The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011427	Pantoea vagans strain ND02 chromosome, complete genome	4313264	1031942	1139938	4313264	terminase,head,plate,protease,transposase,integrase,holin,portal,tRNA,capsid,tail	Enterobacteria_phage(22.92%)	119	1063452:1063470	1103733:1103751
WP_039329659.1|1031942_1033364_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_039329658.1|1033448_1033802_-	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_039329656.1|1033913_1034702_-	formate/nitrite transporter family protein	NA	NA	NA	NA	NA
WP_039327406.1|1035715_1037314_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_039327404.1|1037306_1037897_-	cysteine dioxygenase	NA	NA	NA	NA	NA
WP_039327400.1|1037893_1038877_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_039327397.1|1038876_1039965_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_039327393.1|1040158_1041349_-	NupC/NupG family nucleoside CNT transporter	NA	NA	NA	NA	NA
WP_039327390.1|1041718_1042960_+	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_039327388.1|1043004_1043343_-	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_039327385.1|1043502_1044495_-	L-glyceraldehyde 3-phosphate reductase	NA	NA	NA	NA	NA
WP_039327382.1|1044707_1046363_+	indolepyruvate decarboxylase	NA	NA	NA	NA	NA
WP_039327379.1|1046519_1047485_+	glucokinase	NA	NA	NA	NA	NA
WP_039327375.1|1047518_1048244_-	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	8.4e-15
WP_039327372.1|1048240_1049932_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_039327364.1|1050361_1050886_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_039327361.1|1051003_1052239_+	alanine transaminase	NA	NA	NA	NA	NA
WP_100701370.1|1052280_1052355_-	membrane protein YpdK	NA	NA	NA	NA	NA
WP_039327358.1|1052557_1053586_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_039327355.1|1053591_1055193_-	MFS transporter	NA	NA	NA	NA	NA
WP_039327351.1|1055343_1056129_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_039327348.1|1056136_1056589_+	universal stress protein	NA	NA	NA	NA	NA
WP_039327345.1|1056598_1057402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039327342.1|1057659_1057941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039327340.1|1058438_1059656_-	MFS transporter	NA	NA	NA	NA	NA
WP_039327337.1|1059934_1060174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039327414.1|1060212_1061112_-	EamA family transporter	NA	NA	NA	NA	NA
WP_039327334.1|1061294_1062170_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_039327412.1|1062443_1062722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039327408.1|1063146_1063377_+	hypothetical protein	NA	NA	NA	NA	NA
1063452:1063470	attL	TCCATTTAACTAAGGAGAC	NA	NA	NA	NA
WP_039332521.1|1063665_1064835_+|integrase	site-specific integrase	integrase	G3CFG6	Escherichia_phage	82.5	3.3e-194
WP_039332520.1|1064818_1065001_-	50S ribosomal protein L7/L12	NA	G3CFG7	Escherichia_phage	63.3	4.2e-16
WP_102136003.1|1065049_1065388_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	70.0	1.2e-37
WP_039332517.1|1065891_1066209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039332516.1|1066919_1067555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039332514.1|1067551_1067992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039332512.1|1068003_1068165_-	DUF1317 family protein	NA	A0A193GYJ8	Enterobacter_phage	50.0	1.0e-05
WP_039332509.1|1068148_1068688_-	hypothetical protein	NA	A0A2D1GNL9	Pseudomonas_phage	60.6	4.6e-50
WP_156138065.1|1069138_1069306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039332506.1|1069502_1070150_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	63.9	3.2e-74
WP_039332503.1|1070255_1070459_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	69.5	3.6e-16
WP_052206082.1|1070475_1071045_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	54.6	2.0e-48
WP_071885730.1|1071214_1071424_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	61.4	1.1e-12
WP_039332494.1|1071386_1072319_+	hypothetical protein	NA	U5P0A0	Shigella_phage	70.5	1.0e-44
WP_039332492.1|1072321_1072732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039332490.1|1072844_1073663_+	DNA-binding protein	NA	A0A2H4J902	uncultured_Caudovirales_phage	66.9	9.3e-87
WP_039332488.1|1073662_1074289_+	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	73.3	1.6e-86
WP_039332485.1|1074285_1075041_+	hypothetical protein	NA	A0A1R3Y5Q7	Salmonella_virus	87.6	1.2e-133
WP_039332476.1|1075049_1075415_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PH72	Enterobacteria_phage	57.6	5.7e-36
WP_039332475.1|1075411_1076416_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	50.0	3.2e-97
WP_039332474.1|1076439_1076868_+	antitermination protein Q	NA	U5P0A5	Shigella_phage	68.3	5.1e-44
WP_039332523.1|1077696_1078050_+|holin	phage holin, lambda family	holin	NA	NA	NA	NA
WP_039332471.1|1078033_1078666_+	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	49.3	5.2e-45
WP_039332469.1|1078653_1079127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052206079.1|1079325_1079685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039332467.1|1079816_1080155_+	HNH endonuclease	NA	F1C587	Cronobacter_phage	71.3	1.3e-42
WP_039332465.1|1080319_1080787_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	59.1	6.5e-45
WP_039332462.1|1080740_1082486_+|terminase	terminase large subunit	terminase	M4QNU0	Tetraselmis_viridis_virus	43.3	7.4e-134
WP_039332461.1|1082485_1083790_+|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	75.1	3.4e-192
WP_039332460.1|1083801_1084650_+|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	70.5	3.0e-104
WP_039332459.1|1084659_1085871_+|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	82.1	5.4e-184
WP_039335992.1|1086427_1086757_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	51.9	1.2e-21
WP_039335990.1|1086758_1087148_+|head	phage head closure protein	head	U5P0R0	Shigella_phage	56.6	1.8e-35
WP_039335988.1|1087140_1087647_+	hypothetical protein	NA	Q8HAC8	Salmonella_phage	79.5	1.2e-71
WP_039335987.1|1087643_1088204_+|transposase	transposase	transposase	A0A192Y5U4	Salmonella_phage	62.4	6.4e-63
WP_039335984.1|1088207_1088396_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	68.9	2.1e-10
WP_039335982.1|1088395_1089892_+|tail	tail sheath protein	tail	Q8W623	Enterobacteria_phage	66.8	3.2e-186
WP_039335980.1|1089891_1090248_+|tail	tail protein	tail	U5P076	Shigella_phage	83.9	4.2e-52
WP_039335978.1|1090244_1090568_+|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	64.5	3.8e-28
WP_039335976.1|1090652_1092488_+|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	58.3	6.7e-186
WP_039335974.1|1092524_1093856_+	DNA circularization protein	NA	Q8SBG8	Shigella_phage	54.3	1.3e-130
WP_039335972.1|1093852_1094926_+|plate	baseplate protein	plate	M1FN92	Enterobacteria_phage	67.4	8.9e-138
WP_039335970.1|1094925_1095483_+|plate	phage baseplate assembly protein	plate	Q8W617	Enterobacteria_phage	64.7	3.3e-59
WP_039335968.1|1095479_1095893_+	phage GP46 family protein	NA	A0A192Y6D0	Salmonella_phage	59.1	1.0e-41
WP_039335966.1|1095885_1096953_+|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	60.8	2.1e-123
WP_039335964.1|1096943_1097525_+	YmfQ family protein	NA	O22003	Shigella_phage	61.3	9.3e-65
WP_156138094.1|1097528_1098392_+	hypothetical protein	NA	U5P0I1	Shigella_phage	66.7	5.5e-21
WP_052206249.1|1098391_1098817_+|tail	tail fiber assembly protein	tail	A0A2P1JUG3	Erwinia_phage	53.2	8.4e-15
WP_039335960.1|1098843_1099938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039335959.1|1099934_1101290_-	glycosyltransferase	NA	I7HXI0	Enterobacteria_phage	25.1	1.0e-05
WP_039335957.1|1101834_1102077_-	DinI family protein	NA	K7P6H1	Enterobacteria_phage	67.1	3.3e-24
WP_039335955.1|1102161_1102482_+	hypothetical protein	NA	A0A2H4J4R6	uncultured_Caudovirales_phage	43.0	1.1e-19
WP_039335951.1|1103114_1103414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039335138.1|1103837_1104758_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	76.1	5.0e-113
1103733:1103751	attR	TCCATTTAACTAAGGAGAC	NA	NA	NA	NA
WP_039335168.1|1105002_1105617_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	W5SAS9	Pithovirus	26.9	4.8e-11
WP_039335140.1|1105616_1106276_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_039335170.1|1106331_1107072_+	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_039335142.1|1107068_1107302_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_039335144.1|1107298_1107784_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_039335146.1|1107780_1109739_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_038645648.1|1109735_1110293_+	DsbE family thiol:disulfide interchange protein	NA	NA	NA	NA	NA
WP_039335149.1|1110289_1110745_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_039335151.1|1110744_1111956_+	c-type cytochrome biogenesis protein CcmI	NA	NA	NA	NA	NA
WP_039335156.1|1111991_1112759_+	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_052206202.1|1112791_1114303_-	MFS transporter	NA	NA	NA	NA	NA
WP_039335160.1|1114409_1115306_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_039335162.1|1115350_1116634_-	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_081998136.1|1116992_1117289_+	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_039335164.1|1117508_1118819_+	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_059109770.1|1118818_1120948_+	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_039336074.1|1121143_1121626_+	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_039336057.1|1121672_1122221_-	endonuclease SmrB	NA	NA	NA	NA	NA
WP_039336059.1|1122377_1123310_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_039336061.1|1123355_1124441_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.5	4.8e-91
WP_039336063.1|1124448_1125273_+	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_039336065.1|1125405_1126203_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_039336067.1|1126270_1126816_+	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_039336069.1|1126847_1127129_+	YfcL family protein	NA	NA	NA	NA	NA
WP_039336075.1|1127159_1129172_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_039336070.1|1129327_1130548_+	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_039336071.1|1130799_1131981_+	MFS transporter	NA	NA	NA	NA	NA
WP_039336072.1|1131943_1133380_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_039336073.1|1133466_1133910_+	rhodanese	NA	NA	NA	NA	NA
WP_039337204.1|1133911_1134943_-	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_039337202.1|1135057_1135963_-	DMT family transporter	NA	NA	NA	NA	NA
WP_039337200.1|1136057_1136837_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_039337198.1|1136894_1138019_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	28.8	2.3e-19
WP_039337196.1|1138121_1139132_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_064511439.1|1139131_1139938_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP011427	Pantoea vagans strain ND02 chromosome, complete genome	4313264	1321270	1327095	4313264		Enterobacteria_phage(50.0%)	6	NA	NA
WP_039327814.1|1321270_1322164_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	39.7	6.0e-47
WP_039327816.1|1322208_1323222_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	43.4	8.6e-74
WP_039327818.1|1323661_1324741_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.4	1.6e-102
WP_039327821.1|1324740_1325628_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	33.4	2.8e-28
WP_039327823.1|1325665_1326547_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	62.7	2.0e-103
WP_039327824.1|1326546_1327095_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	54.7	7.7e-53
>prophage 3
NZ_CP011427	Pantoea vagans strain ND02 chromosome, complete genome	4313264	1588475	1670861	4313264	head,plate,terminase,protease,lysis,integrase,portal,tRNA,capsid,tail	Erwinia_phage(48.94%)	86	1623614:1623636	1658634:1658656
WP_039335489.1|1588475_1590206_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	34.5	3.8e-90
WP_102136008.1|1590810_1591371_+	VOC family protein	NA	NA	NA	NA	NA
WP_039335295.1|1591367_1592507_-	putative C-S lyase	NA	NA	NA	NA	NA
WP_039335297.1|1592592_1593345_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_039335298.1|1593515_1594376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039335299.1|1594447_1595545_-	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_039335300.1|1595720_1596341_+	LysE family translocator	NA	NA	NA	NA	NA
WP_039335301.1|1596344_1597313_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_039335302.1|1597309_1598038_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	NA	NA	NA	NA
WP_039335303.1|1598113_1598935_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	73.2	5.2e-45
WP_039335305.1|1599169_1600951_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	26.1	1.4e-10
WP_039335307.1|1600950_1601382_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_034828649.1|1601705_1602449_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_039335309.1|1602486_1603014_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	29.0	2.0e-10
WP_039335313.1|1603220_1603835_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_039335316.1|1603843_1604848_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.9	2.4e-07
WP_039335318.1|1604893_1605679_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_039335321.1|1605678_1606431_-	zinc ABC transporter ATP-binding protein ZnuC	NA	R4TX06	Phaeocystis_globosa_virus	33.0	2.4e-12
WP_039335323.1|1606508_1607480_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_039335325.1|1607494_1608823_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	43.5	2.2e-16
WP_039335326.1|1608950_1609925_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_039335328.1|1609999_1611235_-	MFS transporter	NA	NA	NA	NA	NA
WP_039335330.1|1611329_1612772_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_039335491.1|1612883_1613735_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_039335333.1|1614099_1615575_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	35.6	1.1e-77
WP_039335335.1|1615759_1616398_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_039335337.1|1616438_1617617_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_039335339.1|1617778_1618420_+	DUF533 domain-containing protein	NA	NA	NA	NA	NA
WP_039335341.1|1618634_1620698_+	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_039335344.1|1620691_1621360_-	exodeoxyribonuclease X	NA	NA	NA	NA	NA
WP_039335346.1|1621367_1621598_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	9.1e-16
WP_039335493.1|1621751_1622129_+	copper homeostasis periplasmic binding protein CopC	NA	NA	NA	NA	NA
WP_039335348.1|1622132_1623014_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_102136031.1|1623045_1623390_+	YebY family protein	NA	NA	NA	NA	NA
1623614:1623636	attL	AATCGTATTGGGTCTTTTTTTGT	NA	NA	NA	NA
WP_039335350.1|1623703_1624768_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4S6G4	Salmonella_phage	56.7	2.3e-117
WP_071885735.1|1624876_1625095_-	transcriptional regulator	NA	F1BUT0	Erwinia_phage	77.8	3.4e-28
WP_039335351.1|1625175_1626351_-	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	67.6	1.0e-147
WP_039335352.1|1626347_1626875_-|tail	phage tail protein	tail	F1BUT6	Erwinia_phage	72.7	1.1e-61
WP_039335353.1|1626878_1629341_-|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	54.7	4.0e-202
WP_071885736.1|1629330_1629456_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	74.3	9.9e-09
WP_039335354.1|1629488_1629767_-|tail	phage tail assembly protein	tail	F1BUU0	Erwinia_phage	72.2	2.1e-30
WP_039335355.1|1629831_1630341_-|tail	phage major tail tube protein	tail	F1BUU2	Erwinia_phage	74.7	2.0e-71
WP_039335356.1|1630353_1631523_-|tail	phage tail sheath protein	tail	F1BUU3	Erwinia_phage	87.7	1.6e-196
WP_039335357.1|1631660_1631951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081998138.1|1631950_1632604_-|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	47.2	1.1e-42
WP_102136032.1|1632603_1633833_-|tail	tail fiber protein	tail	K7P7Q7	Enterobacteria_phage	53.6	5.6e-35
WP_039335358.1|1634618_1635227_-|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	75.2	8.4e-85
WP_039335359.1|1635219_1636128_-|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	81.1	7.3e-133
WP_039335360.1|1636132_1636483_-|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	72.4	9.2e-44
WP_039335361.1|1636479_1637070_-|plate	phage baseplate assembly protein V	plate	F1BUP5	Erwinia_phage	77.4	1.4e-79
WP_039335362.1|1637232_1637607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039335503.1|1637657_1638677_+	DUF4917 family protein	NA	NA	NA	NA	NA
WP_039335363.1|1638679_1639135_-	phage virion morphogenesis protein	NA	F1BUP7	Erwinia_phage	65.8	1.9e-44
WP_039335365.1|1639131_1639599_-|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	72.4	1.8e-58
WP_039335505.1|1639673_1640123_-|lysis	phage lysis regulatory protein, LysB family	lysis	F1BUQ1	Erwinia_phage	68.7	1.4e-47
WP_039335366.1|1640119_1640632_-	lysozyme	NA	E5G6N1	Salmonella_phage	75.7	1.2e-71
WP_081998140.1|1640612_1640822_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	50.7	2.4e-15
WP_039335368.1|1640836_1641043_-|tail	tail protein X	tail	F1BUQ5	Erwinia_phage	75.8	8.1e-24
WP_039335369.1|1641039_1641507_-|head	head completion/stabilization protein	head	F1BUQ6	Erwinia_phage	77.4	3.8e-61
WP_039335370.1|1641597_1642266_-|terminase	terminase endonuclease subunit	terminase	F1BUQ7	Erwinia_phage	76.6	1.7e-91
WP_039335371.1|1642269_1643343_-|capsid	phage major capsid protein, P2 family	capsid	F1BUQ8	Erwinia_phage	82.0	5.0e-165
WP_039335372.1|1643374_1644223_-|capsid	GPO family capsid scaffolding protein	capsid	F1BUR1	Erwinia_phage	71.4	5.4e-106
WP_039335374.1|1644368_1646132_+|terminase	terminase ATPase subunit family protein	terminase	F1BUR2	Erwinia_phage	93.0	0.0e+00
WP_039335375.1|1646131_1647154_+|portal	phage portal protein	portal	F1BUR7	Erwinia_phage	84.8	3.4e-171
WP_039335376.1|1647164_1648895_-	RNA-directed DNA polymerase	NA	Q7M2A9	Enterobacteria_phage	30.0	4.9e-13
WP_052206215.1|1649754_1652040_-	replication endonuclease	NA	F1BUS0	Erwinia_phage	69.0	5.4e-294
WP_039335380.1|1652055_1652640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039335381.1|1652636_1652864_-	TraR/DksA family transcriptional regulator	NA	F1BUS2	Erwinia_phage	60.3	9.6e-18
WP_052206213.1|1652863_1653094_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_039335382.1|1653160_1653502_-	DUF5347 domain-containing protein	NA	A0A1S6L019	Salmonella_phage	53.1	5.5e-25
WP_071885737.1|1653465_1653654_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	51.7	9.4e-11
WP_039335513.1|1653663_1654173_-	phage regulatory CII family protein	NA	F1BUS6	Erwinia_phage	73.2	9.0e-64
WP_039335383.1|1654204_1654606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039335386.1|1654720_1655563_+	phage repressor protein CI	NA	Q6K1G0	Salmonella_virus	49.8	2.7e-73
WP_039335388.1|1655612_1657271_+	AAA family ATPase	NA	C7BGE8	Burkholderia_phage	27.5	1.3e-05
WP_039335390.1|1657263_1658460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039335391.1|1658790_1659117_+	hypothetical protein	NA	M1PRT9	Cellulophaga_phage	52.9	4.4e-24
1658634:1658656	attR	AATCGTATTGGGTCTTTTTTTGT	NA	NA	NA	NA
WP_039335393.1|1659434_1659713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039335395.1|1660205_1660853_+	serine/threonine protein phosphatase	NA	Q8HA16	Enterobacteria_phage	46.5	2.4e-53
WP_039335397.1|1660856_1662281_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_039335399.1|1662356_1664990_-	PqiB family protein	NA	NA	NA	NA	NA
WP_039335401.1|1664958_1666203_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_039335404.1|1666420_1666921_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_039335405.1|1667017_1667704_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_039335406.1|1667723_1669760_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	34.2	8.8e-86
WP_039335407.1|1669979_1670861_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 4
NZ_CP011427	Pantoea vagans strain ND02 chromosome, complete genome	4313264	2112852	2161280	4313264	terminase,head,coat,lysis,integrase,tail	Cronobacter_phage(21.28%)	61	2107686:2107707	2169818:2169839
2107686:2107707	attL	CAGGTGCGCATGAATGCGCACC	NA	NA	NA	NA
WP_039333605.1|2112852_2113254_-|tail	tail assembly chaperone	tail	K7P7H0	Enterobacteria_phage	50.0	3.7e-28
WP_081998115.1|2114426_2114645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081998113.1|2114633_2115608_-	hypothetical protein	NA	A0A2P1CKS0	Pantoea_phage	42.8	2.1e-61
WP_052206122.1|2115607_2118742_-	host specificity protein J	NA	Q5G8W0	Enterobacteria_phage	71.1	0.0e+00
WP_039333588.1|2118751_2119276_-|tail	tail assembly protein	tail	H6WRW3	Salmonella_phage	56.3	5.3e-43
WP_059109791.1|2119218_2119944_-|tail	phage tail protein	tail	A0A1V0E5M9	Salmonella_phage	66.8	4.8e-95
WP_039330920.1|2119943_2120648_-|tail	phage minor tail protein L	tail	H6WRW1	Salmonella_phage	74.8	5.2e-102
WP_039330922.1|2120644_2120998_-|tail	phage tail protein	tail	H6WRV8	Salmonella_phage	65.0	1.0e-37
WP_052206037.1|2121006_2124150_-	tape measure protein	NA	H6WRV7	Salmonella_phage	43.3	1.6e-86
WP_039330924.1|2124415_2124622_+	hypothetical protein	NA	H6WRV6	Salmonella_phage	43.5	3.7e-08
WP_039330926.1|2124744_2125431_-	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	59.5	1.3e-73
WP_039330927.1|2125480_2126224_-	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	66.4	2.3e-84
WP_039330929.1|2126245_2126632_-	hypothetical protein	NA	F1C5E4	Cronobacter_phage	74.6	1.9e-53
WP_039330931.1|2126628_2126997_-	hypothetical protein	NA	F1C5E3	Cronobacter_phage	68.9	9.7e-44
WP_039330933.1|2126999_2127347_-	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	65.2	6.4e-37
WP_071885741.1|2127348_2127516_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_039330935.1|2127515_2127893_-	hypothetical protein	NA	A0A0M3LQS8	Mannheimia_phage	46.4	8.2e-22
WP_039330937.1|2127895_2128297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039330939.1|2128306_2129383_-|coat	phage coat protein	coat	F1C5E1	Cronobacter_phage	76.3	2.1e-155
WP_039330941.1|2129393_2129834_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	65.1	5.8e-43
WP_039330943.1|2129837_2131034_-	hypothetical protein	NA	F1C5D9	Cronobacter_phage	50.5	2.2e-100
WP_039330945.1|2131059_2131938_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	66.8	1.2e-108
WP_039330947.1|2131942_2133409_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	72.1	2.0e-193
WP_039330949.1|2133418_2134891_-|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	83.6	5.3e-250
WP_039330951.1|2134893_2135493_-	hypothetical protein	NA	G8C7P2	Escherichia_phage	73.6	5.4e-68
WP_052206038.1|2135792_2136128_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_039330953.1|2136243_2136558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039330955.1|2137110_2137494_-	hypothetical protein	NA	R9TPM9	Aeromonas_phage	42.6	6.0e-12
WP_039330957.1|2137490_2137982_-	lysozyme	NA	A5LH83	Enterobacteria_phage	71.5	2.3e-64
WP_039331022.1|2137984_2138230_-|lysis	lysis protein	lysis	A0A127KNH9	Pseudomonas_phage	37.7	2.2e-07
WP_039330961.1|2140427_2141030_-	hypothetical protein	NA	A0A2H4JCH5	uncultured_Caudovirales_phage	87.4	1.1e-97
WP_039330963.1|2141141_2141759_-	protein ninG	NA	A0A1P8DTE0	Proteus_phage	52.9	2.5e-52
WP_039330965.1|2142234_2142453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039330967.1|2142445_2142904_-	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	65.3	8.4e-53
WP_039330969.1|2143283_2144039_-	hypothetical protein	NA	A0A1R3Y5Q7	Salmonella_virus	90.8	1.9e-139
WP_039330971.1|2144129_2144825_-	DNA replication protein	NA	A0A2H4J1B6	uncultured_Caudovirales_phage	67.7	8.4e-81
WP_081998089.1|2144821_2145682_-	replication protein	NA	K7PGZ0	Enterobacteria_phage	70.0	5.5e-90
WP_039330975.1|2145735_2146566_-	DNA-binding protein	NA	A0A2H4J902	uncultured_Caudovirales_phage	73.0	3.8e-104
WP_039330978.1|2146602_2146875_-	hypothetical protein	NA	I6RSP4	Salmonella_phage	65.0	8.0e-19
WP_039330980.1|2147009_2147213_-	hypothetical protein	NA	K7PLQ6	Enterobacteria_phage	52.4	3.9e-10
WP_039330981.1|2147313_2148021_+	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	60.4	1.7e-73
WP_013512152.1|2148132_2148231_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_039330982.1|2148269_2148482_+	hypothetical protein	NA	A0A1P8DTH3	Proteus_phage	46.8	9.0e-10
WP_039330983.1|2148564_2149485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039330984.1|2149537_2149720_-	hypothetical protein	NA	G8C7T7	Escherichia_phage	51.0	5.7e-05
WP_039330985.1|2150107_2150434_+	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	57.4	9.0e-09
WP_039330986.1|2150491_2150854_-	anti-adapter protein IraP	NA	NA	NA	NA	NA
WP_071885769.1|2151014_2151152_-	DUF2256 domain-containing protein	NA	NA	NA	NA	NA
WP_071885743.1|2151132_2151396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039330987.1|2151515_2152628_+	hypothetical protein	NA	A0A077KCC0	Edwardsiella_phage	69.0	1.5e-34
WP_039330988.1|2152662_2152842_+	hypothetical protein	NA	A0A2H4JCE4	uncultured_Caudovirales_phage	56.9	3.4e-10
WP_156138052.1|2152838_2152982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039330989.1|2152978_2153296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039330990.1|2153295_2154114_+	exodeoxyribonuclease VIII	NA	E5AGE0	Erwinia_phage	76.0	1.3e-125
WP_039330991.1|2154110_2155010_+	DNA recombination protein RecT	NA	E5AGD9	Erwinia_phage	73.1	3.5e-119
WP_156138053.1|2155674_2156451_-	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_039330992.1|2156585_2157470_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	50.0	7.2e-85
WP_039330993.1|2157466_2159326_+	DNA methyltransferase	NA	H9C171	Pectobacterium_phage	55.6	4.7e-219
WP_039331026.1|2159325_2159556_+	hypothetical protein	NA	A0A2H4J398	uncultured_Caudovirales_phage	63.2	9.4e-21
WP_039330994.1|2159721_2159970_+	excisionase family protein	NA	S4TND0	Salmonella_phage	53.4	2.9e-15
WP_039330995.1|2160002_2161280_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	51.5	4.8e-130
2169818:2169839	attR	CAGGTGCGCATGAATGCGCACC	NA	NA	NA	NA
>prophage 5
NZ_CP011427	Pantoea vagans strain ND02 chromosome, complete genome	4313264	3010848	3018550	4313264	tRNA	uncultured_Mediterranean_phage(50.0%)	9	NA	NA
WP_039330017.1|3010848_3011319_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	46.1	3.9e-29
WP_039330015.1|3011412_3012516_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.3	6.7e-48
WP_034831027.1|3012519_3012969_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_039330013.1|3013141_3013579_+	peptidoglycan-binding protein LysM	NA	G3MBQ1	Bacillus_virus	51.9	2.5e-06
WP_039330012.1|3013593_3014157_+	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_039330010.1|3014215_3015184_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	42.2	2.5e-46
WP_071885749.1|3015194_3017042_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_034831018.1|3017067_3017400_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	36.3	2.6e-11
WP_039330004.1|3017425_3018550_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	45.6	9.4e-90
>prophage 6
NZ_CP011427	Pantoea vagans strain ND02 chromosome, complete genome	4313264	3104645	3113375	4313264		Streptococcus_phage(28.57%)	9	NA	NA
WP_039333128.1|3104645_3106391_-	amylovoran biosynthesis protein AmsF	NA	A0A1S6L3G8	Erwinia_phage	44.5	1.1e-142
WP_039333130.1|3106592_3106886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039333132.1|3106882_3107233_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	50.9	1.2e-22
WP_039333135.1|3107229_3107697_-	glycoside hydrolase family protein	NA	H9C148	Vibrio_phage	44.0	4.7e-27
WP_039333138.1|3107869_3108148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039333142.1|3108561_3109293_-	helix-turn-helix transcriptional regulator	NA	A0A2I6PIE7	Escherichia_phage	36.2	1.5e-43
WP_039333145.1|3109646_3110900_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.7	3.5e-93
WP_039333147.1|3110910_3112014_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.0	1.0e-59
WP_039333149.1|3112259_3113375_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	55.2	3.4e-108
>prophage 7
NZ_CP011427	Pantoea vagans strain ND02 chromosome, complete genome	4313264	3347676	3412289	4313264	plate,transposase,tRNA	uncultured_Caudovirales_phage(22.22%)	53	NA	NA
WP_039329413.1|3347676_3350496_-|tRNA	isoleucine--tRNA ligase	tRNA	K7YVP8	Megavirus	25.7	1.8e-76
WP_039329415.1|3350523_3351462_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_034826107.1|3351780_3352044_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_039329417.1|3352105_3352999_-	transcriptional activator NhaR	NA	NA	NA	NA	NA
WP_039329419.1|3353029_3354208_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	50.4	4.8e-84
WP_039329421.1|3354374_3355520_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	32.1	3.7e-25
WP_039329423.1|3355624_3357535_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.9	2.0e-148
WP_039329574.1|3357747_3359049_-	MFS transporter	NA	NA	NA	NA	NA
WP_039329424.1|3359162_3359750_-	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_039329426.1|3359873_3360827_-	transaldolase	NA	A0A127KNC6	Cyanophage	30.9	1.3e-10
WP_039329428.1|3361040_3361814_+	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_034826128.1|3361918_3362350_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_039329430.1|3362346_3362871_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_039329576.1|3362851_3363931_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_039329432.1|3363894_3365664_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_081998075.1|3365689_3367282_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_039329435.1|3367355_3367925_-	DUF3592 domain-containing protein	NA	NA	NA	NA	NA
WP_039329437.1|3368050_3368914_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_039329439.1|3368946_3369810_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_102136037.1|3369848_3370697_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_052205985.1|3370750_3371644_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_158649443.1|3371761_3374572_-	protein ImpG/VasA	NA	NA	NA	NA	NA
WP_039329443.1|3375002_3376175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039329446.1|3376215_3377187_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_059109811.1|3377214_3377724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039329450.1|3377982_3378987_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_039329452.1|3379165_3380029_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_156138045.1|3380040_3380316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039329453.1|3380880_3381909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039329455.1|3382113_3383142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039329457.1|3383138_3385958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039329458.1|3385982_3386249_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_052205989.1|3386267_3388655_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.5	2.1e-06
WP_039329460.1|3388654_3391300_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	29.7	1.5e-93
WP_039329461.1|3391498_3391990_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_039329462.1|3392006_3393704_-	OmpA family protein	NA	NA	NA	NA	NA
WP_039329464.1|3393714_3394377_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_039329466.1|3394373_3395723_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_039329468.1|3395737_3397270_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_039329469.1|3397297_3397792_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_039329471.1|3398561_3399848_-	threonine synthase	NA	NA	NA	NA	NA
WP_039329582.1|3399851_3400781_-	homoserine kinase	NA	NA	NA	NA	NA
WP_039329473.1|3400783_3403246_-	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_071813620.1|3403330_3403465_-	thr operon leader peptide	NA	NA	NA	NA	NA
WP_039329474.1|3403604_3404294_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_039329476.1|3404902_3405619_+	two-component system response regulator ArcA	NA	NA	NA	NA	NA
WP_039329478.1|3405667_3406141_-	protein CreA	NA	NA	NA	NA	NA
WP_039329480.1|3406335_3407217_+	MDR efflux pump AcrAB transcriptional activator RobA	NA	NA	NA	NA	NA
WP_039329482.1|3407349_3407997_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
WP_039329483.1|3408048_3408567_+	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_039329485.1|3408568_3408892_-	trp operon repressor	NA	NA	NA	NA	NA
WP_039329486.1|3408936_3410856_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	39.7	1.5e-10
WP_102136018.1|3410916_3412289_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	46.9	4.4e-65
