The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013835	Escherichia coli strain JJ2434 chromosome, complete genome	5128614	929333	1039125	5128614	protease,integrase,plate,tail,terminase,transposase,holin,portal,tRNA,capsid,head	Enterobacteria_phage(42.11%)	130	1024723:1024738	1044044:1044059
WP_000520781.1|929333_929654_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|929684_931961_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_001040187.1|932645_932864_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241674.1|933148_933853_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202204.1|933894_935616_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	30.8	1.2e-14
WP_001043561.1|935616_937383_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_001385255.1|937505_938471_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.9e-62
WP_000228473.1|939014_939509_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000077041.1|939643_943750_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|943908_944520_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067797.1|944530_945874_+	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_000886683.1|945964_947257_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000078916.1|947562_947703_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_000488106.1|947894_948155_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000132830.1|948195_949305_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.9	1.3e-195
WP_000290462.1|950645_951158_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
WP_000651577.1|951213_951588_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	71.5	9.9e-36
WP_000333503.1|951596_951752_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000853410.1|951738_954546_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	90.1	0.0e+00
WP_000979945.1|954558_955047_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_000905061.1|955075_955675_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	98.9	3.8e-98
WP_032142265.1|955893_956451_+	hypothetical protein	NA	A0A0A7NPY7	Enterobacteria_phage	88.5	5.0e-84
WP_000972134.1|956453_956987_+|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	98.9	4.2e-96
WP_001554335.1|957015_957543_-|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	93.7	2.6e-90
WP_032140708.1|957544_959767_-|tail	tail fiber protein	tail	A0A0A7NV63	Enterobacteria_phage	65.0	3.8e-183
WP_000071703.1|959769_960300_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.2	3.6e-92
WP_001111954.1|960292_961189_-|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	3.3e-154
WP_001067543.1|961192_961522_-	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	99.1	8.4e-55
WP_001295912.1|961539_962106_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	98.4	6.6e-100
WP_000356366.1|962117_962753_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	4.1e-114
WP_000921127.1|962745_963213_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	95.5	3.5e-83
WP_000202148.1|963236_965114_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	80.2	2.7e-299
WP_000780577.1|965252_965648_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	93.3	1.0e-59
WP_000072341.1|965644_966037_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	96.9	1.9e-69
WP_001342221.1|966033_966357_-|holin	phage holin family protein	holin	A0A0A7NRY9	Enterobacteria_phage	93.5	1.7e-47
WP_000864901.1|966359_966560_-|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000063100.1|966559_967054_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	97.0	1.9e-87
WP_000632309.1|967155_967956_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	89.1	6.9e-127
WP_001055083.1|968001_969054_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	94.3	1.4e-188
WP_001262655.1|969077_969914_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.6	2.7e-150
WP_000613780.1|970068_971820_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	97.8	0.0e+00
WP_000087814.1|971819_972866_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	2.2e-202
WP_000236495.1|972880_973405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001068329.1|974128_974626_+	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
WP_000193205.1|974665_975508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000211282.1|975591_975906_-	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.3	4.1e-19
WP_000686485.1|975910_976870_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	4.2e-179
WP_000123489.1|976946_979769_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	98.4	0.0e+00
WP_000599382.1|979775_980141_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	97.5	1.7e-61
WP_023142408.1|980137_980755_-	ash family protein	NA	S5MQL6	Escherichia_phage	42.0	1.5e-09
WP_000104290.1|980766_981066_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.9	2.4e-40
WP_000153700.1|981062_981329_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	75.9	2.0e-30
WP_000985157.1|981325_981529_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000543036.1|981552_981963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021715.1|982056_982170_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	89.2	1.8e-09
WP_000514277.1|982166_982409_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000159455.1|982420_982699_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	79.3	3.1e-34
WP_000776267.1|982709_983060_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	93.1	8.1e-56
WP_001287828.1|983197_983389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000856387.1|983395_983818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204236.1|983822_984344_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001368591.1|984448_984790_+	helix-turn-helix transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	51.2	4.7e-16
WP_000023739.1|984859_985852_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	56.2	1.3e-103
WP_000850306.1|986151_988596_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
WP_000213098.1|988606_989224_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000534666.1|989225_990089_+	dimethyl sulfoxide reductase anchor subunit DmsC	NA	NA	NA	NA	NA
WP_000165876.1|990124_990751_-	hydrolase	NA	NA	NA	NA	NA
WP_000109283.1|991064_992213_+	MFS transporter	NA	NA	NA	NA	NA
WP_000111043.1|992309_993050_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
WP_001292822.1|993241_995524_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
WP_001295917.1|995578_996436_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_000194832.1|996841_998602_-	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_000642852.1|998731_999424_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_000057158.1|999622_1000711_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	2.7e-81
WP_000445240.1|1000781_1002065_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000904922.1|1002321_1002894_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	85.2	4.6e-85
WP_063269479.1|1002953_1003478_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	48.6	1.8e-35
WP_000072165.1|1003477_1004092_+|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	60.5	2.5e-60
WP_023142129.1|1004098_1004560_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	50.0	3.9e-34
WP_023363137.1|1004570_1005818_-|tail	tail fiber protein	tail	A0A0K2FIZ6	Escherichia_phage	43.7	2.0e-40
WP_000138756.1|1005820_1006399_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.8	1.7e-66
WP_001219098.1|1006391_1007495_-|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	55.2	1.4e-106
WP_000859111.1|1007485_1007833_-	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	62.4	5.9e-35
WP_000148266.1|1007887_1008484_-|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	45.2	3.2e-36
WP_000808007.1|1008480_1009635_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	47.6	1.9e-85
WP_000478224.1|1009622_1009835_-|tail	tail protein X	tail	Q6QIA3	Burkholderia_phage	57.1	1.2e-17
WP_000458387.1|1009834_1010719_-|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	47.9	6.8e-51
WP_000016538.1|1010718_1013670_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	29.9	9.8e-86
WP_001202894.1|1013745_1013904_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_000084213.1|1013827_1014163_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000110114.1|1014260_1014542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162832341.1|1014544_1015069_-|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	66.7	1.1e-67
WP_000729834.1|1015065_1016493_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A4JWK5	Burkholderia_virus	76.3	4.5e-214
WP_000666499.1|1016482_1016734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101804.1|1016733_1017198_-	Gp37 family protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
WP_000271668.1|1017197_1017644_-	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
WP_000537457.1|1017645_1017984_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_001286908.1|1017993_1018947_-	hypothetical protein	NA	A4JWK0	Burkholderia_virus	43.8	3.4e-64
WP_001273074.1|1018961_1020077_-	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.6	9.4e-98
WP_000135514.1|1020291_1020750_-	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	2.6e-30
WP_000117548.1|1020752_1021574_-|capsid	minor capsid protein	capsid	A4JWJ6	Burkholderia_virus	61.9	1.8e-98
WP_000090684.1|1021554_1023051_-	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.0	9.7e-167
WP_169542415.1|1023050_1024592_-	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.8	6.3e-185
WP_000124060.1|1024642_1025188_-	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
1024723:1024738	attL	CGGCGTTGCTGGCTGC	NA	NA	NA	NA
WP_000227701.1|1025187_1025499_-	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
WP_000175099.1|1025498_1025825_-	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	48.6	1.1e-17
WP_000264665.1|1025821_1026472_-	hypothetical protein	NA	J9SVN7	Pseudomonas_phage	32.9	2.8e-09
WP_001104440.1|1026455_1027196_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	51.4	2.5e-62
WP_000793146.1|1027198_1027549_-|holin	putative holin	holin	A4JWP3	Burkholderia_virus	53.0	1.5e-22
WP_000194951.1|1027679_1028408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295927.1|1028383_1028785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001069611.1|1028786_1029002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000783854.1|1029192_1029957_+	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	64.4	5.2e-100
WP_000031013.1|1030073_1030430_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000123378.1|1030523_1030712_+	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	71.0	3.9e-17
WP_000047759.1|1030764_1031073_+	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	55.9	2.7e-23
WP_000533817.1|1031083_1032004_+	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	56.2	1.6e-74
WP_001095645.1|1032003_1032321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000186588.1|1032336_1034106_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A4JWN2	Burkholderia_virus	69.4	1.5e-227
WP_000960679.1|1034116_1035283_+	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	59.4	2.2e-121
WP_000843446.1|1035285_1035555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001140136.1|1035582_1036113_+	host-nuclease inhibitor Gam family protein	NA	L7P7T1	Pseudomonas_phage	66.7	1.2e-58
WP_000632576.1|1036401_1036674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295929.1|1036683_1036980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763554.1|1036994_1037210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000132039.1|1037206_1037890_+	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	36.1	1.1e-32
WP_000631813.1|1037886_1038117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000206212.1|1038106_1038313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001170114.1|1038314_1038764_+	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	45.1	6.1e-24
WP_001281701.1|1038735_1039125_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	54.2	1.5e-31
1044044:1044059	attR	CGGCGTTGCTGGCTGC	NA	NA	NA	NA
>prophage 2
NZ_CP013835	Escherichia coli strain JJ2434 chromosome, complete genome	5128614	1250452	1296161	5128614	integrase,terminase,tail,lysis,holin,portal,tRNA,capsid,head	Enterobacteria_phage(56.0%)	58	1248770:1248784	1277364:1277378
1248770:1248784	attL	GCTGCCAGCGGGAAA	NA	NA	NA	NA
WP_001295972.1|1250452_1251559_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|1251612_1252074_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248677.1|1252083_1252737_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444487.1|1252908_1254159_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741335.1|1254272_1255415_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z02	Phage_21	100.0	3.6e-206
WP_000088653.1|1255404_1255641_-	excisionase	NA	NA	NA	NA	NA
WP_000490213.1|1255780_1256020_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.2	4.7e-39
WP_000002139.1|1256003_1256330_-	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	95.7	9.8e-48
WP_000763374.1|1256329_1256551_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	93.2	2.3e-32
WP_021533932.1|1256649_1256931_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	95.7	3.0e-45
WP_000548516.1|1256941_1257133_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	93.7	1.8e-25
WP_000149537.1|1257105_1257288_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.3	1.8e-27
WP_000186848.1|1257284_1257965_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_000100847.1|1257961_1258747_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995418.1|1258752_1259049_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	8.9e-48
WP_000233576.1|1259124_1259331_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000858975.1|1259926_1260616_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_001067458.1|1260720_1260951_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_001182900.1|1261020_1261560_+	toxin YdaT domain-containing protein	NA	K7PJT7	Enterobacteria_phage	67.0	2.6e-61
WP_000147894.1|1261556_1262576_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.1	8.8e-111
WP_000788794.1|1262572_1263274_+	replication protein P of bacteriophage	NA	M1FJ72	Enterobacteria_phage	97.0	1.5e-125
WP_022645049.1|1263523_1267789_+	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_000700202.1|1267825_1268869_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_072147164.1|1269218_1269320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053005.1|1269316_1269772_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	1.6e-59
WP_000224914.1|1269771_1269942_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774479.1|1269934_1270225_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	95.8	2.3e-48
WP_001099488.1|1270221_1270584_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	95.7	1.6e-59
WP_000971096.1|1270580_1270721_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	68.9	8.5e-09
WP_001097224.1|1270717_1271407_+	antiterminator Q	NA	I6PDF8	Cronobacter_phage	48.5	4.9e-57
WP_000544528.1|1271728_1272034_+|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001180486.1|1272020_1272497_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	94.9	7.3e-84
WP_001228695.1|1272713_1272896_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001298464.1|1272986_1273280_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
WP_000830178.1|1273760_1274087_+	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_000881610.1|1274293_1274476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000453620.1|1275039_1275585_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	6.8e-94
WP_001027261.1|1275559_1277485_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
1277364:1277378	attR	TTTCCCGCTGGCAGC	NA	NA	NA	NA
WP_000198149.1|1277481_1277688_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001295977.1|1277684_1279286_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	1.4e-309
WP_000123268.1|1279266_1280586_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.7	1.1e-230
WP_001295978.1|1280595_1280928_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063293.1|1280983_1282009_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.4	7.8e-192
WP_000158908.1|1282050_1282449_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	1.0e-62
WP_000753018.1|1282460_1282814_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.2e-61
WP_000985120.1|1282825_1283404_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	92.7	5.9e-80
WP_000683150.1|1283400_1283796_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	2.9e-70
WP_001295979.1|1283803_1284544_+|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	98.0	1.6e-130
WP_000479203.1|1284559_1284982_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	94.3	2.2e-68
WP_000459457.1|1284963_1285398_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840216.1|1285390_1287952_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	98.4	0.0e+00
WP_000847375.1|1287948_1288278_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	2.8e-58
WP_001152626.1|1288277_1288976_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.6	5.1e-134
WP_023146277.1|1288980_1289724_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	5.0e-148
WP_023149564.1|1289660_1290263_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	2.1e-88
WP_001531667.1|1290323_1293806_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.3	0.0e+00
WP_000290538.1|1293864_1295886_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0E3M0V5	Enterobacteria_phage	72.3	7.2e-181
WP_000654172.1|1295882_1296161_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	55.4	9.9e-25
>prophage 3
NZ_CP013835	Escherichia coli strain JJ2434 chromosome, complete genome	5128614	1354883	1362431	5128614	integrase,transposase	Stx2-converting_phage(33.33%)	11	1354844:1354857	1364127:1364140
1354844:1354857	attL	TCCGTTATTTCAGT	NA	NA	NA	NA
WP_001531625.1|1354883_1355153_-	helix-turn-helix domain-containing protein	NA	A0A0C4UQU0	Shigella_phage	58.7	3.4e-14
WP_000095786.1|1355274_1355763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063270541.1|1356117_1356510_+	DUF2787 family protein	NA	NA	NA	NA	NA
WP_000954131.1|1356629_1357091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000177770.1|1357092_1357545_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_023141324.1|1357591_1358521_+|integrase	site-specific integrase	integrase	A0A1B1P7C7	Bacillus_phage	28.5	4.4e-08
WP_000580009.1|1358507_1359122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001095671.1|1359344_1359542_+	AlpA family phage regulatory protein	NA	A0A1V0E8E5	Vibrio_phage	43.9	7.3e-06
WP_000422741.1|1360014_1360440_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|1360436_1360787_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080195.1|1360817_1362431_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
1364127:1364140	attR	ACTGAAATAACGGA	NA	NA	NA	NA
>prophage 4
NZ_CP013835	Escherichia coli strain JJ2434 chromosome, complete genome	5128614	1436662	1506377	5128614	protease,integrase,terminase,tail,transposase,portal,holin,capsid,head	Stx2-converting_phage(24.56%)	79	1432836:1432850	1438746:1438760
1432836:1432850	attL	ACTCCTTGTTCGGGA	NA	NA	NA	NA
WP_000113700.1|1436662_1437793_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|1437770_1438019_-	excisionase	NA	NA	NA	NA	NA
WP_016230610.1|1438083_1440555_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.0	5.7e-55
1438746:1438760	attR	ACTCCTTGTTCGGGA	NA	NA	NA	NA
WP_001090200.1|1440647_1440839_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449179.1|1440835_1441024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001171951.1|1441589_1441808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379589.1|1441967_1442123_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_000103687.1|1442395_1443112_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	42.0	1.7e-52
WP_000471549.1|1443161_1443377_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000693845.1|1443373_1443799_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095675.1|1443821_1444784_+	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	56.4	1.4e-70
WP_000788950.1|1444790_1445537_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.8	4.0e-113
WP_000450998.1|1445558_1446329_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	1.6e-80
WP_001151161.1|1446344_1446770_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	94.0	2.2e-63
WP_000150294.1|1446944_1447610_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_000018429.1|1447790_1448003_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	5.2e-26
WP_001329966.1|1448170_1448443_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	5.5e-12
WP_001265085.1|1448444_1449500_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.4	4.0e-90
WP_000140014.1|1449500_1449881_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.5	2.9e-35
WP_059219417.1|1449877_1450699_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	2.2e-80
WP_000917751.1|1450925_1451123_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	6.1e-29
WP_000024331.1|1451274_1452324_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.4	4.4e-198
WP_023142244.1|1453125_1453257_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	1.1e-05
WP_000871291.1|1453537_1453873_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_016230612.1|1454133_1455987_+	SASA family carbohydrate esterase	NA	Q08JA2	Stx2-converting_phage	90.3	0.0e+00
WP_000284510.1|1456137_1456353_+|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000193278.1|1456357_1456702_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.8e-37
WP_000369850.1|1456667_1456940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992071.1|1457045_1457579_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	4.8e-100
WP_032140280.1|1458133_1458220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012578895.1|1458441_1458627_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.4	2.7e-18
WP_000736382.1|1458712_1458928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000095741.1|1459126_1459327_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	98.5	4.3e-30
WP_000829185.1|1459368_1459734_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	93.4	2.5e-60
WP_000958366.1|1460024_1460588_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	92.0	1.6e-82
WP_001296023.1|1460584_1462246_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.7	0.0e+00
WP_000173031.1|1462309_1464247_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	100.0	0.0e+00
WP_001063099.1|1464291_1464513_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000267294.1|1464458_1467044_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	100.0	0.0e+00
WP_000125990.1|1467040_1467367_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_001007905.1|1467376_1467727_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|1467723_1468170_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|1468166_1468511_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275441.1|1468577_1469294_+	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	99.6	3.6e-127
WP_000710949.1|1469308_1469683_+|tail	phage tail assembly chaperone	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_001513217.1|1469778_1469988_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_000212991.1|1470035_1473278_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	91.6	0.0e+00
WP_000807937.1|1473270_1473612_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	95.6	9.0e-60
WP_001296027.1|1473611_1474310_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	97.4	5.8e-130
WP_000194730.1|1474320_1475064_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	4.3e-147
WP_061089814.1|1475009_1475642_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.6	3.0e-101
WP_059219418.1|1475984_1479458_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.6	0.0e+00
WP_001298859.1|1480098_1481640_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_001016257.1|1481654_1482401_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_023363168.1|1482862_1485688_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q858V4	Yersinia_virus	63.6	9.0e-04
WP_000972097.1|1485689_1486223_+|tail	tail fiber assembly protein	tail	A0A077SL44	Escherichia_phage	70.1	1.8e-67
WP_001164137.1|1486253_1486781_-|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	77.7	8.4e-73
WP_001513292.1|1486796_1487765_-	hypothetical protein	NA	A0A0F7LDR4	Escherichia_phage	38.8	6.5e-47
WP_001421220.1|1487890_1488073_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	95.0	1.4e-24
WP_000240999.1|1488271_1488940_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937495.1|1488996_1489266_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
WP_000251936.1|1489380_1489551_+	hypothetical protein	NA	A0A0U2RK60	Escherichia_phage	62.5	9.4e-10
WP_001348267.1|1489677_1490235_-	Rha family transcriptional regulator	NA	Q8H9L9	Vibrio_phage	63.8	4.2e-30
WP_001296031.1|1490231_1490507_-	ash family protein	NA	S5MQL6	Escherichia_phage	52.9	1.1e-10
WP_000443082.1|1490882_1491689_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209513.1|1491688_1492882_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001195273.1|1492893_1494252_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.9e-37
WP_000763535.1|1494255_1495851_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001194644.1|1495850_1497413_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|1497504_1497549_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285702.1|1497686_1498568_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|1498564_1499185_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001296033.1|1499212_1501108_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291206.1|1501320_1502196_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_000622024.1|1502365_1503388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001000715.1|1503397_1503706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001278898.1|1503762_1504353_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559273.1|1504349_1505108_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	4.4e-06
WP_000422062.1|1505327_1506377_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 5
NZ_CP013835	Escherichia coli strain JJ2434 chromosome, complete genome	5128614	2000600	2088845	5128614	integrase,plate,tail,terminase,portal,holin,tRNA,capsid,transposase	Escherichia_phage(23.26%)	102	2046297:2046356	2088907:2089031
WP_099156422.1|2000600_2001949_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	8.7e-74
WP_000568520.1|2002058_2003069_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580323.1|2003077_2003689_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_072093883.1|2003827_2003893_-	stress response small protein YobI	NA	NA	NA	NA	NA
WP_001024911.1|2003963_2004566_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|2004567_2005089_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_000907234.1|2005123_2005864_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_077249130.1|2005892_2006345_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001258676.1|2006337_2008110_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000891625.1|2008419_2008986_+	hydrolase	NA	NA	NA	NA	NA
WP_000639277.1|2008982_2009801_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
WP_000252980.1|2009853_2010249_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_000019588.1|2010289_2011033_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000564759.1|2011029_2012001_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000176764.1|2012036_2014466_-	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_001214293.1|2014490_2015591_-	NapC/NirT family cytochrome c	NA	NA	NA	NA	NA
WP_001185734.1|2015978_2016725_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001490174.1|2016738_2017305_-	VOC family protein	NA	NA	NA	NA	NA
WP_001025326.1|2017520_2019254_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
WP_001202076.1|2019306_2019699_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_000066973.1|2019698_2021777_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001278946.1|2021769_2022918_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000983600.1|2023106_2023751_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763867.1|2023761_2024151_-	chemotaxis response regulator CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036371.1|2024165_2025215_-	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204320.1|2025217_2026078_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_001296146.1|2026368_2028030_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_000147302.1|2028174_2028678_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001531763.1|2028698_2030663_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795641.1|2030667_2031594_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000906342.1|2031590_2032478_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|2032604_2033183_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001295647.1|2033185_2033536_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122413.1|2034315_2034744_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001296148.1|2034750_2036175_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001296149.1|2036149_2036950_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_059219421.1|2037116_2038103_-	arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001187827.1|2038117_2039632_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.7	1.3e-12
WP_000548680.1|2039701_2040691_-	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_000179469.1|2041485_2041989_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000082127.1|2042066_2042318_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|2042432_2042519_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_001237881.1|2042782_2043106_+	YecR-like lipofamily protein	NA	NA	NA	NA	NA
WP_000917208.1|2043277_2043775_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377224.1|2043812_2044052_-	YecH family protein	NA	NA	NA	NA	NA
WP_000797555.1|2044242_2045454_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847882.1|2045504_2046170_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
2046297:2046356	attL	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTA	NA	NA	NA	NA
WP_001296152.1|2046641_2047061_-	hypothetical protein	NA	G8C7Q7	Escherichia_phage	68.8	1.8e-49
WP_001531767.1|2048275_2048500_-|tail	tail protein X	tail	NA	NA	NA	NA
WP_001531768.1|2048661_2049051_-|tail	phage tail protein	tail	E5FFG4	Burkholderia_phage	37.9	1.0e-14
WP_001018353.1|2049086_2050727_-	hypothetical protein	NA	A0A2I7R3J9	Vibrio_phage	29.3	1.2e-19
WP_000444667.1|2050835_2051117_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000785563.1|2051129_2051642_-|tail	phage major tail tube protein	tail	NA	NA	NA	NA
WP_000117510.1|2051659_2053162_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	R9TMQ0	Vibrio_phage	33.5	5.5e-69
WP_000626358.1|2053158_2053548_-	hypothetical protein	NA	A0A2H4EXG4	Aeromonas_phage	30.8	9.4e-05
WP_000829621.1|2053547_2054732_-|tail	phage tail protein	tail	J9QDX3	Clostridium_phage	35.2	2.5e-16
WP_000203868.1|2054724_2055351_-|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	38.8	2.0e-25
WP_000633314.1|2055353_2056274_-|plate	baseplate J/gp47 family protein	plate	D5LGZ3	Escherichia_phage	47.8	6.4e-68
WP_000901289.1|2056270_2056612_-	GPW/gp25 family protein	NA	D4HTV2	Vibrio_phage	51.6	1.1e-20
WP_000079174.1|2056614_2057517_-|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_000015612.1|2057497_2058034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774516.1|2058030_2058711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001531773.1|2058742_2059123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000105179.1|2059119_2059539_-	DNA-packaging protein	NA	NA	NA	NA	NA
WP_001283997.1|2059573_2060608_-|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	56.5	6.6e-106
WP_000206292.1|2060666_2060996_-	hypothetical protein	NA	A0A2R9YJN3	Escherichia_phage	39.5	2.0e-08
WP_001145892.1|2060995_2062303_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	4.9e-106
WP_000126513.1|2062302_2063877_-|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	64.0	8.6e-190
WP_000203897.1|2063873_2064107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000148195.1|2064106_2065969_-|terminase	phage terminase large subunit family protein	terminase	A0A1I9KF19	Aeromonas_phage	53.2	1.1e-191
WP_000168117.1|2065955_2066522_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	46.2	2.9e-31
WP_001531775.1|2066890_2067136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000734931.1|2067195_2067390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000131873.1|2067397_2067877_-	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	68.8	4.6e-62
WP_000172496.1|2067876_2068149_-|holin	phage holin family protein	holin	A0A0A0YPY6	Escherichia_phage	42.9	9.8e-09
WP_001294589.1|2068148_2068532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000064384.1|2068644_2069316_-	antitermination protein	NA	Q7Y3X2	Yersinia_phage	33.5	1.9e-16
WP_000717783.1|2069315_2069609_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	70.5	3.3e-34
WP_000057010.1|2069605_2070202_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	64.1	1.5e-70
WP_001025459.1|2070279_2070459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000847617.1|2070610_2071252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000536919.1|2071495_2071729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000224749.1|2072127_2072616_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A142KB62	Gordonia_phage	42.7	6.4e-27
WP_001138663.1|2072625_2073231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001237642.1|2075578_2076502_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_001531776.1|2076676_2077465_-	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	69.8	1.1e-39
WP_000661082.1|2078146_2078371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000875806.1|2078367_2078679_-	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	65.7	1.2e-34
WP_000918616.1|2078675_2078912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000214056.1|2078913_2079324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000609322.1|2079362_2080778_-	AAA family ATPase	NA	H9C165	Pectobacterium_phage	66.7	6.6e-173
WP_001023813.1|2080767_2081523_-	hypothetical protein	NA	H9C164	Pectobacterium_phage	68.5	2.4e-41
WP_000943914.1|2081519_2081744_-	hypothetical protein	NA	H9C163	Pectobacterium_phage	54.1	6.1e-17
WP_000431205.1|2081783_2082260_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	48.6	1.9e-23
WP_000360804.1|2082318_2082549_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	63.2	1.5e-21
WP_001296165.1|2082647_2083061_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	49.1	8.7e-09
WP_000388260.1|2084071_2084392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000151806.1|2084422_2086639_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	35.6	4.7e-101
WP_000100753.1|2086635_2087205_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	49.2	6.1e-37
WP_000916334.1|2087204_2087387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000833838.1|2087596_2087860_+	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	38.0	1.2e-06
WP_001531780.1|2087828_2088845_+|integrase	tyrosine-type recombinase/integrase	integrase	H9C152	Pectobacterium_phage	63.6	1.1e-126
2088907:2089031	attR	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTATCTTTCCCATGGTACCCGGAGCGGGACTTGAACCCGCACAGCGCGAACGCCGAGGGATTTTAAAT	NA	NA	NA	NA
>prophage 6
NZ_CP013835	Escherichia coli strain JJ2434 chromosome, complete genome	5128614	2107089	2185222	5128614	protease,integrase,terminase,tail,head,portal,holin,capsid,transposase	Escherichia_phage(41.07%)	95	2141865:2141880	2208223:2208238
WP_001347174.1|2107089_2107614_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.0	2.2e-33
WP_000879824.1|2107770_2108568_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001310919.1|2108577_2109129_-	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_001070440.1|2109297_2109630_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001274299.1|2109973_2110288_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_000994425.1|2110502_2112161_+	flagellar M-ring protein FliF	NA	NA	NA	NA	NA
WP_000067950.1|2112153_2113149_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_001282677.1|2113141_2113828_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000213308.1|2113827_2115201_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_000807584.1|2115219_2115663_+	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000620069.1|2115659_2116787_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000133106.1|2116891_2117356_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_001295641.1|2117360_2118365_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_001282103.1|2118361_2118775_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_001313947.1|2118777_2119143_+	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001253318.1|2119142_2119880_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_000187358.1|2119889_2120159_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_000983988.1|2120167_2120953_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000103992.1|2121242_2121866_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_000867217.1|2121909_2122098_-	protein DsrB	NA	NA	NA	NA	NA
WP_000844800.1|2122260_2122488_+	peroxide/acid resistance protein YodD	NA	NA	NA	NA	NA
WP_000491527.1|2122783_2123599_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_001531784.1|2123595_2125290_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
WP_000009307.1|2125460_2125643_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_032179065.1|2125721_2126639_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212226.1|2126811_2127732_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000228686.1|2127720_2128191_-	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	48.3	5.2e-34
WP_001157265.1|2128171_2129590_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.1	1.0e-101
WP_001296176.1|2129656_2130352_-	phosphohydrolase	NA	S4W232	Pandoravirus	28.7	1.6e-07
WP_001330593.1|2130391_2130757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824383.1|2131322_2132438_+	porin	NA	Q1MVN1	Enterobacteria_phage	47.4	2.9e-91
WP_000218217.1|2133030_2133882_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000826711.1|2133989_2135348_-	two-component system sensor histidine kinase HprS	NA	NA	NA	NA	NA
WP_001347103.1|2135347_2136019_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_000920127.1|2136151_2136565_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_000740067.1|2136673_2137678_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_001240063.1|2137678_2138314_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_099156434.1|2138397_2139746_-|transposase	IS3-like element IS1397 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.3e-74
WP_001007778.1|2140006_2140657_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_000355363.1|2141740_2142028_-	hypothetical protein	NA	NA	NA	NA	NA
2141865:2141880	attL	TGCCCGAACATTTCGA	NA	NA	NA	NA
WP_000235978.1|2142038_2142743_-|tail	tail fiber domain-containing protein	tail	A0A1X7QGH6	Escherichia_phage	61.7	4.6e-58
WP_000654141.1|2142752_2143034_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	47.8	1.6e-17
WP_001554173.1|2143033_2145412_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A1X7QGG5	Escherichia_phage	76.1	1.9e-185
WP_000526135.1|2145532_2145991_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	2.9e-13
WP_001228252.1|2146187_2146787_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	92.5	3.4e-102
WP_001554175.1|2146854_2150250_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	88.6	0.0e+00
WP_000741570.1|2150310_2150958_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.2	6.6e-112
WP_000140743.1|2150855_2151599_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	4.1e-150
WP_001152448.1|2151604_2152303_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	94.8	3.8e-129
WP_001330090.1|2152302_2152659_-|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
WP_000224009.1|2152636_2155864_-|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.7	0.0e+00
WP_000978930.1|2155910_2156189_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	97.8	3.6e-43
WP_000164661.1|2156212_2156584_-|tail	phage tail assembly chaperone	tail	A0A1B5FP91	Escherichia_phage	100.0	6.5e-64
WP_000097526.1|2156598_2157303_-	immunoglobulin domain-containing protein	NA	A0A1B5FP82	Escherichia_phage	94.4	3.7e-116
WP_001206306.1|2157363_2157708_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	97.4	1.4e-55
WP_000347792.1|2157704_2158151_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	80.4	3.9e-63
WP_001147814.1|2158150_2158489_-|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	90.2	7.5e-51
WP_000719066.1|2158497_2158815_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	50.5	6.2e-23
WP_000766111.1|2158891_2160109_-|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.6	4.5e-162
WP_000999828.1|2160123_2160723_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	81.0	1.9e-89
WP_000923132.1|2160715_2161942_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	82.6	1.5e-202
WP_000811487.1|2161931_2162093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001140907.1|2162089_2163847_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	98.9	0.0e+00
WP_001554177.1|2163846_2164329_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	96.9	7.4e-84
WP_001135103.1|2164476_2164827_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	97.4	4.7e-64
WP_000738421.1|2165352_2165646_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_075202333.1|2165736_2165919_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	77.0	2.2e-17
WP_000992101.1|2166135_2166669_-	lysozyme	NA	Q08J98	Stx2-converting_phage	93.8	1.1e-99
WP_000193269.1|2166732_2167083_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.9e-36
WP_000372595.1|2167087_2167303_-|holin	class II holin family protein	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
WP_000874243.1|2167610_2167799_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	95.2	7.2e-27
WP_023281677.1|2168058_2168394_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_000562553.1|2168674_2168806_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	3.7e-06
WP_021538919.1|2169701_2170523_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.2	1.5e-76
WP_000139998.1|2170537_2170900_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	9.6e-36
WP_001296186.1|2170900_2171959_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.7	7.5e-89
WP_023141427.1|2171960_2172233_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.8	4.2e-12
WP_000813254.1|2172400_2172556_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000753060.1|2173477_2173654_-	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	94.8	6.7e-27
WP_001224667.1|2173646_2173829_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	96.7	2.0e-26
WP_001296187.1|2173922_2174279_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	3.9e-58
WP_001151210.1|2174336_2174759_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	1.3e-63
WP_000095675.1|2174799_2175762_-	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	56.4	1.4e-70
WP_000693943.1|2175784_2176210_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000391951.1|2176193_2176475_-	helix-turn-helix domain-containing protein	NA	K7PHA1	Enterobacteria_phage	72.6	6.5e-24
WP_000362153.1|2176575_2176995_+	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_000379575.1|2177260_2177416_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001171947.1|2177575_2177794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000854558.1|2178361_2178550_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001070254.1|2178546_2178738_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_023363203.1|2178830_2181302_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.9	3.8e-59
WP_000096342.1|2181360_2181564_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533615.1|2181563_2182589_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.9	3.4e-102
WP_001311896.1|2182824_2183622_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000060157.1|2183959_2185222_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	38.5	2.6e-72
2208223:2208238	attR	TGCCCGAACATTTCGA	NA	NA	NA	NA
>prophage 7
NZ_CP013835	Escherichia coli strain JJ2434 chromosome, complete genome	5128614	2271759	2278211	5128614	transposase	Acidithiobacillus_phage(16.67%)	9	NA	NA
WP_001298859.1|2271759_2273301_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_001016257.1|2273315_2274062_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_000846703.1|2274510_2274921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001542275.1|2275141_2275960_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.6	8.8e-45
WP_001164966.1|2275959_2276205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001542276.1|2276298_2276772_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.1	4.3e-12
WP_001186200.1|2276787_2277264_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692345.1|2277326_2277548_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_000086752.1|2277566_2278211_+	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	32.9	1.8e-24
>prophage 8
NZ_CP013835	Escherichia coli strain JJ2434 chromosome, complete genome	5128614	2309014	2315317	5128614		Enterobacteria_phage(66.67%)	6	NA	NA
WP_001100793.1|2309014_2309557_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	61.8	6.0e-50
WP_000857525.1|2309561_2310440_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	6.6e-107
WP_001023641.1|2310497_2311397_-	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	34.8	1.7e-28
WP_000699407.1|2311396_2312482_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	8.8e-101
WP_000183040.1|2312854_2313748_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	3.0e-46
WP_001116066.1|2313922_2315317_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.0	6.3e-19
>prophage 9
NZ_CP013835	Escherichia coli strain JJ2434 chromosome, complete genome	5128614	2362035	2402292	5128614	integrase,plate,tail,terminase,lysis,holin,portal,tRNA,capsid,head	Escherichia_phage(43.48%)	51	2365632:2365650	2409420:2409438
WP_000675176.1|2362035_2363439_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.8	7.0e-34
WP_000137877.1|2363435_2364158_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_000929408.1|2364337_2364670_+	YegP family protein	NA	NA	NA	NA	NA
WP_000476014.1|2364816_2366178_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
2365632:2365650	attL	CGCCCATGTTGAACGCCTG	NA	NA	NA	NA
WP_000468308.1|2366450_2366669_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000887625.1|2366750_2367914_-	phage late control D family protein	NA	A0A0F7LDZ2	Escherichia_phage	99.0	1.2e-204
WP_000978916.1|2367913_2368393_-|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	98.7	2.5e-84
WP_001600133.1|2368407_2370855_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	99.1	0.0e+00
WP_000785970.1|2370847_2370967_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001599803.1|2370999_2371275_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	97.8	6.3e-40
WP_052922117.1|2371331_2371850_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	98.3	4.6e-92
WP_001286716.1|2371862_2373053_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	100.0	1.6e-225
WP_023908562.1|2373131_2373299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001599801.1|2373487_2374567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001516655.1|2374895_2375474_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	65.4	6.8e-68
WP_001599800.1|2375473_2378092_-|tail	phage tail protein	tail	Q858V4	Yersinia_virus	73.0	3.4e-284
WP_001285323.1|2378102_2378633_-|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	99.4	1.3e-102
WP_001121473.1|2378625_2379534_-|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	99.7	2.6e-162
WP_000127164.1|2379538_2379886_-	GPW/gp25 family protein	NA	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
WP_001599799.1|2379882_2380518_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.6	2.6e-113
WP_001599798.1|2380601_2381387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001599797.1|2381458_2381911_-	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	97.3	1.3e-74
WP_001599796.1|2381903_2382371_-|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	98.1	9.7e-81
WP_001300730.1|2382333_2382507_-	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_059219424.1|2382478_2382904_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7L9Y0	Escherichia_phage	94.3	1.5e-64
WP_032153534.1|2382891_2383317_-	hypothetical protein	NA	U5N096	Enterobacteria_phage	94.3	2.8e-58
WP_001144101.1|2383331_2383829_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123123.1|2383828_2384110_-|holin	phage holin family protein	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_000846409.1|2384113_2384317_-|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_000988633.1|2384316_2384826_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000203439.1|2384924_2385668_-|terminase	terminase endonuclease subunit	terminase	Q94MK6	Enterobacteria_phage	98.4	8.6e-124
WP_059219425.1|2385671_2386745_-|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	99.4	7.4e-201
WP_001601069.1|2386803_2387658_-|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	88.0	2.7e-137
WP_000156861.1|2387831_2389604_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_001600135.1|2389603_2390638_+|portal	phage portal protein	portal	Q858W8	Yersinia_virus	98.8	3.9e-199
WP_032179103.1|2391056_2391998_+	hypothetical protein	NA	Q2P9W7	Enterobacteria_phage	81.2	2.7e-146
WP_072164333.1|2392070_2392223_-	meiotically up-regulated 80 protein	NA	Q2P9X3	Enterobacteria_phage	89.8	1.7e-18
WP_023136039.1|2392317_2392998_-	hypothetical protein	NA	Q2P9W8	Enterobacteria_phage	99.1	4.6e-124
WP_001547483.1|2393025_2393217_-	DUF2158 domain-containing protein	NA	Q2P9W9	Enterobacteria_phage	100.0	3.2e-30
WP_032179106.1|2393343_2395629_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	98.7	0.0e+00
WP_001541416.1|2396630_2396912_-	DUF5405 family protein	NA	S4TP00	Salmonella_phage	71.4	3.6e-30
WP_001113270.1|2396908_2397133_-	TraR/DksA family transcriptional regulator	NA	A0A0F7LDI3	Escherichia_phage	98.6	3.8e-35
WP_001277957.1|2397132_2397435_-	DUF5405 family protein	NA	A0A0F7LDT6	Escherichia_phage	99.0	2.2e-46
WP_000557703.1|2397434_2397659_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_000217677.1|2397722_2398223_-	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	100.0	4.5e-92
WP_001005162.1|2398219_2398390_-	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
WP_001081582.1|2398400_2398676_-	regulatory phage cox family protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
WP_000020919.1|2398797_2399097_+	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
WP_000985261.1|2399212_2400226_+|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.1	4.1e-193
WP_001531820.1|2400660_2400978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807341.1|2401392_2402292_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.5	5.7e-13
2409420:2409438	attR	CGCCCATGTTGAACGCCTG	NA	NA	NA	NA
>prophage 10
NZ_CP013835	Escherichia coli strain JJ2434 chromosome, complete genome	5128614	2443476	2452921	5128614		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292786.1|2443476_2444613_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	96.7	6.1e-161
WP_001296230.1|2444609_2446613_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001296231.1|2446737_2447199_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001295430.1|2447239_2447710_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|2447756_2448476_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2448472_2450158_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240408.1|2450379_2451111_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.5	6.3e-111
WP_001216963.1|2451170_2451278_+	protein YohO	NA	NA	NA	NA	NA
WP_000783109.1|2451258_2451990_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569347.1|2451994_2452921_-	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	2.6e-08
>prophage 11
NZ_CP013835	Escherichia coli strain JJ2434 chromosome, complete genome	5128614	3029512	3036652	5128614		Escherichia_phage(83.33%)	6	NA	NA
WP_000103863.1|3029512_3032074_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	1.6e-31
WP_001141293.1|3032179_3032836_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.1	3.3e-50
WP_001296319.1|3032886_3033654_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	9.7e-70
WP_000847996.1|3033849_3034758_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.2	1.9e-117
WP_000590411.1|3034754_3036017_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_001279004.1|3036013_3036652_+	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.4e-82
>prophage 12
NZ_CP013835	Escherichia coli strain JJ2434 chromosome, complete genome	5128614	3285919	3348009	5128614	protease,integrase,lysis,tRNA,transposase	Staphylococcus_phage(50.0%)	52	3287128:3287145	3347406:3347423
WP_001296354.1|3285919_3286678_+|protease	metalloprotease LoiP	protease	NA	NA	NA	NA
WP_000105562.1|3287107_3288028_-	agmatinase	NA	NA	NA	NA	NA
3287128:3287145	attL	CCTGAATATACAGCATCT	NA	NA	NA	NA
WP_000758881.1|3288163_3288895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295380.1|3289040_3291017_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_001297406.1|3291025_3291157_-	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_001331575.1|3291292_3291508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001062128.1|3291811_3292966_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
WP_001112301.1|3293401_3294796_+	galactose/proton symporter	NA	NA	NA	NA	NA
WP_001296359.1|3294872_3295370_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_000286500.1|3295464_3296172_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001222509.1|3296251_3296983_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000593274.1|3296995_3297946_+	glutathione synthase	NA	NA	NA	NA	NA
WP_001053178.1|3298054_3298618_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000017111.1|3298617_3299034_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001296360.1|3299148_3300129_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000997795.1|3300146_3300851_+	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001094831.1|3300868_3301435_+	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_001277229.1|3301431_3301722_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174754.1|3301729_3302323_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_000239963.1|3302315_3303452_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_000783999.1|3303766_3304753_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000577034.1|3304797_3305301_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_000378955.1|3305300_3306602_+	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_000745240.1|3306657_3307665_-	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000394132.1|3307781_3308828_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000984796.1|3309003_3309723_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_001296361.1|3309743_3309884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001107566.1|3309906_3310233_-	YggL family protein	NA	NA	NA	NA	NA
WP_000786911.1|3310232_3310952_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001296362.1|3311112_3312165_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000091700.1|3312192_3312468_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_000760323.1|3312532_3313612_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_001296363.1|3313813_3315070_+	nucleoside permease NupG	NA	NA	NA	NA	NA
WP_000839781.1|3315118_3317254_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_000234526.1|3317646_3318354_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_001218869.1|3318732_3319998_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.1	2.1e-77
WP_000147017.1|3320253_3321297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001774069.1|3322990_3323542_-	HTH-type transcriptional regulator PapX	NA	NA	NA	NA	NA
WP_000006213.1|3326033_3326267_+	major pilus subunit operon transcriptional regulator PapI	NA	NA	NA	NA	NA
WP_001513409.1|3328134_3328248_-|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_001110186.1|3330081_3330342_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000109147.1|3330383_3330944_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001296373.1|3330983_3331412_+	DUF417 family protein	NA	NA	NA	NA	NA
WP_000074472.1|3332129_3333323_-	MFS transporter	NA	NA	NA	NA	NA
WP_001296374.1|3333458_3335183_+	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_001287500.1|3335183_3336131_+	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_001015715.1|3336130_3337873_+	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_000750130.1|3337869_3339147_+	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_000973516.1|3339228_3341430_+	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_011076574.1|3341980_3342124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001034083.1|3342373_3346261_+|protease	serine protease autotransporter toxin Sat	protease	Q9LA58	Enterobacterial_phage	39.0	1.2e-227
WP_001254932.1|3346857_3348009_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
3347406:3347423	attR	CCTGAATATACAGCATCT	NA	NA	NA	NA
>prophage 13
NZ_CP013835	Escherichia coli strain JJ2434 chromosome, complete genome	5128614	3354762	3362259	5128614	transposase	Stx2-converting_phage(50.0%)	6	NA	NA
WP_001223344.1|3354762_3356853_-	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
WP_000422741.1|3357246_3357672_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|3357668_3358019_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080195.1|3358049_3359663_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_096928816.1|3359892_3361121_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	94.4	7.2e-168
WP_000274668.1|3361272_3362259_-	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	57.7	4.0e-108
>prophage 14
NZ_CP013835	Escherichia coli strain JJ2434 chromosome, complete genome	5128614	4439491	4537000	5128614	protease,integrase,terminase,tail,plate,transposase,lysis,portal,holin,tRNA,capsid,head	Escherichia_phage(34.69%)	104	4468563:4468609	4500486:4500532
WP_000560981.1|4439491_4439929_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_001297068.1|4439973_4440915_+	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_001385591.1|4440978_4441887_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000897302.1|4442115_4442427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000356397.1|4442427_4442718_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001296612.1|4443076_4443355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001251293.1|4443751_4443970_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_032140890.1|4444154_4444604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001038650.1|4444919_4445768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001068514.1|4446057_4446300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000027696.1|4446481_4447411_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_000829013.1|4447407_4448043_-	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000331383.1|4448039_4448942_-	formate dehydrogenase O subunit beta	NA	NA	NA	NA	NA
WP_077633686.1|4448954_4452005_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
WP_000753589.1|4452198_4453032_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_000749934.1|4454027_4455422_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_000619499.1|4455462_4455777_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_001179746.1|4455786_4456611_-	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_001296617.1|4456877_4458137_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_000144100.1|4458133_4459603_-	rhamnulokinase	NA	NA	NA	NA	NA
WP_000217147.1|4459890_4460727_+	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_001296618.1|4460710_4461649_+	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_000063507.1|4461645_4462680_-	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_001296619.1|4462964_4463585_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	5.4e-63
WP_001270242.1|4464975_4465650_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000580417.1|4465820_4467194_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001033720.1|4467190_4467889_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_001223800.1|4468038_4468539_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
4468563:4468609	attL	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000985246.1|4468725_4469706_-|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	100.0	4.7e-186
WP_000777029.1|4469775_4470069_-	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
WP_001308179.1|4470205_4470478_+	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
WP_001005164.1|4470480_4470651_+	hypothetical protein	NA	S4TNZ7	Salmonella_phage	98.2	1.8e-24
WP_000217670.1|4470647_4471148_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_000557701.1|4471211_4471436_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	98.6	3.0e-32
WP_003571043.1|4471435_4471738_+	DUF5405 family protein	NA	A0A0F7LDT6	Escherichia_phage	98.0	3.8e-46
WP_001113264.1|4471737_4471962_+	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_000027667.1|4471958_4472234_+	DUF5405 family protein	NA	Q858T5	Yersinia_virus	100.0	3.8e-45
WP_059219437.1|4472223_4474512_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	97.2	0.0e+00
WP_001302990.1|4474920_4475076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310277.1|4475112_4475421_+	helix-turn-helix transcriptional regulator	NA	E5E3S9	Burkholderia_phage	40.2	1.7e-12
WP_059219438.1|4475398_4476349_+	RNA-directed DNA polymerase	NA	E5E3S8	Burkholderia_phage	40.0	3.8e-39
WP_000042038.1|4476473_4476911_-	hypothetical protein	NA	S4TUD6	Salmonella_phage	92.3	1.6e-69
WP_032153531.1|4477616_4478651_-|portal	phage portal protein	portal	M1SV64	Escherichia_phage	99.4	2.7e-200
WP_000156874.1|4478650_4480423_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_032153533.1|4480596_4481457_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	84.3	7.9e-129
WP_001248558.1|4481510_4482584_+|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	100.0	6.7e-202
WP_000203439.1|4482587_4483331_+|terminase	terminase endonuclease subunit	terminase	Q94MK6	Enterobacteria_phage	98.4	8.6e-124
WP_000988633.1|4483429_4483939_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846409.1|4483938_4484142_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_000123123.1|4484145_4484427_+|holin	phage holin family protein	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144101.1|4484426_4484924_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_032153534.1|4484938_4485364_+	hypothetical protein	NA	U5N096	Enterobacteria_phage	94.3	2.8e-58
WP_032153535.1|4485351_4485777_+|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	95.7	6.8e-65
WP_001440152.1|4485748_4485922_+	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
WP_000917186.1|4485884_4486352_+|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	98.7	2.5e-81
WP_032153537.1|4486344_4486797_+	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	98.7	6.9e-76
WP_021535458.1|4486863_4487499_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.6	2.0e-113
WP_000127163.1|4487495_4487843_+	GPW/gp25 family protein	NA	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_032153538.1|4487847_4488756_+|plate	baseplate assembly protein	plate	Q858V6	Yersinia_virus	99.0	1.7e-161
WP_001285323.1|4488748_4489279_+|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	99.4	1.3e-102
WP_001554307.1|4489289_4492025_+|tail	phage tail protein	tail	Q858V4	Yersinia_virus	81.9	0.0e+00
WP_001554308.1|4492028_4492556_+|tail	tail fiber assembly protein	tail	Q858V3	Yersinia_virus	99.4	1.7e-94
WP_032153539.1|4492945_4493473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032153540.1|4493771_4494962_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.0	9.0e-224
WP_032153542.1|4494974_4495493_+|tail	phage major tail tube protein	tail	Q858V0	Yersinia_virus	99.4	5.5e-93
WP_001031303.1|4495549_4495825_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|4495857_4495977_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_059219440.1|4495969_4498417_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	87.4	0.0e+00
WP_032153545.1|4498431_4498911_+|tail	phage tail protein	tail	O64315	Escherichia_phage	98.1	2.1e-83
WP_000882969.1|4498910_4500074_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	100.0	2.8e-206
WP_000468308.1|4500155_4500374_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001076748.1|4500610_4501513_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
4500486:4500532	attR	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000591795.1|4501693_4502656_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_000758732.1|4502975_4503965_+	sulfate/thiosulfate ABC transporter substrate-binding protein Sbp	NA	NA	NA	NA	NA
WP_001296622.1|4504071_4504827_+	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001216325.1|4504881_4505649_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000802235.1|4505756_4506356_-	YiiQ family protein	NA	NA	NA	NA	NA
WP_000155252.1|4506456_4506897_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000655986.1|4507108_4507408_+	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000323555.1|4507434_4507863_+	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000796342.1|4507867_4508614_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_001250644.1|4508710_4509721_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_059219441.1|4509891_4511400_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_000084268.1|4511422_4512268_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|4512692_4512938_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872908.1|4513022_4513508_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001305044.1|4513600_4514527_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293344.1|4514593_4515925_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000208242.1|4515934_4516465_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_000068834.1|4516557_4517517_-	cell division protein FtsN	NA	NA	NA	NA	NA
WP_000644908.1|4517608_4518634_-	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
WP_001296625.1|4518789_4520988_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_000710769.1|4521190_4521403_+	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000702314.1|4521463_4522072_-	YiiX family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000852812.1|4522131_4522449_-	met regulon transcriptional regulator MetJ	NA	NA	NA	NA	NA
WP_000197203.1|4522725_4523886_+	cystathionine gamma-synthase	NA	NA	NA	NA	NA
WP_000110759.1|4523888_4526321_+	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
WP_000105529.1|4526284_4527415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000694068.1|4527547_4529101_+	bifunctional metallophosphatase/5'-nucleotidase	NA	A0A0B5J7T1	Pandoravirus	24.5	3.5e-10
WP_000007515.1|4529482_4530373_+	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_001296626.1|4530701_4532882_+	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_001271242.1|4532975_4533881_+	cystine transporter YijE	NA	NA	NA	NA	NA
WP_000647862.1|4533907_4534525_-	DUF1287 domain-containing protein	NA	NA	NA	NA	NA
WP_000608644.1|4535737_4537000_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
>prophage 1
NZ_CP013833	Escherichia coli strain JJ2434 plasmid pJJ2434_1, complete sequence	126302	26241	78912	126302	transposase,protease	Escherichia_phage(50.0%)	49	NA	NA
WP_001298859.1|26241_27783_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_000107537.1|28307_28595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001234469.1|28715_29537_+	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	38.2	4.4e-44
WP_000614282.1|29833_30481_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_001151564.1|30766_31150_+	relaxosome protein TraM	NA	NA	NA	NA	NA
WP_000332487.1|31343_32030_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_001254388.1|32123_32351_+	conjugal transfer relaxosome protein TraY	NA	NA	NA	NA	NA
WP_001098998.1|32384_32747_+	type IV conjugative transfer system pilin TraA	NA	NA	NA	NA	NA
WP_000012106.1|32751_33063_+	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_000399804.1|33084_33651_+	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
WP_072095570.1|33661_34366_+	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
WP_000146638.1|34365_35793_+	conjugal transfer protein TraB	NA	NA	NA	NA	NA
WP_000002795.1|35782_36367_+	conjugal transfer protein TraP	NA	NA	NA	NA	NA
WP_071528018.1|36320_36674_+	conjugal transfer protein TrbD	NA	NA	NA	NA	NA
WP_001038341.1|36666_36918_+	conjugal transfer protein TrbG	NA	NA	NA	NA	NA
WP_000809893.1|36914_37430_+	type IV conjugative transfer system lipoprotein TraV	NA	NA	NA	NA	NA
WP_001278978.1|37564_37786_+	conjugal transfer protein TraR	NA	A0A218M4I6	Erwinia_phage	41.7	7.4e-07
WP_059219396.1|37945_40585_+	type IV secretion system protein TraC	NA	NA	NA	NA	NA
WP_000214082.1|40581_40968_+	type-F conjugative transfer system protein TrbI	NA	NA	NA	NA	NA
WP_001203720.1|40964_41597_+	type-F conjugative transfer system protein TraW	NA	NA	NA	NA	NA
WP_000830838.1|41593_42586_+	conjugal transfer pilus assembly protein TraU	NA	NA	NA	NA	NA
WP_000224411.1|42615_42921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059219397.1|43508_45119_+	type-F conjugative transfer system mating-pair stabilization protein TraN	NA	NA	NA	NA	NA
WP_000864320.1|45145_45403_+	conjugal transfer protein TrbE	NA	NA	NA	NA	NA
WP_001030371.1|45395_46139_+	type-F conjugative transfer system pilin assembly protein TraF	NA	NA	NA	NA	NA
WP_001287905.1|46154_46493_+	conjugal transfer protein TrbA	NA	NA	NA	NA	NA
WP_001448202.1|46619_46904_+	type-F conjugative transfer system pilin chaperone TraQ	NA	NA	NA	NA	NA
WP_001448115.1|47364_47706_+	P-type conjugative transfer protein TrbJ	NA	NA	NA	NA	NA
WP_001448114.1|47653_48079_+	F-type conjugal transfer protein TrbF	NA	NA	NA	NA	NA
WP_001137364.1|48065_49439_+	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_001007057.1|49435_52255_+	conjugal transfer mating pair stabilization protein TraG	NA	NA	NA	NA	NA
WP_000850422.1|52801_53533_+	complement resistance protein TraT	NA	NA	NA	NA	NA
WP_001462104.1|53785_55993_+	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_001067855.1|58804_59509_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001393253.1|59999_60332_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_000616807.1|63239_63893_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000557619.1|63985_64243_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_001398199.1|64175_64577_+	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_001067855.1|67594_68299_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_063840321.1|68442_68997_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001334766.1|69127_69958_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_001067855.1|70589_71294_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_032140899.1|72915_73158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000164043.1|73189_73840_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000804064.1|73945_75145_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000058717.1|75176_76061_-	EamA family transporter	NA	NA	NA	NA	NA
WP_001214976.1|76198_76606_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_000509965.1|77367_77973_-	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	9.4e-20
WP_001067855.1|78207_78912_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
