The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP008697	Escherichia coli strain ST648 isolate Pleural Effusion of Patients with Empyema Thoracis chromosome, complete genome	5056598	271593	396769	5056598	portal,terminase,head,tRNA,integrase,lysis,tail,protease,holin,capsid,plate,transposase	Enterobacteria_phage(23.29%)	127	374941:374956	396193:396208
WP_000187016.1|271593_272694_-|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_016235454.1|273062_274907_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.6	5.5e-10
WP_000201825.1|274851_275709_+	glutamate racemase	NA	NA	NA	NA	NA
WP_000236980.1|281214_281658_-	acetyltransferase	NA	NA	NA	NA	NA
WP_001122786.1|281814_282744_+	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_022646399.1|283012_284614_+	malate synthase A	NA	NA	NA	NA	NA
WP_000857856.1|284643_285948_+	isocitrate lyase	NA	NA	NA	NA	NA
WP_022646400.1|286033_287758_+	bifunctional isocitrate dehydrogenase kinase/phosphatase	NA	NA	NA	NA	NA
WP_000226403.1|287774_288599_-	glyoxylate bypass operon transcriptional repressor IclR	NA	NA	NA	NA	NA
WP_001572176.1|288798_292482_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
WP_000956822.1|292701_294333_+	Na/Pi cotransporter family protein	NA	NA	NA	NA	NA
WP_022646401.1|294422_295112_-	dipeptidase PepE	NA	NA	NA	NA	NA
WP_000610344.1|295234_296047_-	shikimate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000858564.1|296039_297269_-	L-sorbose 1-phosphate reductase	NA	NA	NA	NA	NA
WP_022646402.1|297320_298145_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_000406332.1|298155_298953_-	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_001027853.1|299018_299513_-	PTS system mannose/fructose/N-acetylgalactosamine-transporter subunit IIB	NA	NA	NA	NA	NA
WP_000245629.1|299512_299920_-	PTS sorbose transporter subunit IIA	NA	NA	NA	NA	NA
WP_001195407.1|299929_300736_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000431660.1|300805_301753_-	sugar-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_060684344.1|302100_303039_+	23S rRNA pseudouridine(2604) synthase RluF	NA	NA	NA	NA	NA
WP_001207638.1|302972_303245_-	DUF3811 domain-containing protein	NA	NA	NA	NA	NA
WP_022646404.1|303773_304901_+	slipin family protein	NA	NA	NA	NA	NA
WP_022646405.1|304906_305698_+	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	45.1	2.0e-46
WP_022646406.1|305711_306167_-	hypothetical protein	NA	F6MIM0	Haemophilus_phage	42.7	6.6e-26
WP_022646407.1|306163_306871_-	DUF4376 domain-containing protein	NA	A0A0E3JQ06	Enterobacteria_phage	42.4	5.3e-14
WP_022646408.1|306867_308478_-|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	39.1	3.8e-84
WP_060684345.1|308480_309197_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	37.2	7.0e-22
WP_022646410.1|309189_310305_-|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	51.7	2.0e-100
WP_022646411.1|310295_310655_-	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	64.2	1.1e-34
WP_000679403.1|310753_311455_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	36.3	6.4e-12
WP_022646412.1|311464_312505_-	phage late control D family protein	NA	A4JWL3	Burkholderia_virus	45.1	2.0e-73
WP_001269711.1|312492_312702_-|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	60.3	1.3e-16
WP_022646413.1|312701_313655_-|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	50.8	3.3e-35
WP_015674804.1|316132_316261_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_022646415.1|316220_316538_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907502.1|316588_317113_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.0	9.5e-69
WP_022646416.1|317112_318537_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.2	7.0e-191
WP_000875310.1|318526_318724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022646417.1|318720_319176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000777272.1|319320_319635_-	membrane protein	NA	Q5ZQY8	Pseudomonas_phage	43.2	9.2e-19
WP_000266448.1|319647_320253_-	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	57.1	3.3e-57
WP_022646418.1|320255_320543_-|holin	putative holin	holin	Q6QIC8	Burkholderia_phage	48.6	3.9e-16
WP_000619864.1|321080_321428_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	49.0	2.2e-21
WP_013362812.1|323193_324162_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	100.0	1.6e-186
WP_001617865.1|324196_325072_-	class A extended-spectrum beta-lactamase CTX-M-14	NA	A0A1B0VBP7	Salmonella_phage	99.6	6.1e-153
WP_000608644.1|325321_326584_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_022646420.1|327522_329172_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000757333.1|329526_329769_+	polysaccharide production threonine-rich protein	NA	NA	NA	NA	NA
WP_001296632.1|329882_330521_+	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_060684348.1|330517_331255_+	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_001295279.1|333399_333678_-	periplasmic protein	NA	NA	NA	NA	NA
WP_000202902.1|333891_334302_+	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_001252058.1|334395_335286_-	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_022646423.1|335300_336845_-	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_000695389.1|336998_338189_-	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000179165.1|338553_339669_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
WP_000973665.1|339740_341081_+	maltoporin LamB	NA	NA	NA	NA	NA
WP_000783444.1|341232_342153_+	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_022646424.1|342380_343961_+	SopA family protein	NA	NA	NA	NA	NA
WP_001308201.1|344183_344681_+	chorismate lyase	NA	NA	NA	NA	NA
WP_000455227.1|344693_345566_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000017354.1|345720_348144_-	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000002907.1|348314_348683_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000646078.1|348792_349401_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_001361471.1|349473_350799_+	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_001296638.1|350914_351124_+	CsbD family protein	NA	NA	NA	NA	NA
WP_000416263.1|351165_351681_-	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_022646425.1|351998_353003_+	DUF2713 family protein	NA	NA	NA	NA	NA
WP_001300034.1|353364_353487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060684349.1|353722_354295_+	SocA family protein	NA	NA	NA	NA	NA
WP_014640052.1|354324_354711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023908888.1|354750_354924_+	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	94.7	1.4e-21
WP_001093916.1|354971_355253_-	pyocin activator PrtN family protein	NA	K7PGU0	Enterobacteria_phage	96.8	2.8e-43
WP_024946495.1|355289_356042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023908886.1|356260_357085_-	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	3.0e-149
WP_000135686.1|357150_357513_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	1.5e-60
WP_021530636.1|358180_358855_-	LexA family transcriptional regulator	NA	Q8SBF6	Shigella_phage	100.0	3.5e-132
WP_021527487.1|358945_359146_+	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	98.5	1.3e-31
WP_024946496.1|359189_359747_+	hypothetical protein	NA	K7PGU3	Enterobacteria_phage	93.5	1.0e-92
WP_071789194.1|359922_360102_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	4.6e-15
WP_023908882.1|360091_361033_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	92.3	3.2e-139
WP_023908881.1|361029_361518_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	93.2	8.6e-80
WP_001401088.1|361517_362171_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	3.3e-127
WP_000210154.1|362167_362494_+	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	99.1	2.7e-53
WP_000767133.1|362490_362880_+	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	99.2	1.6e-68
WP_023908880.1|362899_363709_+	KilA-N domain-containing protein	NA	A5LH75	Enterobacteria_phage	99.6	8.2e-152
WP_023908878.1|364720_365473_+	antitermination protein	NA	K7PGU5	Enterobacteria_phage	97.2	4.2e-134
WP_001181554.1|365665_365869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024946499.1|365998_366334_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	93.7	2.5e-54
WP_021543581.1|366337_366814_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	94.3	6.2e-83
WP_023908876.1|366810_367254_+|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	94.6	2.3e-71
WP_021543580.1|367292_367667_+	hypothetical protein	NA	M1FPD9	Enterobacteria_phage	96.0	1.8e-61
WP_000699783.1|367784_367988_+	hypothetical protein	NA	A0A1W6JPG4	Morganella_phage	52.9	4.9e-13
WP_024946501.1|368053_368404_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	96.6	1.2e-62
WP_000929184.1|368530_369025_+|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	100.0	2.3e-88
WP_065312442.1|369258_370755_+|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.6	1.7e-299
WP_000605605.1|370766_370949_+	hypothetical protein	NA	S5FXQ9	Shigella_phage	98.3	3.8e-25
WP_023908874.1|370948_372190_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.0	2.9e-241
WP_001193633.1|372167_372818_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	99.5	7.3e-119
WP_023908873.1|372832_374038_+|capsid	phage major capsid protein	capsid	A0A1B5FPI9	Escherichia_phage	99.0	1.7e-222
WP_023908872.1|374087_374276_+	hypothetical protein	NA	A0A1B5FP98	Escherichia_phage	93.5	8.8e-25
WP_021543573.1|374287_374593_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B5FP86	Escherichia_phage	87.1	3.9e-38
WP_021543572.1|374602_374941_+|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	84.8	4.6e-48
WP_021543571.1|374937_375387_+	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	78.5	1.3e-61
374941:374956	attL	ACGGATTTTAGTCTGG	NA	NA	NA	NA
WP_021543570.1|375383_375728_+	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	94.7	1.9e-54
WP_023908871.1|375787_376492_+	immunoglobulin domain-containing protein	NA	A0A1B5FP82	Escherichia_phage	90.6	1.8e-110
WP_021543568.1|376506_376878_+|tail	phage tail assembly chaperone	tail	A0A1B5FP91	Escherichia_phage	90.2	3.1e-58
WP_021543567.1|376901_377180_+	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	80.4	1.5e-33
WP_021543566.1|377238_377580_+	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	64.5	7.6e-35
WP_024946502.1|377624_380867_+|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	88.8	0.0e+00
WP_023908869.1|380859_381201_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	66.4	7.9e-40
WP_021543563.1|381200_381899_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	98.3	1.8e-131
WP_032152077.1|381903_382647_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	99.2	4.4e-152
WP_000741576.1|382544_383192_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	98.6	2.7e-113
WP_060684350.1|383252_386732_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.0	0.0e+00
WP_001228252.1|386799_387399_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	92.5	3.4e-102
WP_022646430.1|387463_389812_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0E3M0V5	Enterobacteria_phage	46.3	9.5e-92
WP_022646431.1|389808_390090_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	50.0	4.1e-18
WP_001595444.1|390099_390804_+|tail	tail fiber domain-containing protein	tail	A0A1X7QGH6	Escherichia_phage	61.7	7.0e-59
WP_022646432.1|390814_391102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217539.1|391212_391461_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
WP_000332260.1|391522_392620_-|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.2	4.0e-210
WP_000543825.1|392708_393746_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000891408.1|393879_394122_+	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_022646433.1|394287_395271_-	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000918363.1|395353_396769_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
396193:396208	attR	CCAGACTAAAATCCGT	NA	NA	NA	NA
>prophage 2
NZ_CP008697	Escherichia coli strain ST648 isolate Pleural Effusion of Patients with Empyema Thoracis chromosome, complete genome	5056598	479992	499135	5056598	tail,holin,tRNA,transposase	Burkholderia_phage(27.27%)	17	NA	NA
WP_022646456.1|479992_481510_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	1.2e-87
WP_022646457.1|481746_483204_-	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.6	4.0e-48
WP_001296667.1|483262_485410_-	lysine decarboxylase CadA	NA	NA	NA	NA	NA
WP_000092909.1|485489_486824_-	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
WP_015674804.1|488681_488810_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_022646415.1|488769_489087_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907502.1|489137_489662_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.0	9.5e-69
WP_022646416.1|489661_491086_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.2	7.0e-191
WP_000875310.1|491075_491273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022646417.1|491269_491725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000777272.1|491869_492184_-	membrane protein	NA	Q5ZQY8	Pseudomonas_phage	43.2	9.2e-19
WP_060684353.1|492196_492802_-	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	56.1	3.3e-57
WP_022646418.1|492806_493094_-|holin	putative holin	holin	Q6QIC8	Burkholderia_phage	48.6	3.9e-16
WP_000619864.1|493631_493979_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	49.0	2.2e-21
WP_013362812.1|495744_496713_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	100.0	1.6e-186
WP_001617865.1|496747_497623_-	class A extended-spectrum beta-lactamase CTX-M-14	NA	A0A1B0VBP7	Salmonella_phage	99.6	6.1e-153
WP_000608644.1|497872_499135_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
>prophage 3
NZ_CP008697	Escherichia coli strain ST648 isolate Pleural Effusion of Patients with Empyema Thoracis chromosome, complete genome	5056598	601913	673386	5056598	protease,holin,tRNA,transposase	Vibrio_phage(12.5%)	57	NA	NA
WP_060684359.1|601913_603266_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_001232240.1|603448_603835_+	cytochrome b562	NA	NA	NA	NA	NA
WP_060684360.1|603879_604344_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	56.4	1.1e-52
WP_000187778.1|604501_606640_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
WP_001339491.1|607033_608689_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_001299664.1|608738_610160_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_001181324.1|610278_611226_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
WP_001387276.1|611410_611464_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_000471889.1|611603_614300_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_000047538.1|614505_614892_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148581.1|614964_615426_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013046.1|615438_616374_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
WP_001296693.1|616377_616512_-	pyr operon leader peptide	NA	NA	NA	NA	NA
WP_000230277.1|616792_617188_-	RidA family protein	NA	NA	NA	NA	NA
WP_000500725.1|617318_618032_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000256670.1|618102_618696_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001353502.1|618840_619293_+	toxin-antitoxin biofilm protein TabA	NA	NA	NA	NA	NA
WP_024946506.1|619415_620999_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_023908892.1|621166_622180_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000002953.1|622341_622758_+	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_001059402.1|622902_623406_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_023908893.1|623597_624794_+	DUF898 domain-containing protein	NA	NA	NA	NA	NA
WP_060684361.1|624849_627705_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.4	3.3e-139
WP_000786399.1|627704_628148_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|628406_629918_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000584117.1|630184_631285_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001295681.1|631284_632367_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_001514874.1|632527_634030_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.6	7.9e-84
WP_001300770.1|634159_635179_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	1.4e-44
WP_000908169.1|635972_636887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000190110.1|637862_638423_+	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	39.9	4.2e-22
WP_000331918.1|638436_639282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001724296.1|639342_639837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000749342.1|640077_640542_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001064798.1|644070_644835_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016246833.1|645074_645974_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_001044501.1|645990_647508_+	altronate dehydratase	NA	NA	NA	NA	NA
WP_024946607.1|647585_648593_+	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_024946608.1|648894_650160_+	MFS transporter	NA	NA	NA	NA	NA
WP_032152090.1|650169_651126_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_060684362.1|651707_652718_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.4	3.6e-197
WP_000839179.1|653254_653659_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_000612626.1|653655_654003_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_001741392.1|655653_656787_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000916805.1|659028_659472_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_001741394.1|659487_659775_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_000345347.1|659787_661044_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_001305336.1|661290_661482_-|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	65.6	8.3e-15
WP_004019923.1|661966_662980_-	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_000998346.1|662991_664308_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_000350265.1|664335_665256_-	ribokinase	NA	NA	NA	NA	NA
WP_001295538.1|665561_666344_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001296706.1|667542_667671_+	alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_000145475.1|667851_668508_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001375347.1|668755_670033_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_001293435.1|670095_672093_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
WP_000088351.1|672246_673386_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	7.9e-68
>prophage 4
NZ_CP008697	Escherichia coli strain ST648 isolate Pleural Effusion of Patients with Empyema Thoracis chromosome, complete genome	5056598	987108	1052933	5056598	plate,protease,tRNA,transposase	Emiliania_huxleyi_virus(11.11%)	54	NA	NA
WP_022645195.1|987108_988461_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|988490_990923_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|991044_991530_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139282.1|991533_992559_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|992663_993119_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|993122_993911_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_022645196.1|993910_995059_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_022645197.1|995055_995652_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	2.3e-26
WP_001294757.1|995688_999171_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000055746.1|999183_1000143_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001020966.1|1000241_1002383_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|1002439_1002829_+	VOC family protein	NA	NA	NA	NA	NA
WP_022645198.1|1002893_1004192_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062318.1|1004240_1004501_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|1004487_1004688_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185283.1|1004853_1005399_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635528.1|1005395_1005818_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239184.1|1005831_1006542_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_022645199.1|1006697_1007522_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_022645200.1|1007574_1009293_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094006.1|1009403_1010111_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202329.1|1010107_1010512_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874226.1|1010629_1011445_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|1011484_1012138_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593991.1|1012130_1013162_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_022645201.1|1019692_1020496_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	35.8	2.7e-38
WP_000648568.1|1020492_1021407_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|1021647_1022448_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211702.1|1022524_1023295_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644685.1|1023342_1024701_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052732.1|1024772_1025528_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001308373.1|1025561_1026284_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|1026280_1026748_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001308374.1|1026812_1027544_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	7.6e-40
WP_022645202.1|1028078_1028864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022645204.1|1029494_1030403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022645205.1|1030446_1030929_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_022645206.1|1030952_1032305_-	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_122988716.1|1032315_1035750_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_022645208.1|1035858_1037274_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_022645209.1|1037278_1038022_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_022645210.1|1038018_1040778_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	29.0	7.2e-83
WP_022645211.1|1040786_1041548_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_022645212.1|1041552_1042884_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080149.1|1042886_1043411_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113710.1|1043407_1044688_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_022645213.1|1044712_1045795_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_022645214.1|1045758_1047609_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_022645215.1|1047612_1048026_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_060684380.1|1048032_1049508_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_022645217.1|1049558_1049783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000037391.1|1049817_1050318_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142958.1|1051014_1051533_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_085949836.1|1051719_1052933_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	58.4	4.7e-103
>prophage 5
NZ_CP008697	Escherichia coli strain ST648 isolate Pleural Effusion of Patients with Empyema Thoracis chromosome, complete genome	5056598	1332304	1422576	5056598	terminase,head,tRNA,integrase,lysis,tail,protease,capsid,transposase	Enterobacteria_phage(56.36%)	90	1342456:1342502	1389160:1389206
WP_000912345.1|1332304_1333690_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143564.1|1333725_1334247_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|1334354_1334567_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729155.1|1334568_1335435_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|1335906_1336449_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_022645303.1|1336668_1337361_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_022645304.1|1337391_1340001_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_000691076.1|1340013_1341021_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001255235.1|1341031_1341547_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_060684390.1|1341549_1342182_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
1342456:1342502	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001299447.1|1342515_1343679_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.3	3.4e-199
WP_000488407.1|1343877_1344156_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_022645305.1|1344203_1344422_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	97.2	5.4e-34
WP_000548537.1|1344813_1345005_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_000149544.1|1344977_1345160_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
WP_000186848.1|1345156_1345837_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_023909022.1|1345833_1346619_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	98.9	1.5e-147
WP_020241285.1|1346624_1346921_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	3.6e-49
WP_000233579.1|1346997_1347204_-	hypothetical protein	NA	K7PM31	Enterobacteria_phage	83.8	7.1e-28
WP_000858975.1|1347798_1348488_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_001067458.1|1348592_1348823_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_001182772.1|1348892_1349432_+	toxin YdaT domain-containing protein	NA	M9NZI6	Enterobacteria_phage	66.1	1.5e-61
WP_000147901.1|1349428_1350448_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.8	4.4e-110
WP_000788890.1|1350444_1351146_+	Replication protein P	NA	M1FJ72	Enterobacteria_phage	97.4	7.9e-127
WP_000145902.1|1351142_1351445_+	hypothetical protein	NA	A0A0N6WES4	Escherichia_phage	93.5	1.7e-41
WP_001070451.1|1351512_1351845_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_032139864.1|1351936_1352044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709074.1|1352101_1353628_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.7	3.6e-31
WP_001351655.1|1353739_1354063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000379700.1|1354524_1354881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072130332.1|1354970_1355072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053034.1|1355068_1355524_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	4.9e-61
WP_000224912.1|1355523_1355694_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	1.4e-13
WP_000774504.1|1355686_1355977_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_001099712.1|1355973_1356336_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971074.1|1356332_1356473_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	6.5e-09
WP_022645308.1|1356558_1356936_+	antitermination protein Q	NA	Q777W5	Enterobacteria_phage	83.3	8.1e-54
WP_000780581.1|1357091_1357616_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	1.1e-48
WP_000592546.1|1357808_1358768_+	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_022645309.1|1359119_1359851_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000839582.1|1360038_1360254_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	1.2e-33
WP_001135261.1|1360253_1360751_+	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	97.6	4.2e-90
WP_000092273.1|1360747_1361215_+|lysis	lysis protein	lysis	A0A2D1GLQ7	Escherichia_phage	96.8	1.6e-75
WP_001139678.1|1361202_1361355_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	3.1e-20
WP_000079508.1|1361706_1362117_-	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_000105084.1|1362173_1362407_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	94.4	7.3e-21
WP_000453580.1|1362795_1363341_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	100.0	2.8e-95
WP_060684391.1|1363315_1365241_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000198149.1|1365237_1365444_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_022645310.1|1367021_1368341_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	6.9e-233
WP_001297109.1|1368350_1368683_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	100.0	2.2e-55
WP_022645311.1|1368738_1369764_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.4	1.0e-191
WP_000158919.1|1369805_1370204_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	100.0	3.1e-64
WP_000752979.1|1370215_1370569_+|head,tail	head-tail joining protein	head,tail	A0A0K2FJB7	Enterobacteria_phage	100.0	2.0e-62
WP_000985119.1|1370580_1371159_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000683105.1|1371155_1371551_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001547245.1|1371558_1372299_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	1.7e-127
WP_001468358.1|1372314_1372737_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	97.9	2.8e-71
WP_022645312.1|1372718_1373153_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	1.5e-64
WP_000847321.1|1375704_1376034_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	97.2	8.9e-57
WP_001152639.1|1376033_1376732_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
WP_071932122.1|1376737_1377823_+	Mov34/MPN/PAD-1 family protein	NA	K7PLW1	Enterobacteria_phage	97.4	2.8e-115
WP_023909233.1|1377883_1381363_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.6	0.0e+00
WP_038431964.1|1381430_1382030_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	92.5	4.4e-102
WP_060684392.1|1382094_1384452_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A1X7QGG5	Escherichia_phage	50.1	2.2e-117
WP_001204892.1|1384451_1384721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022645319.1|1384733_1385774_+|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	91.9	2.1e-176
WP_000386784.1|1386784_1387534_+	DNA-binding transcriptional activator AppY	NA	NA	NA	NA	NA
WP_001201842.1|1387782_1388736_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001177457.1|1389248_1390010_-	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
1389160:1389206	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_022645321.1|1390192_1391083_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_022645322.1|1391083_1394056_-	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_022645323.1|1394042_1396280_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_022645326.1|1398468_1398858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001160804.1|1403728_1404190_-	DcrB-related protein	NA	NA	NA	NA	NA
WP_000103215.1|1404217_1406119_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.1	6.0e-28
WP_022645328.1|1406859_1408308_-	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.1	2.3e-11
WP_000770953.1|1408297_1408981_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
WP_022645329.1|1409137_1410520_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel CusC	NA	NA	NA	NA	NA
WP_000709873.1|1410543_1410876_+	Cu(+)/Ag(+) efflux RND transporter periplasmic metallochaperone CusF	NA	NA	NA	NA	NA
WP_022645330.1|1410891_1412115_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit CusB	NA	NA	NA	NA	NA
WP_022645331.1|1412126_1415270_+	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.4	5.7e-60
WP_000786307.1|1415371_1416748_+	phenylalanine transporter	NA	NA	NA	NA	NA
WP_060684395.1|1416815_1418063_-	mechanosensitive ion channel YbdG	NA	NA	NA	NA	NA
WP_000351480.1|1418170_1418824_-	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_000360950.1|1418902_1419286_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_000682524.1|1419350_1419599_-	DUF1158 domain-containing protein	NA	NA	NA	NA	NA
WP_022645332.1|1419664_1420783_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_000956465.1|1421234_1421387_+	type I toxin-antitoxin system toxin HokE	NA	NA	NA	NA	NA
WP_001300563.1|1421463_1422576_+|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP008697	Escherichia coli strain ST648 isolate Pleural Effusion of Patients with Empyema Thoracis chromosome, complete genome	5056598	2140581	2226632	5056598	portal,terminase,head,integrase,lysis,tail,protease,holin,capsid,transposase	Enterobacteria_phage(34.55%)	93	2159876:2159903	2209261:2209288
WP_024181814.1|2140581_2141928_+|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_000301651.1|2141982_2144658_-	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_022645592.1|2145134_2145782_+	NAAT family transporter YchE	NA	NA	NA	NA	NA
WP_001211525.1|2145939_2146236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000182039.1|2146519_2148151_+	oligopeptide ABC transporter substrate-binding protein OppA	NA	NA	NA	NA	NA
WP_060684418.1|2148236_2149157_+	oligopeptide ABC transporter permease OppB	NA	NA	NA	NA	NA
WP_000979659.1|2149171_2150080_+	oligopeptide ABC transporter permease OppC	NA	NA	NA	NA	NA
WP_000110931.1|2150091_2151105_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
WP_000994905.1|2151101_2152106_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
WP_000366959.1|2152158_2152488_-	YciU family protein	NA	NA	NA	NA	NA
WP_000214516.1|2152522_2153983_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_001309467.1|2154125_2154299_+	YciY family protein	NA	NA	NA	NA	NA
WP_000020078.1|2154353_2155607_-	voltage-gated potassium channel protein	NA	NA	NA	NA	NA
WP_000967595.1|2155907_2156204_-	YciI family protein	NA	NA	NA	NA	NA
WP_001357407.1|2156427_2157144_+	TonB system transport protein TonB	NA	NA	NA	NA	NA
WP_000108160.1|2157183_2157582_-	acyl-CoA thioester hydrolase YciA	NA	NA	NA	NA	NA
WP_000808667.1|2157686_2158226_-	septation protein A	NA	NA	NA	NA	NA
WP_000028546.1|2158255_2158999_-	UPF0259 family protein	NA	NA	NA	NA	NA
WP_000737224.1|2159355_2159994_+	outer membrane protein OmpW	NA	NA	NA	NA	NA
2159876:2159903	attL	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_000113696.1|2160039_2161170_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.7	2.0e-103
WP_000113189.1|2161147_2161396_-	excisionase	NA	NA	NA	NA	NA
WP_023909115.1|2161460_2163932_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.1	2.3e-56
WP_001090200.1|2164024_2164216_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2164212_2164401_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_016237926.1|2164933_2165308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001725971.1|2165319_2165472_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	1.1e-06
WP_000948454.1|2165790_2166267_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_000711018.1|2166391_2166715_+	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000693906.1|2166698_2167124_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095673.1|2167146_2168109_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	51.2	1.6e-69
WP_001468623.1|2168149_2168572_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.4	3.3e-64
WP_000403785.1|2168629_2168986_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.8e-58
WP_001224662.1|2169079_2169262_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_000753060.1|2169254_2169431_+	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	94.8	6.7e-27
WP_089541817.1|2169706_2170935_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.7e-170
WP_000967408.1|2171632_2171845_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
WP_032151993.1|2172011_2172290_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	7.4e-12
WP_023909113.1|2172291_2173341_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.0	2.7e-107
WP_000904174.1|2173353_2173713_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	3.9e-37
WP_023909112.1|2173709_2174399_+	antiterminator	NA	I6PDF8	Cronobacter_phage	46.4	1.8e-54
WP_000917767.1|2174612_2174810_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_000935536.1|2174960_2176010_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.7	8.8e-199
WP_001438304.1|2176811_2176943_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	96.4	1.1e-05
WP_000871291.1|2177223_2177559_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_023909002.1|2177819_2179673_+	SASA family carbohydrate esterase	NA	Q08JA2	Stx2-converting_phage	89.2	0.0e+00
WP_000284510.1|2179822_2180038_+|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_023909003.1|2180042_2180357_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	98.1	3.1e-51
WP_023909004.1|2180412_2180946_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	98.3	2.5e-101
WP_024946561.1|2180942_2181401_+|lysis	lysis protein	lysis	K7PJW6	Enterobacteria_phage	92.8	7.5e-70
WP_000654790.1|2181817_2182438_+	sce7726 family protein	NA	A0A0U2RXY7	Escherichia_phage	53.7	5.1e-53
WP_023909270.1|2182379_2183447_-	beta family protein	NA	NA	NA	NA	NA
WP_000867575.1|2183856_2184405_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_000622379.1|2184376_2186305_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.7	9.7e-260
WP_000259002.1|2186288_2186495_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831818.1|2186491_2188084_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	4.9e-185
WP_000256835.1|2189616_2189964_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	55.9	2.9e-21
WP_000522601.1|2190021_2191050_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	62.2	1.1e-113
WP_000201501.1|2191101_2191485_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_001204553.1|2191477_2191831_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	2.5e-41
WP_001575631.1|2191845_2192421_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	57.8	1.1e-49
WP_000683079.1|2192417_2192813_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000235110.1|2192820_2193573_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
WP_000479095.1|2193586_2194018_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	6.2e-42
WP_000533402.1|2194044_2194458_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_023909007.1|2194438_2197012_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.3	0.0e+00
WP_000847298.1|2197008_2197338_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001335877.1|2197337_2198036_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	96.6	1.7e-129
WP_000194723.1|2198046_2198790_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	5.0e-148
WP_122997661.1|2198735_2199368_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	94.3	1.5e-100
WP_023909008.1|2199711_2203185_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.8	0.0e+00
WP_001228314.1|2203252_2203852_+	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	97.0	9.1e-108
WP_023909009.1|2204003_2207030_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	54.6	1.4e-55
WP_000885578.1|2207029_2207614_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	5.0e-103
WP_000240999.1|2207668_2208337_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_060684419.1|2208393_2208663_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
WP_000251936.1|2208777_2208948_+	hypothetical protein	NA	A0A0U2RK60	Escherichia_phage	62.5	9.4e-10
WP_001056491.1|2209989_2210490_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
2209261:2209288	attR	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_000807651.1|2210575_2210755_-	general stress protein	NA	NA	NA	NA	NA
WP_022645611.1|2211145_2211952_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_022645612.1|2211951_2213145_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001195273.1|2213156_2214515_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.9e-37
WP_000763524.1|2214518_2216114_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	1.7e-52
WP_022645613.1|2216113_2217676_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|2217767_2217812_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285663.1|2217949_2218831_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|2218827_2219448_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_022645614.1|2219475_2221365_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291217.1|2221575_2222451_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_022645615.1|2222620_2223643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001000715.1|2223652_2223961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001278893.1|2224017_2224608_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559277.1|2224604_2225363_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	4.4e-06
WP_000422059.1|2225582_2226632_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 7
NZ_CP008697	Escherichia coli strain ST648 isolate Pleural Effusion of Patients with Empyema Thoracis chromosome, complete genome	5056598	2992078	2999601	5056598		Enterobacteria_phage(42.86%)	7	NA	NA
WP_033870520.1|2992078_2992621_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.9	1.7e-44
WP_033870519.1|2992625_2993504_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	3.0e-107
WP_044863830.1|2993561_2994461_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.2	3.3e-29
WP_033870517.1|2994460_2995546_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	3.3e-100
WP_060684449.1|2995917_2996811_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	41.7	1.1e-45
WP_060684450.1|2997053_2998049_-	N-acetyl-alpha-D-glucosaminyl-diphospho-ditrans, octacis-undecaprenol 4-epimerase	NA	A0A1V0QG29	Shearwaterpox_virus	26.3	3.3e-09
WP_001683004.1|2998206_2999601_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	4.9e-19
>prophage 8
NZ_CP008697	Escherichia coli strain ST648 isolate Pleural Effusion of Patients with Empyema Thoracis chromosome, complete genome	5056598	3049487	3078125	5056598	portal,terminase,head,tRNA,tail,protease,capsid	uncultured_Caudovirales_phage(58.33%)	32	NA	NA
WP_000476012.1|3049487_3050849_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.5	2.5e-217
WP_001303579.1|3051178_3051496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022645854.1|3051910_3052810_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.7e-12
WP_000178552.1|3052891_3053671_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_022645855.1|3053770_3054811_-	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_022645856.1|3054859_3056215_-	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000823289.1|3056218_3056503_-	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000182901.1|3056533_3056986_-	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_022645857.1|3056995_3058258_-	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_001527276.1|3058286_3059141_-	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000129551.1|3059367_3060420_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000858523.1|3060676_3061954_+	MFS transporter	NA	NA	NA	NA	NA
WP_022645858.1|3061950_3062955_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	9.9e-14
WP_022645859.1|3062951_3063917_+	kinase	NA	NA	NA	NA	NA
WP_000434040.1|3063890_3064637_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001361580.1|3064688_3065507_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.0	2.5e-23
WP_022645860.1|3065571_3066372_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001195576.1|3066368_3067157_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_001353111.1|3067946_3068228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000127869.1|3068233_3069895_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	82.3	4.9e-276
WP_001353110.1|3069878_3070235_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	83.8	6.1e-51
WP_001251188.1|3070354_3070540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145897.1|3070523_3070964_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	76.0	9.1e-65
WP_001287546.1|3070963_3071266_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	61.1	1.4e-27
WP_000270251.1|3071258_3072473_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	87.3	2.2e-209
WP_000798773.1|3072474_3073035_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	84.9	2.6e-88
WP_000733253.1|3073089_3074259_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	76.3	1.8e-163
WP_001053662.1|3074545_3075052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024167808.1|3075087_3075336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000126652.1|3075352_3075778_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000125507.1|3075774_3076020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000710160.1|3076307_3078125_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	50.7	2.6e-129
>prophage 9
NZ_CP008697	Escherichia coli strain ST648 isolate Pleural Effusion of Patients with Empyema Thoracis chromosome, complete genome	5056598	3106357	3114667	5056598		Enterobacteria_phage(83.33%)	8	NA	NA
WP_022645869.1|3106357_3108358_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.8	0.0e+00
WP_001296231.1|3108482_3108944_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001295430.1|3108984_3109455_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_012311742.1|3109501_3110221_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001334139.1|3110217_3111903_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.5	9.5e-304
WP_001240398.1|3112124_3112856_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001216963.1|3112915_3113023_+	protein YohO	NA	NA	NA	NA	NA
WP_022645872.1|3113740_3114667_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.2e-23
>prophage 10
NZ_CP008697	Escherichia coli strain ST648 isolate Pleural Effusion of Patients with Empyema Thoracis chromosome, complete genome	5056598	3509030	3515974	5056598	holin	Escherichia_phage(88.89%)	10	NA	NA
WP_000017552.1|3509030_3509183_-	hypothetical protein	NA	G9L6F3	Escherichia_phage	96.0	1.7e-18
WP_000076001.1|3509200_3509392_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
WP_001295476.1|3509702_3510221_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	100.0	1.3e-62
WP_022645975.1|3510236_3510776_+	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	96.6	2.9e-44
WP_032152016.1|3510995_3511478_-	DUF2514 domain-containing protein	NA	A0A0F6TK39	Escherichia_coli_O157_typing_phage	90.0	3.2e-71
WP_024946531.1|3511474_3512104_-	glycoside hydrolase family 19 protein	NA	G9L6E8	Escherichia_phage	97.6	1.8e-114
WP_060684470.1|3512093_3512402_-|holin	phage holin family protein	holin	G9L6E7	Escherichia_phage	94.1	6.0e-47
WP_001275999.1|3512388_3512793_-	membrane protein	NA	G9L6E6	Escherichia_phage	97.0	2.7e-63
WP_024946530.1|3513015_3513312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001188253.1|3515716_3515974_+	hypothetical protein	NA	G9L6E3	Escherichia_phage	100.0	3.4e-43
>prophage 11
NZ_CP008697	Escherichia coli strain ST648 isolate Pleural Effusion of Patients with Empyema Thoracis chromosome, complete genome	5056598	3520108	3554600	5056598	tail,terminase,integrase	Escherichia_phage(50.0%)	38	3517933:3517948	3555369:3555384
3517933:3517948	attL	TCGGGCGCGGCGGCGG	NA	NA	NA	NA
WP_032152018.1|3520108_3523498_-	hypothetical protein	NA	A0A1E1GEP2	Vibrio_phage	36.8	3.4e-183
WP_024946525.1|3523497_3526245_-	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	43.5	1.2e-117
WP_000332877.1|3526244_3526820_-	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	95.3	7.0e-81
WP_000228790.1|3526819_3527284_-	hypothetical protein	NA	G9L6D1	Escherichia_phage	99.4	1.1e-84
WP_001018550.1|3527283_3529755_-	hypothetical protein	NA	G9L6D0	Escherichia_phage	99.3	0.0e+00
WP_000179260.1|3529754_3530360_-	hypothetical protein	NA	G9L6C9	Escherichia_phage	100.0	2.8e-112
WP_000012377.1|3530416_3530752_-	hypothetical protein	NA	G9L6C7	Escherichia_phage	100.0	7.7e-56
WP_024946524.1|3530762_3531200_-	hypothetical protein	NA	A0A0F6R7N9	Escherichia_coli_O157_typing_phage	94.5	1.9e-70
WP_024946523.1|3531251_3532238_-	hypothetical protein	NA	G9L6C5	Escherichia_phage	94.5	2.5e-179
WP_001048075.1|3532252_3532948_-	peptidase	NA	G9L6C4	Escherichia_phage	100.0	6.0e-95
WP_000133160.1|3532950_3533247_-	hypothetical protein	NA	G9L6C3	Escherichia_phage	100.0	1.3e-46
WP_024946522.1|3533243_3534923_-|tail	tail protein	tail	G9L6C2	Escherichia_phage	99.1	3.1e-302
WP_000335899.1|3534937_3535144_-	hypothetical protein	NA	G9L6C1	Escherichia_phage	100.0	6.0e-11
WP_060684471.1|3535905_3536469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024946520.1|3536516_3537986_-	hypothetical protein	NA	G9L6B8	Escherichia_phage	97.4	1.2e-289
WP_024946519.1|3537982_3538657_-|terminase	terminase small subunit	terminase	Q287B7	Escherichia_phage	99.6	3.4e-119
WP_024946517.1|3539149_3540079_-	DUF551 domain-containing protein	NA	Q1MVF7	Enterobacteria_phage	50.6	7.9e-66
WP_024946516.1|3540592_3541357_-	ead/Ea22-like family protein	NA	A0A1B0VCG7	Salmonella_phage	95.6	2.4e-68
WP_001593200.1|3541358_3541658_-	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	97.0	1.4e-56
WP_024946515.1|3541654_3542200_-	hypothetical protein	NA	J9Q748	Salmonella_phage	83.2	3.2e-83
WP_024946514.1|3542196_3542676_-	hypothetical protein	NA	Q9MCR3	Enterobacteria_phage	54.2	1.5e-28
WP_021558026.1|3542737_3543085_-	hypothetical protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	96.5	5.9e-59
WP_001066741.1|3543202_3543988_-	hypothetical protein	NA	A0A0F6TJ71	Escherichia_coli_O157_typing_phage	99.6	3.6e-152
WP_000086414.1|3543984_3544800_-	helix-turn-helix domain-containing protein	NA	Q286X4	Escherichia_phage	95.6	1.7e-117
WP_000402896.1|3544815_3545016_-	hypothetical protein	NA	A0A0F6TJB7	Escherichia_coli_O157_typing_phage	98.5	1.0e-31
WP_001282459.1|3545166_3545397_-	hypothetical protein	NA	G9L6A7	Escherichia_phage	100.0	2.6e-39
WP_000836290.1|3545551_3546136_+	helix-turn-helix transcriptional regulator	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	100.0	7.0e-105
WP_001198620.1|3546289_3546442_+	hypothetical protein	NA	G9L6A5	Escherichia_phage	100.0	5.4e-25
WP_001102254.1|3546444_3546744_+	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	98.0	1.4e-45
WP_000802268.1|3546740_3547562_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A2R9YJH7	Escherichia_phage	100.0	1.2e-163
WP_000063834.1|3547558_3548500_+	recombinase RecT	NA	A0A2R9YJJ1	Escherichia_phage	100.0	4.5e-178
WP_000675390.1|3548549_3548798_+	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	100.0	3.6e-42
WP_001335975.1|3548955_3549207_+	PerC family transcriptional regulator	NA	G9L6A0	Escherichia_phage	100.0	3.1e-41
WP_000163456.1|3549199_3549850_+	adenine methylase	NA	A0A2R9YJG0	Escherichia_phage	100.0	5.0e-128
WP_001077944.1|3549846_3550041_+	DUF1382 family protein	NA	A0A0F6R7M7	Escherichia_coli_O157_typing_phage	98.4	9.7e-27
WP_024946512.1|3550044_3551295_-|integrase	site-specific integrase	integrase	A0A0F6TJM5	Escherichia_coli_O157_typing_phage	99.3	3.0e-238
WP_000138270.1|3551487_3553065_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_001299507.1|3553133_3554600_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
3555369:3555384	attR	TCGGGCGCGGCGGCGG	NA	NA	NA	NA
>prophage 1
NZ_CP008715	Escherichia coli strain ST648 isolate Pleural Effusion of Patients with Empyema Thoracis plasmid pEC648_1, complete sequence	120653	13084	85948	120653	integrase,transposase	Escherichia_phage(33.33%)	58	27334:27393	76433:76588
WP_000016982.1|13084_13891_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	100.0	5.8e-57
WP_060684530.1|13891_14197_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000813634.1|14198_14417_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_000151784.1|14983_15496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001542067.1|15529_16663_-	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_000528931.1|17616_18117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001261278.1|18381_18612_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001034046.1|18608_19025_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001261286.1|23245_23476_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001034044.1|23472_23889_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001128474.1|23963_25529_+	AAA family ATPase	NA	NA	NA	NA	NA
27334:27393	attL	TGAGAGCAGAGATAGCGCTGATGTCCGGCGGTGCTTTTGCCGTTACGCACCACCCCGTCA	NA	NA	NA	NA
WP_000949004.1|27789_28704_+	iron/manganese ABC transporter substrate-binding protein SitA	NA	NA	NA	NA	NA
WP_000983710.1|28703_29531_+	iron/manganese ABC transporter ATP-binding protein SitB	NA	A0A1M7XV31	Cedratvirus	27.0	3.6e-14
WP_001101723.1|29527_30385_+	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_000968139.1|30381_31239_+	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_001318207.1|32481_32862_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	55.0	1.9e-26
WP_000095526.1|33241_34435_-	MFS transporter	NA	NA	NA	NA	NA
WP_000602863.1|34570_36295_+	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_000011908.1|36295_37243_+	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_001015721.1|37242_38985_+	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_000750130.1|38981_40259_+	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_000973519.1|40340_42542_+	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_000361611.1|45547_46525_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	63.9	4.6e-101
WP_060684531.1|46809_47550_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_042344623.1|47670_47853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001105060.1|50361_50655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000421272.1|50760_51036_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001387467.1|51035_51320_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_000562172.1|51924_52677_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024946717.1|53707_54088_-	endoribonuclease	NA	NA	NA	NA	NA
WP_001077068.1|54112_55003_-	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_000796505.1|55235_55430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000338039.1|55974_56853_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_001271561.1|56842_57730_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_000922702.1|57740_58565_+	phosphodiesterase	NA	NA	NA	NA	NA
WP_000950177.1|58570_59644_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.7	2.6e-28
WP_000476108.1|59636_60947_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001067834.1|62866_63571_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
WP_000205718.1|67231_67978_+	conjugal transfer pilus acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.9	3.2e-09
WP_000139341.1|68032_68593_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_013023861.1|68724_68937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023144756.1|69807_69942_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001323403.1|70417_71197_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	1.5e-139
WP_000255944.1|71196_72219_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_072258247.1|72299_72452_+	replication protein A	NA	NA	NA	NA	NA
WP_031943482.1|72688_72763_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000130640.1|72755_73613_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_000557619.1|75263_75521_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_001398199.1|75453_75855_+	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_060684534.1|77683_78241_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	99.5	2.6e-93
76433:76588	attR	TGACGGGGTGGTGCGTAACGGCAAAAGCACCGCCGGACATCAGCGCTATCTCTGCTCTCAGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAA	NA	NA	NA	NA
WP_001067855.1|78564_79269_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001389366.1|80171_80645_+	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
WP_000503573.1|80775_81564_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_000679427.1|81769_82117_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|82110_82950_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376616.1|83077_83281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000184001.1|83436_84642_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_001389365.1|85183_85948_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
