2818899_2819223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003574021.1|2819376_2820297_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_016383989.1|2820651_2821611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016366078.1|2821612_2821999_-	DUF2785 domain-containing protein	NA	NA	NA	NA	NA
WP_016366079.1|2821977_2822418_-	DUF2785 domain-containing protein	NA	NA	NA	NA	NA
WP_040167081.1|2823387_2824338_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.9	3.5e-13
WP_003661686.1|2824334_2825105_+	ABC-2 family transporter protein	NA	NA	NA	NA	NA
WP_016366322.1|2825108_2825888_+	ABC-2 family transporter protein	NA	NA	NA	NA	NA
WP_016383785.1|2826182_2826998_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_003661692.1|2826994_2827696_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	39.3	1.6e-31
WP_003574021.1|2827854_2828775_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_040167268.1|2828768_2829980_+	acyltransferase	NA	NA	NA	NA	NA
WP_003661694.1|2829936_2831469_+	AMP-binding protein	NA	Q75ZG1	Hepacivirus	30.3	2.0e-29
WP_003567455.1|2831458_2832433_+	aliphatic sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003567453.1|2832811_2833615_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_003661698.1|2833611_2834394_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_003567449.1|2834393_2835167_-	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.3	1.6e-24
WP_003567447.1|2835226_2836174_-	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003661700.1|2836555_2836816_-	2-phosphoglycerate dehydratase	NA	W6LP63	Streptococcus_phage	63.6	1.3e-10
WP_003567441.1|2837869_2838280_+	CrcB family protein	NA	NA	NA	NA	NA
WP_003661703.1|2838273_2838630_+	CrcB family protein	NA	NA	NA	NA	NA
WP_003574021.1|2839071_2839992_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_003574021.1|2841535_2842456_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_003567431.1|2844799_2844949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003661709.1|2845191_2846094_-	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_040167228.1|2846241_2848077_-	membrane protein	NA	NA	NA	NA	NA
WP_003574021.1|2848402_2849323_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_003599857.1|2849394_2849919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003574021.1|2850336_2851257_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_003567422.1|2851880_2852522_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003576335.1|2852760_2853678_-	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_040167226.1|2853878_2853998_+	putative metal homeostasis protein	NA	NA	NA	NA	NA
WP_003567416.1|2854086_2854356_+	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_016365630.1|2854556_2856023_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003567413.1|2856298_2857042_+	metal ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.9	1.1e-12
WP_003567411.1|2857038_2857935_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_003567408.1|2857931_2858873_+	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003599840.1|2858992_2859325_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003599837.1|2859345_2859984_-	cation transporter	NA	NA	NA	NA	NA
WP_003567401.1|2860112_2860304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040167223.1|2860430_2861960_+	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_003599833.1|2861999_2863373_+	MFS transporter	NA	NA	NA	NA	NA
WP_003580900.1|2863526_2863892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003603333.1|2864191_2866909_-	HAD-IC family P-type ATPase	NA	M1HJQ2	Paramecium_bursaria_Chlorella_virus	28.5	1.7e-60
WP_040167219.1|2867296_2868904_+	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_003599827.1|2869195_2869954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016365497.1|2870086_2871463_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_003661736.1|2871638_2872802_-	NADH-dependent flavin oxidoreductase	NA	NA	NA	NA	NA
WP_016365947.1|2872827_2873562_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_016376452.1|2873766_2874720_+	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	24.6	8.2e-10
WP_003603324.1|2874871_2875279_-	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_003661740.1|2875280_2875535_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016365949.1|2875686_2876283_+	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_040167217.1|2876401_2876737_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_016365872.1|2877050_2877242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003599808.1|2877493_2877826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003599805.1|2877941_2878100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052458376.1|2878338_2879196_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003567359.1|2879997_2880222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016365869.1|2880543_2880717_+|bacteriocin	ComC/BlpC family leader-containing pheromone/bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003599800.1|2880755_2880929_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003603311.1|2881202_2881442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059219833.1|2881873_2882890_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.1	5.4e-36
WP_003661762.1|2883180_2883378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040167212.1|2883739_2884546_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_032775417.1|2884550_2885669_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_003571414.1|2886037_2886175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128528263.1|2886518_2887397_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.0e-22
WP_040167206.1|2887695_2889888_+	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	26.7	8.1e-37
WP_016366046.1|2889898_2891278_+|bacteriocin	bacteriocin secretion accessory protein	bacteriocin	NA	NA	NA	NA
WP_003580849.1|2891873_2892185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016376391.1|2892490_2893846_+	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_003599758.1|2894432_2894717_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003567328.1|2894740_2895019_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
