The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LN997848	Magnetospirillum sp. XM-1 isolate XM1 chromosome I	4825187	20557	57746	4825187	capsid,terminase,head,transposase,portal,tail	Acidithiobacillus_phage(48.28%)	43	NA	NA
WP_082700302.1|20557_22081_-	DNA cytosine methyltransferase	NA	Q14VY6	Ranid_herpesvirus	25.4	2.7e-23
WP_082700674.1|22077_22491_-	DNA mismatch endonuclease Vsr	NA	I6NSG0	Burkholderia_phage	52.8	1.6e-34
WP_156428591.1|22777_23955_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.6	2.2e-52
WP_068427893.1|24174_24567_-	hypothetical protein	NA	K4HZX2	Acidithiobacillus_phage	39.5	3.5e-15
WP_068427897.1|24563_25904_-	recombinase family protein	NA	K4ICM1	Acidithiobacillus_phage	54.6	1.5e-118
WP_068427900.1|25900_26350_-	DUF2924 domain-containing protein	NA	K4I3X1	Acidithiobacillus_phage	41.1	1.0e-18
WP_068427902.1|26346_26550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068427905.1|26735_28940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156428592.1|29033_29279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068427911.1|29376_30126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009870337.1|30215_30419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068427915.1|30559_30850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068427918.1|30849_31782_+	ATP-binding protein	NA	K4HZX9	Acidithiobacillus_phage	60.5	1.5e-96
WP_068427921.1|31800_32382_+	hypothetical protein	NA	K4ICM8	Acidithiobacillus_phage	54.3	1.3e-53
WP_068427924.1|32393_34073_+	DEAD/DEAH box helicase	NA	A0A2K9V3E9	Faecalibacterium_phage	34.2	2.2e-42
WP_068427927.1|34271_34478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068427931.1|34477_35236_+	PD-(D/E)XK nuclease family protein	NA	K4HZA0	Acidithiobacillus_phage	59.1	4.1e-81
WP_082700675.1|35463_37593_+	hypothetical protein	NA	K4HZY1	Acidithiobacillus_phage	65.7	1.5e-165
WP_068437312.1|37782_38202_+	hypothetical protein	NA	K4ICN3	Acidithiobacillus_phage	61.3	7.2e-43
WP_068427937.1|38198_38396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068427941.1|38388_38853_+	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
WP_068427944.1|39111_40668_+	DNA cytosine methyltransferase	NA	Q6V7R9	Burkholderia_virus	41.1	1.2e-87
WP_068427946.1|40667_41924_+	ParB N-terminal domain-containing protein	NA	A0A0A8ILE7	Aurantimonas_phage	51.6	5.7e-120
WP_068427949.1|41920_42130_+	hypothetical protein	NA	K4I1E3	Acidithiobacillus_phage	69.6	2.6e-17
WP_068427951.1|42190_42454_+	HU family DNA-binding protein	NA	NA	NA	NA	NA
WP_068437315.1|42630_43140_-	DUF3489 domain-containing protein	NA	K4HZZ2	Acidithiobacillus_phage	36.4	5.1e-19
WP_068427954.1|43240_43774_+	elements of external origin	NA	A0A2H4JCL4	uncultured_Caudovirales_phage	50.3	2.6e-37
WP_068427957.1|43721_45716_+|terminase	phage terminase large subunit family protein	terminase	A0A2H4JIC6	uncultured_Caudovirales_phage	57.3	3.6e-209
WP_068427960.1|45712_46330_-	plasmid pRiA4b ORF-3 family protein	NA	A0A2H4PDG5	Mycobacterium_phage	37.5	4.0e-18
WP_068427963.1|46448_46658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068427964.1|46660_48124_+|portal	phage portal protein	portal	K4I1F2	Acidithiobacillus_phage	69.5	1.8e-189
WP_068427965.1|48132_49353_+	S49 family peptidase	NA	K4HZZ6	Acidithiobacillus_phage	51.0	3.3e-96
WP_068427966.1|49355_49745_+|head	head decoration protein	head	K4ICP8	Acidithiobacillus_phage	59.5	4.9e-30
WP_068427967.1|49759_50782_+|capsid	major capsid protein	capsid	K4I3Z3	Acidithiobacillus_phage	56.6	5.5e-105
WP_068427968.1|50783_51095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068427969.1|51274_51925_+	hypothetical protein	NA	G8DH49	Emiliania_huxleyi_virus	44.3	2.3e-35
WP_068427972.1|51893_52214_-	helix-turn-helix transcriptional regulator	NA	A0A088CD40	Shigella_phage	47.9	3.3e-16
WP_068427975.1|52210_52537_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	42.4	7.3e-11
WP_068427986.1|52637_53066_+	acyl-CoA transferase	NA	G8DH50	Emiliania_huxleyi_virus	47.5	1.4e-30
WP_068427991.1|53091_54054_+	hypothetical protein	NA	G8DH51	Emiliania_huxleyi_virus	43.7	3.5e-61
WP_068427994.1|54062_54587_+	hypothetical protein	NA	G8DH52	Emiliania_huxleyi_virus	34.1	1.3e-09
WP_082700676.1|54583_54814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172821873.1|54800_57746_+|tail	phage tail length tape measure family protein	tail	NA	NA	NA	NA
>prophage 2
NZ_LN997848	Magnetospirillum sp. XM-1 isolate XM1 chromosome I	4825187	427943	476426	4825187	protease,integrase,tRNA,transposase	Bacillus_phage(12.5%)	51	473577:473598	477215:477236
WP_068428969.1|427943_429251_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	A0A2L0UZ92	Agrobacterium_phage	42.3	9.8e-38
WP_068428971.1|429245_429491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068428975.1|429668_431102_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_068428978.1|431178_432459_+	DUF3422 domain-containing protein	NA	NA	NA	NA	NA
WP_068428981.1|432590_435092_-	EAL domain-containing protein	NA	A0A127AWB9	Bacillus_phage	38.9	4.1e-16
WP_068428984.1|435092_435713_-	chemotaxis protein CheC	NA	NA	NA	NA	NA
WP_068428987.1|435709_436081_-	response regulator	NA	NA	NA	NA	NA
WP_068428991.1|436188_436608_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_082700321.1|436990_438319_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_068437409.1|438342_438657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068428994.1|439128_440628_+	type I restriction-modification system subunit M	NA	A0A220A2U4	Liberibacter_phage	48.6	1.0e-131
WP_082700322.1|440608_441841_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_082700323.1|441868_444238_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	32.9	4.3e-68
WP_082700324.1|444386_445421_+	RelA/SpoT domain-containing protein	NA	NA	NA	NA	NA
WP_068437415.1|445467_446157_-	DUF2786 domain-containing protein	NA	A0A219VHD3	Ochrobactrum_phage	25.7	2.0e-05
WP_068429000.1|446201_446804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082700684.1|447030_447576_-	dual specificity protein phosphatase family protein	NA	NA	NA	NA	NA
WP_156428611.1|447711_448020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156428612.1|448067_448607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068429006.1|449379_449829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082700325.1|450256_450709_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_068429009.1|451124_451706_-|integrase	site-specific integrase	integrase	K4K327	Caulobacter_virus	41.2	6.5e-26
WP_082700326.1|451932_452769_-	DNA adenine methylase	NA	E3SNS6	Prochlorococcus_phage	31.9	5.5e-26
WP_068429011.1|452896_453289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156428613.1|453621_455220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082700327.1|455707_456568_+	DUF5131 family protein	NA	A0A0A7RVQ8	Mycobacterium_phage	32.7	3.7e-25
WP_068429018.1|456586_456931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068429027.1|457031_458309_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	43.2	4.5e-88
WP_082700328.1|458315_458786_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	39.8	7.8e-22
WP_156428614.1|458925_459297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082700329.1|459416_459869_-	DUF1465 family protein	NA	NA	NA	NA	NA
WP_156428615.1|460095_460824_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_082700330.1|461320_462784_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	31.1	3.1e-16
WP_068437421.1|463210_463561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082700332.1|463621_464719_+	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_068429047.1|464778_465057_+	HU family DNA-binding protein	NA	B5TA87	Burkholderia_phage	56.7	2.4e-18
WP_082700333.1|465046_465544_+	MucR family transcriptional regulator	NA	A0A1P8VVG0	Erythrobacter_phage	41.5	1.4e-16
WP_068437424.1|465644_466064_+	helix-turn-helix transcriptional regulator	NA	Q8W6G2	Sinorhizobium_phage	43.9	1.7e-20
WP_082700334.1|466494_466878_+	response regulator	NA	NA	NA	NA	NA
WP_082700335.1|466983_467280_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_082700336.1|467566_469063_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_068429053.1|469059_469899_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	37.9	1.5e-39
WP_068429056.1|470713_472030_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_068429059.1|472125_472335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172821877.1|472394_472859_-	response regulator	NA	NA	NA	NA	NA
473577:473598	attL	TGTCGTGTAACACGACAGCCAG	NA	NA	NA	NA
WP_068437430.1|473704_474004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082700338.1|474022_474319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156428616.1|474346_474544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068429066.1|474916_475303_+	response regulator	NA	NA	NA	NA	NA
WP_082700340.1|475358_475847_+	bacteriohemerythrin	NA	NA	NA	NA	NA
WP_068429070.1|475859_476426_-|integrase	site-specific integrase	integrase	K4JX14	Caulobacter_virus	34.8	3.7e-18
477215:477236	attR	CTGGCTGTCGTGTTACACGACA	NA	NA	NA	NA
>prophage 3
NZ_LN997848	Magnetospirillum sp. XM-1 isolate XM1 chromosome I	4825187	596365	636110	4825187	terminase,transposase,holin,integrase	uncultured_Caudovirales_phage(25.0%)	37	629889:629907	639415:639433
WP_068429425.1|596365_597850_+|terminase	phage terminase large subunit	terminase	A0A2H4JCA3	uncultured_Caudovirales_phage	30.4	9.0e-56
WP_068429429.1|597892_598192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068429432.1|598204_598723_+|holin	holin family protein	holin	A0A1D9CA16	Salinivibrio_phage	37.9	3.2e-16
WP_068437445.1|598772_599273_-	ferritin family protein	NA	NA	NA	NA	NA
WP_068429436.1|599441_599651_+	dodecin domain-containing protein	NA	NA	NA	NA	NA
WP_068437448.1|599655_599886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068429439.1|599962_600277_-	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	50.5	2.3e-22
WP_082700345.1|600762_601557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068429443.1|601624_602104_-	MucR family transcriptional regulator	NA	A0A1P8VVG0	Erythrobacter_phage	41.9	1.0e-16
WP_156428623.1|602180_602771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156428624.1|602780_603110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156428625.1|603496_603796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156428626.1|603972_604857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068429457.1|604853_606383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068429463.1|607147_607972_-	pirin family protein	NA	NA	NA	NA	NA
WP_172821878.1|610935_612603_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_068429471.1|613189_613459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068429474.1|613482_613746_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_156428628.1|614232_614736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068429483.1|614805_616266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156428629.1|616266_616560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068429486.1|616632_616896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068429489.1|616969_619435_-	cation:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	27.1	3.7e-06
WP_172821879.1|619523_622121_-	response regulator	NA	A0A1V0SGX0	Hokovirus	30.3	7.1e-32
WP_068429497.1|622404_624102_+	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_068429500.1|624121_625228_+	hydrogenase small subunit	NA	NA	NA	NA	NA
WP_068429503.1|625214_627011_+	nickel-dependent hydrogenase large subunit	NA	NA	NA	NA	NA
WP_068429509.1|627025_627748_+	Ni/Fe-hydrogenase, b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_068429512.1|627740_628229_+	HyaD/HybD family hydrogenase maturation endopeptidase	NA	NA	NA	NA	NA
WP_068429515.1|628249_628690_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_008618450.1|628697_629036_-	cyclic nucleotide-binding domain-containing protein	NA	NA	NA	NA	NA
WP_068429519.1|629212_629695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068429523.1|629768_630872_-	hypothetical protein	NA	NA	NA	NA	NA
629889:629907	attL	GCGCTTGGCGTTGGTGGCG	NA	NA	NA	NA
WP_156428594.1|632695_633647_-|transposase	IS630 family transposase	transposase	A0A2P0VP61	Tetraselmis_virus	28.6	1.1e-14
WP_068428062.1|633797_634046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068428058.1|634042_635242_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_068428055.1|635252_636110_-|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	35.3	7.8e-36
639415:639433	attR	GCGCTTGGCGTTGGTGGCG	NA	NA	NA	NA
>prophage 4
NZ_LN997848	Magnetospirillum sp. XM-1 isolate XM1 chromosome I	4825187	867848	875274	4825187		Enterobacteria_phage(16.67%)	6	NA	NA
WP_068430217.1|867848_868967_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	48.3	7.7e-84
WP_068430220.1|868963_869854_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	55.6	5.0e-86
WP_068430222.1|869850_871647_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.9	1.9e-23
WP_068430225.1|871650_872685_+	SDR family oxidoreductase	NA	Q58M85	Prochlorococcus_phage	40.7	2.0e-49
WP_068430228.1|872704_874261_+	adenylyltransferase/cytidyltransferase family protein	NA	M4QSA2	Synechococcus_phage	44.2	2.1e-10
WP_068430231.1|874281_875274_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SKV4	Klosneuvirus	25.4	9.4e-17
>prophage 6
NZ_LN997848	Magnetospirillum sp. XM-1 isolate XM1 chromosome I	4825187	2284831	2319435	4825187	transposase	Tupanvirus(28.57%)	38	NA	NA
WP_082700445.1|2284831_2285014_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_068433356.1|2287179_2287857_-	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_068433358.1|2287873_2288575_-	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_068433360.1|2288825_2289992_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_068433362.1|2290012_2290861_+	MaoC family dehydratase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_068433364.1|2290924_2291686_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_172821908.1|2291669_2292707_-	acetyl-CoA hydrolase/transferase family protein	NA	NA	NA	NA	NA
WP_068433367.1|2292918_2293692_-	cyclohexa-1,5-dienecarbonyl-CoA hydratase	NA	NA	NA	NA	NA
WP_068433369.1|2293691_2294831_-	6-oxocyclohex-1-ene-1-carbonyl-CoA hydratase	NA	NA	NA	NA	NA
WP_068433373.1|2294842_2295910_-	6-hydroxycyclohex-1-ene-1-carbonyl-CoA dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	26.4	5.9e-09
WP_068433375.1|2296105_2296573_+	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_068433378.1|2296707_2297853_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_172821909.1|2297977_2298646_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_068433382.1|2298685_2300335_-	acyl--CoA ligase	NA	NA	NA	NA	NA
WP_156428696.1|2300641_2300842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172821871.1|2301041_2301179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068433387.1|2301230_2301494_+	HU family DNA-binding protein	NA	NA	NA	NA	NA
WP_068433389.1|2301502_2301694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082700448.1|2301669_2301981_-	DUF3489 domain-containing protein	NA	K4HZZ2	Acidithiobacillus_phage	64.5	4.0e-14
WP_068433390.1|2302079_2302442_-	hypothetical protein	NA	K4ICP1	Acidithiobacillus_phage	60.0	7.1e-15
WP_156428697.1|2302493_2302751_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	62.1	7.5e-19
WP_156428698.1|2302747_2302927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082700450.1|2302845_2303130_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_068433391.1|2303300_2304758_+|transposase	IS4 family transposase	transposase	Q9JMP3	Wolbachia_phage	35.6	7.7e-68
WP_082700451.1|2306549_2306963_+	PhnD/SsuA/transferrin family substrate-binding protein	NA	NA	NA	NA	NA
WP_068433396.1|2307072_2308626_+	PAS domain S-box protein	NA	A0A2K9L5I4	Tupanvirus	31.2	7.6e-05
WP_172821910.1|2308672_2309590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011383368.1|2311109_2311358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008621829.1|2311512_2311887_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	47.7	8.4e-27
WP_172821911.1|2312352_2312721_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_172821912.1|2312774_2313251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068433398.1|2313345_2313696_+	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_156428700.1|2314177_2314468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082700456.1|2315233_2315605_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_068433399.1|2316368_2316581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008621838.1|2316967_2317447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050750629.1|2317673_2318030_+	response regulator	NA	NA	NA	NA	NA
WP_068430816.1|2318406_2319435_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_LN997848	Magnetospirillum sp. XM-1 isolate XM1 chromosome I	4825187	2358651	2442223	4825187	integrase,holin,transposase	Leptospira_phage(23.08%)	76	2358623:2358682	2438407:2438514
2358623:2358682	attL	GTAATTGCTCACGGGGTTGACGCTGGGGTTCAGGCGATAGCGAAATTGCCGTCGATGAGT	NA	NA	NA	NA
WP_068433431.1|2358651_2360010_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
2358623:2358682	attL	GTAATTGCTCACGGGGTTGACGCTGGGGTTCAGGCGATAGCGAAATTGCCGTCGATGAGT	NA	NA	NA	NA
WP_068433435.1|2360707_2361655_-	hemerythrin family protein	NA	NA	NA	NA	NA
WP_068433437.1|2362283_2363135_-	bacteriohemerythrin	NA	NA	NA	NA	NA
WP_082700458.1|2363152_2363656_-	hemerythrin family protein	NA	NA	NA	NA	NA
WP_068433440.1|2363690_2365001_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	63.3	6.2e-08
WP_156428853.1|2365015_2365498_-	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	40.7	3.3e-23
WP_082700459.1|2365693_2367073_-	bacteriohemerythrin	NA	NA	NA	NA	NA
WP_068428055.1|2367285_2368143_+|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	35.3	7.8e-36
WP_068428058.1|2368153_2369353_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_068428062.1|2369349_2369598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156428703.1|2369748_2370699_+|transposase	IS630 family transposase	transposase	A0A2P0VP61	Tetraselmis_virus	28.6	1.4e-14
WP_011383424.1|2371126_2372755_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_068433444.1|2372997_2373225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043746027.1|2373388_2373694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011383427.1|2373780_2373996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068437710.1|2374429_2376106_+	trypsin-like peptidase domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	30.0	1.6e-13
WP_068433446.1|2376134_2377097_+	FraH protein	NA	NA	NA	NA	NA
WP_008622189.1|2377155_2378013_+	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_011383430.1|2378060_2378879_+	LemA family protein	NA	NA	NA	NA	NA
WP_008622632.1|2378875_2379130_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_068433448.1|2379126_2380017_+	magnetosome biogenesis CDF transporter MamB	NA	NA	NA	NA	NA
WP_008615104.1|2380076_2380325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068433450.1|2380464_2380890_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_008615101.1|2380995_2381421_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_068437713.1|2381643_2383794_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	43.6	2.3e-121
WP_008615089.1|2383810_2384767_+	CDF family Co(II)/Ni(II) efflux transporter DmeF	NA	NA	NA	NA	NA
WP_068433451.1|2385014_2385341_+	YnfA family protein	NA	A0A2H4JF35	uncultured_Caudovirales_phage	51.0	1.9e-22
WP_082700460.1|2385376_2386312_-	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_008615077.1|2386357_2388292_-	MFS transporter	NA	NA	NA	NA	NA
WP_008615076.1|2388275_2389046_-	magnetochrome domain-containing protein	NA	NA	NA	NA	NA
WP_068433452.1|2389226_2390396_-	chemotaxis protein	NA	NA	NA	NA	NA
WP_068433454.1|2390667_2391648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068433456.1|2391631_2392585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011383440.1|2392591_2393557_+	protein kinase family protein	NA	NA	NA	NA	NA
WP_068433457.1|2393686_2394235_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_068433459.1|2394246_2394789_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_068433461.1|2395280_2396489_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_008615052.1|2396497_2396818_+	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_068433463.1|2396853_2398968_+	ferrous iron transport protein B	NA	NA	NA	NA	NA
WP_156428705.1|2399220_2399370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011383445.1|2399449_2399785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156428854.1|2399796_2400390_-	cell wall protein TIR3 precursor	NA	NA	NA	NA	NA
WP_068433464.1|2400417_2400651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068433467.1|2400741_2401662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068433469.1|2401658_2402822_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_156428706.1|2403138_2404096_-|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	26.4	7.2e-06
WP_068428062.1|2404244_2404493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068428058.1|2404489_2405689_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_068428055.1|2405699_2406557_-|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	35.3	7.8e-36
WP_148207301.1|2406693_2407647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068433474.1|2407882_2408944_-	HEAT repeat domain-containing protein	NA	NA	NA	NA	NA
WP_082700461.1|2409618_2410797_-	FecR domain-containing protein	NA	NA	NA	NA	NA
2409415:2409784	attR	ACTCATCGACGGCAATTTCGCTATCGCCTGAACCCCAGCGTCAACCCCGTGAGCAATTACGCTGGTCATGCTCAATGCCGACTCGGCCTAAAGTGAGGATCAAGGCTTATCTGCCGGAACCATAACCAGCTGTTGCGTGAAGTACGGGCAGTCATTGGACTTACGAACCTTCCACTTCCCGTTGGCAACGGGACATAGCGTTGTTTATCTGTCTGATCTAAGCGGAATCGGATTTTGGATTGAACGAAACCGCTGGCGCGGTATTGGAGCCTGAGCCGCGTCCTTCTGTACCGTCGGCGCCGCGGCCTTGAATGCCTCGGTGGCTTTCTCCGGAGCCAGGGTTTTGTCAGGGGTGATCGCCTTGTCGGGC	NA	NA	NA	NA
WP_068433479.1|2411940_2412309_+	hypothetical protein	NA	NA	NA	NA	NA
2409415:2409784	attR	ACTCATCGACGGCAATTTCGCTATCGCCTGAACCCCAGCGTCAACCCCGTGAGCAATTACGCTGGTCATGCTCAATGCCGACTCGGCCTAAAGTGAGGATCAAGGCTTATCTGCCGGAACCATAACCAGCTGTTGCGTGAAGTACGGGCAGTCATTGGACTTACGAACCTTCCACTTCCCGTTGGCAACGGGACATAGCGTTGTTTATCTGTCTGATCTAAGCGGAATCGGATTTTGGATTGAACGAAACCGCTGGCGCGGTATTGGAGCCTGAGCCGCGTCCTTCTGTACCGTCGGCGCCGCGGCCTTGAATGCCTCGGTGGCTTTCTCCGGAGCCAGGGTTTTGTCAGGGGTGATCGCCTTGTCGGGC	NA	NA	NA	NA
WP_068430816.1|2412830_2413859_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_148207253.1|2414410_2415251_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_082700462.1|2415258_2415471_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_041041672.1|2415621_2415861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068433480.1|2416445_2417546_+	response regulator	NA	W8CYM9	Bacillus_phage	33.6	1.5e-07
WP_068433481.1|2417609_2418761_+	two-component system response regulator	NA	NA	NA	NA	NA
WP_156428855.1|2418784_2419429_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_172821913.1|2419445_2423747_+	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	29.5	4.2e-53
WP_068433490.1|2424794_2425535_-|holin	phosphocholine cytidylyltransferase family protein	holin	NA	NA	NA	NA
WP_082700465.1|2425531_2426125_-	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	NA	NA	NA	NA
WP_068433492.1|2426121_2428446_-	phosphoenolpyruvate synthase	NA	NA	NA	NA	NA
WP_068433493.1|2428449_2429229_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_068437725.1|2429225_2429762_-	adenylyl-sulfate kinase	NA	A0A2P1ELS9	Moumouvirus	31.1	2.4e-14
WP_156428707.1|2429994_2431302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068433494.1|2431580_2431958_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_082700466.1|2432208_2432742_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_068433497.1|2433163_2435053_-	caspase family protein	NA	NA	NA	NA	NA
WP_068428062.1|2436093_2436342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068428058.1|2436338_2437538_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_068428055.1|2437548_2438406_-|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	35.3	7.8e-36
WP_068433508.1|2439209_2440283_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_156428708.1|2440613_2441123_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_068433508.1|2441149_2442223_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_LN997848	Magnetospirillum sp. XM-1 isolate XM1 chromosome I	4825187	2551004	2611777	4825187	integrase,capsid,terminase,portal,tail	uncultured_Caudovirales_phage(10.0%)	70	2550681:2550702	2612847:2612868
2550681:2550702	attL	TCAATGCACCGTGCAGACCATG	NA	NA	NA	NA
WP_068433668.1|2551004_2551637_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A8WF93	Clostridium_phage	27.8	8.7e-08
WP_068433673.1|2551787_2553170_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_068437734.1|2553209_2555921_+	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_068433675.1|2555917_2556262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156428713.1|2556258_2556426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068433677.1|2556580_2559232_-	cation-transporting P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	29.5	1.5e-69
WP_068433678.1|2559254_2562128_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_068437737.1|2562179_2563313_-	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	26.1	1.2e-15
WP_068433680.1|2563465_2564011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043745183.1|2564532_2564742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082700481.1|2564720_2564996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172821916.1|2564998_2565154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068437739.1|2566199_2566445_-	hypothetical protein	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	41.2	6.1e-10
WP_068433685.1|2567022_2567241_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_068433687.1|2567315_2567969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068433689.1|2568005_2568362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068433691.1|2568361_2568616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068433693.1|2568612_2569254_-	recombinase family protein	NA	A0A0F7L6S1	uncultured_marine_virus	46.6	6.7e-40
WP_068433696.1|2570351_2571959_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_068433698.1|2571955_2572600_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_068433700.1|2572745_2573267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068433702.1|2573372_2573801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145980738.1|2573857_2574076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068433708.1|2574595_2575372_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0U4JIT5	Pseudomonas_phage	50.2	9.8e-62
WP_068433710.1|2575694_2575919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068433712.1|2575918_2576449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068433714.1|2576504_2577017_-	hypothetical protein	NA	A0A2I7S3K6	Vibrio_phage	37.3	1.2e-18
WP_068433716.1|2577016_2577217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172821967.1|2577219_2577666_-	lysozyme	NA	A0A2I7S753	Vibrio_phage	56.8	2.0e-35
WP_068433720.1|2577677_2578205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068433723.1|2578302_2580702_-|tail	phage tail protein	tail	A0A0B5A1N2	Achromobacter_phage	36.8	2.2e-128
WP_068433725.1|2580698_2581118_-	hypothetical protein	NA	A0A0G3EYJ9	Achromobacter_phage	40.8	2.2e-20
WP_068433727.1|2581169_2581712_-	DUF1833 family protein	NA	NA	NA	NA	NA
WP_068433729.1|2581714_2582053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068433731.1|2582054_2583926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068433733.1|2583944_2584454_-	hypothetical protein	NA	B5WZT5	Pseudomonas_phage	38.6	1.2e-15
WP_068433735.1|2584453_2587450_-	tape measure protein	NA	A5H1M1	Xanthomonas_virus	24.6	7.0e-07
WP_172821917.1|2587439_2587583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156428714.1|2588222_2588594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068433739.1|2588626_2589589_-	hypothetical protein	NA	G8DH51	Emiliania_huxleyi_virus	43.7	2.5e-62
WP_068433741.1|2589615_2590050_-	hypothetical protein	NA	G8DH50	Emiliania_huxleyi_virus	45.7	1.1e-25
WP_156428715.1|2590039_2590720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068433745.1|2590716_2591034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068433747.1|2591039_2591273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068433749.1|2591349_2593251_-|capsid	phage major capsid protein	capsid	K7XS73	uncultured_Mediterranean_phage	41.7	7.4e-119
WP_068433750.1|2593266_2594760_-|portal	phage portal protein	portal	Q6R4V2	Vibrio_virus	41.2	3.5e-100
WP_068433751.1|2594759_2595323_-	hypothetical protein	NA	A2I2W7	Vibrio_virus	46.1	2.0e-32
WP_082700484.1|2595322_2597311_-|terminase	phage terminase large subunit family protein	terminase	A0A0A8ILA6	Aurantimonas_phage	47.8	8.1e-153
WP_068433753.1|2597288_2597849_-	hypothetical protein	NA	K4ICN8	Acidithiobacillus_phage	28.1	1.1e-06
WP_068437742.1|2597876_2599097_-	site-specific DNA-methyltransferase	NA	A0A2H4JGF1	uncultured_Caudovirales_phage	47.1	3.5e-98
WP_068433755.1|2599456_2600014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068433757.1|2600010_2600967_-	hypothetical protein	NA	A0A1J0MCP9	Streptomyces_phage	41.4	5.0e-15
WP_068433759.1|2600966_2601188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068433760.1|2601180_2602647_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	37.1	3.4e-79
WP_068433761.1|2602643_2602913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068433763.1|2603426_2604074_-	DNA cytosine methyltransferase	NA	A0A088FTS3	Mycobacterium_phage	44.7	2.4e-37
WP_068433765.1|2604070_2604484_-	hypothetical protein	NA	A0A088FV39	Escherichia_phage	60.4	2.7e-18
WP_068433767.1|2604480_2604963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068433771.1|2605516_2606284_+	helix-turn-helix domain-containing protein	NA	Q8W6G7	Sinorhizobium_phage	42.9	1.5e-06
WP_068433773.1|2606418_2606718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068433775.1|2606719_2606914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068433777.1|2606913_2607231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068433779.1|2607246_2607633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068433780.1|2607655_2608594_+	DUF2303 family protein	NA	A0A291AUR3	Sinorhizobium_phage	39.9	2.8e-47
WP_068433781.1|2608752_2609331_+	hypothetical protein	NA	U5P0T3	Shigella_phage	40.4	2.2e-18
WP_068433782.1|2609327_2609591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068433783.1|2609594_2610125_+	single-stranded DNA-binding protein	NA	A0A0U2C0X4	Paracoccus_phage	65.1	5.5e-40
WP_068433785.1|2610128_2610455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082700486.1|2610447_2610678_+	hypothetical protein	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	43.1	1.9e-05
WP_068433787.1|2610679_2611777_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	40.4	1.2e-65
2612847:2612868	attR	TCAATGCACCGTGCAGACCATG	NA	NA	NA	NA
>prophage 9
NZ_LN997848	Magnetospirillum sp. XM-1 isolate XM1 chromosome I	4825187	2830362	2836719	4825187		Salmonella_phage(16.67%)	8	NA	NA
WP_068434097.1|2830362_2831640_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	41.6	6.1e-85
WP_082700721.1|2831646_2832117_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	39.8	4.6e-22
WP_068434101.1|2832181_2832643_-	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_082700722.1|2832923_2834753_+	diguanylate cyclase	NA	G3MA91	Bacillus_virus	31.4	7.1e-18
WP_156428859.1|2835190_2835430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068434105.1|2835508_2835787_+	HU family DNA-binding protein	NA	B5TA87	Burkholderia_phage	55.6	1.8e-18
WP_082700507.1|2835776_2836190_+	MucR family transcriptional regulator	NA	A0A1P8VVG0	Erythrobacter_phage	50.4	8.1e-23
WP_068434107.1|2836299_2836719_+	helix-turn-helix transcriptional regulator	NA	Q8W6G2	Sinorhizobium_phage	43.9	2.2e-20
>prophage 10
NZ_LN997848	Magnetospirillum sp. XM-1 isolate XM1 chromosome I	4825187	3098953	3105204	4825187		Sinorhizobium_phage(16.67%)	8	NA	NA
WP_068434578.1|3098953_3099217_+	DUF2312 domain-containing protein	NA	A0A0F6R615	Sinorhizobium_phage	57.7	2.9e-18
WP_068434581.1|3099308_3099764_-	MucR family transcriptional regulator	NA	A0A1P8VVG0	Erythrobacter_phage	46.4	2.2e-21
WP_068434584.1|3100103_3100538_+	ribose 5-phosphate isomerase B	NA	NA	NA	NA	NA
WP_068434587.1|3100567_3101851_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	51.7	3.3e-99
WP_068434590.1|3101909_3102371_+	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_068434593.1|3102402_3103479_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.6	6.8e-45
WP_068434596.1|3103490_3104084_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.1	7.6e-22
WP_068434599.1|3104055_3105204_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	38.7	4.0e-59
>prophage 11
NZ_LN997848	Magnetospirillum sp. XM-1 isolate XM1 chromosome I	4825187	3261421	3270441	4825187	protease,tRNA	uncultured_Mediterranean_phage(88.89%)	12	NA	NA
WP_068434874.1|3261421_3262522_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I3PV79	Clostridium_phage	37.6	3.0e-16
WP_068434875.1|3262602_3263247_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	39.4	2.6e-23
WP_068434877.1|3263246_3264026_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	38.9	1.1e-41
WP_068434881.1|3264027_3265296_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.8	1.3e-103
WP_082700544.1|3265310_3266138_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	49.2	4.7e-54
WP_068434882.1|3266148_3266553_-	twin-arginine translocase subunit TatB	NA	A0A1B1IVT0	uncultured_Mediterranean_phage	41.4	6.8e-06
WP_068434884.1|3266568_3266808_-	twin-arginine translocase TatA/TatE family subunit	NA	NA	NA	NA	NA
WP_068437889.1|3266901_3267252_-	YbaN family protein	NA	NA	NA	NA	NA
WP_068434885.1|3267282_3267933_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	48.8	9.4e-42
WP_068434886.1|3267929_3268742_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	35.0	3.4e-33
WP_068434888.1|3268738_3269425_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_068434890.1|3269421_3270441_-	beta-N-acetylhexosaminidase	NA	A0A1B1IVS3	uncultured_Mediterranean_phage	43.5	1.5e-22
>prophage 12
NZ_LN997848	Magnetospirillum sp. XM-1 isolate XM1 chromosome I	4825187	4041242	4079854	4825187	capsid,head,plate,transposase,tail	Ochrobactrum_phage(15.38%)	54	NA	NA
WP_068436123.1|4041242_4042091_+	ParB N-terminal domain-containing protein	NA	R9U496	Rhizobium_phage	29.4	9.5e-18
WP_068436124.1|4042093_4043524_+|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A1B0T6N2	Pelagibaca_phage	44.9	1.3e-107
WP_068436126.1|4043571_4044309_+	ATP-binding protein	NA	A0A0A1IVZ3	Pseudomonas_phage	49.4	5.7e-59
WP_068436127.1|4044311_4044965_+	hypothetical protein	NA	A0A1B0T6M0	Pelagibaca_phage	38.9	5.1e-27
WP_068436129.1|4044954_4045347_+	hypothetical protein	NA	A0A1B0T6G8	Thiobacimonas_phage	41.0	4.4e-18
WP_068436131.1|4045339_4045804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068436133.1|4045800_4046256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156428790.1|4046243_4046384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068436135.1|4046395_4047259_+	DUF3164 family protein	NA	Q5ZR10	Pseudomonas_phage	38.2	1.2e-31
WP_068436137.1|4047263_4047554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068436138.1|4047556_4047844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068436140.1|4047856_4048342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068438029.1|4048517_4049030_+	helix-turn-helix transcriptional regulator	NA	Q8W6G2	Sinorhizobium_phage	44.1	1.9e-21
WP_068436141.1|4049087_4050230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068436142.1|4050233_4050509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156428791.1|4050514_4050718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068436145.1|4050719_4051445_+	DUF2786 domain-containing protein	NA	A0A219VHD3	Ochrobactrum_phage	35.2	4.6e-13
WP_068436147.1|4051459_4052071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068436149.1|4052148_4052781_+	regulatory protein GemA	NA	NA	NA	NA	NA
WP_068436150.1|4052829_4053033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068436154.1|4053297_4053579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068436155.1|4053581_4053788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068436157.1|4053788_4054208_+	hypothetical protein	NA	A0A219VHE2	Ochrobactrum_phage	45.9	5.4e-06
WP_068436159.1|4054533_4055274_+	transglycosylase SLT domain-containing protein	NA	M4R0Y9	Tetraselmis_viridis_virus	53.2	1.2e-37
WP_068436161.1|4055270_4055807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068436162.1|4055832_4056210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068436163.1|4056209_4056512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068436165.1|4056515_4057190_+	DUF3486 family protein	NA	NA	NA	NA	NA
WP_068436169.1|4057324_4058962_+	hypothetical protein	NA	A0A219VH72	Ochrobactrum_phage	44.2	1.3e-111
WP_068436171.1|4058961_4060527_+	DUF935 domain-containing protein	NA	A0A2P9JZI9	Alteromonadaceae_phage	42.8	1.3e-105
WP_068436173.1|4060527_4061811_+|capsid	minor capsid protein	capsid	A0A219VH74	Ochrobactrum_phage	37.9	3.0e-63
WP_172821941.1|4062198_4063383_+	hypothetical protein	NA	J9SH47	Pseudomonas_phage	29.3	5.8e-21
WP_068436176.1|4063383_4063791_+	hypothetical protein	NA	M4ST95	Rhodobacter_phage	55.7	4.4e-29
WP_068436178.1|4063801_4064695_+|head	Mu-like prophage major head subunit gpT family protein	head	M4SRT6	Rhodobacter_phage	56.2	1.2e-98
WP_068436180.1|4064706_4064934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068436182.1|4065013_4065436_+	DUF1320 domain-containing protein	NA	NA	NA	NA	NA
WP_068436184.1|4065435_4065936_+	phage virion morphogenesis protein	NA	A0A1B1P725	Rhodovulum_phage	47.7	4.4e-23
WP_068436185.1|4065932_4066514_+	DUF1834 family protein	NA	NA	NA	NA	NA
WP_156428876.1|4066525_4066732_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_068436188.1|4066735_4068208_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	M1Q565	Vibrio_phage	38.4	4.6e-84
WP_068436190.1|4068232_4068577_+|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_068436192.1|4068588_4068930_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_068436194.1|4069004_4070750_+|tail	phage tail tape measure protein	tail	NA	NA	NA	NA
WP_068436196.1|4070749_4071967_+	DNA circularization N-terminal domain-containing protein	NA	S5FUX4	Shigella_phage	27.0	3.7e-23
WP_068436198.1|4071959_4073030_+	hypothetical protein	NA	M4M9L5	Vibrio_phage	34.1	5.3e-42
WP_068436200.1|4073020_4073581_+|plate	phage baseplate assembly protein	plate	Q8W617	Enterobacteria_phage	48.4	1.0e-07
WP_068436202.1|4073580_4074054_+	phage GP46 family protein	NA	B5TAA8	Burkholderia_phage	33.6	1.4e-05
WP_068436204.1|4074050_4075109_+|plate	baseplate J/gp47 family protein	plate	A0A2I7S9E5	Vibrio_phage	32.0	7.7e-25
WP_068436206.1|4075108_4075747_+	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_068436208.1|4075746_4076430_+	hypothetical protein	NA	M1FN94	Enterobacteria_phage	41.2	7.4e-13
WP_068436210.1|4076432_4077374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082700744.1|4077590_4077896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068438032.1|4078046_4078868_+	DNA adenine methylase	NA	A0A291AUP9	Sinorhizobium_phage	62.8	1.9e-92
WP_156428594.1|4078902_4079854_-|transposase	IS630 family transposase	transposase	A0A2P0VP61	Tetraselmis_virus	28.6	1.1e-14
>prophage 13
NZ_LN997848	Magnetospirillum sp. XM-1 isolate XM1 chromosome I	4825187	4762466	4773032	4825187	integrase	Acanthamoeba_polyphaga_mimivirus(12.5%)	13	NA	NA
WP_068437147.1|4762466_4765175_-	type I DNA topoisomerase	NA	A0A0G2YA05	Acanthamoeba_polyphaga_mimivirus	34.1	4.0e-94
WP_082700663.1|4765560_4766748_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	NA	NA	NA	NA
WP_068437151.1|4766813_4767098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052004201.1|4767148_4767451_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
WP_068438186.1|4767492_4767912_-	helix-turn-helix transcriptional regulator	NA	Q8W6G2	Sinorhizobium_phage	43.9	2.2e-20
WP_082700664.1|4768020_4768434_-	MucR family transcriptional regulator	NA	A0A1P8VVG0	Erythrobacter_phage	50.8	1.4e-22
WP_068437153.1|4768423_4768702_-	HU family DNA-binding protein	NA	B5TA87	Burkholderia_phage	55.6	2.4e-18
WP_068438188.1|4768780_4769128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156428832.1|4769622_4769994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082700665.1|4770133_4770604_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	39.8	3.0e-21
WP_068437168.1|4770610_4771888_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	42.8	2.2e-87
WP_082700666.1|4772165_4772447_-	helix-turn-helix transcriptional regulator	NA	A0A088CD40	Shigella_phage	43.3	9.8e-12
WP_068437170.1|4772480_4773032_-	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	37.3	2.0e-24
