The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010350	Acinetobacter johnsonii XBB1 chromosome, complete genome	3509795	14208	74797	3509795	tRNA,transposase,protease	Helicobacter_phage(18.18%)	51	NA	NA
WP_058951456.1|14208_15120_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_058951457.1|15202_16027_-	OXA-211 family carbapenem-hydrolyzing class D beta-lactamase OXA-652	NA	NA	NA	NA	NA
WP_101598931.1|16614_16953_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_058951458.1|17038_18979_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	48.9	5.0e-147
WP_058951459.1|19098_19647_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_039890835.1|20569_20797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058951460.1|20933_21482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058951461.1|21681_22755_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_005401739.1|22802_23471_-	acetoacetate decarboxylase family protein	NA	NA	NA	NA	NA
WP_005402021.1|23571_23985_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.9	1.4e-46
WP_058951462.1|24005_25064_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0H3UZC2	Geobacillus_virus	35.0	2.0e-25
WP_058951463.1|25136_25706_+	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_004691886.1|31904_33263_+	MFS transporter	NA	NA	NA	NA	NA
WP_058951464.1|33404_33968_+	DUF4256 domain-containing protein	NA	NA	NA	NA	NA
WP_058951465.1|34931_36410_+	sodium-dependent transporter	NA	NA	NA	NA	NA
WP_004691882.1|36419_36563_+	methionine/alanine import family NSS transporter small subunit	NA	NA	NA	NA	NA
WP_004691880.1|37002_37383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164996879.1|37418_37556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004691877.1|37555_37972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058951466.1|38279_39434_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_004978440.1|39474_40779_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_058951467.1|40778_41738_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.4	4.5e-08
WP_081316804.1|42209_44039_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_058951468.1|44406_46092_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_058951469.1|46163_47462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058951470.1|47667_49773_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_058951471.1|49934_50672_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_058951472.1|50668_51574_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_058951473.1|51723_53025_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	63.1	2.7e-149
WP_058951474.1|53326_56011_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_058951475.1|56216_56843_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_058951476.1|56993_58094_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_058951477.1|58096_61234_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_058951478.1|61365_61743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004978425.1|61846_62965_+	molecular chaperone DnaJ	NA	A0A0P0YNN4	Yellowstone_lake_phycodnavirus	34.6	1.9e-26
WP_058951479.1|63029_63266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058951480.1|63463_64285_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_058951481.1|64344_64992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058951482.1|65040_65442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058951483.1|65541_66993_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_058951484.1|67023_68046_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	30.4	1.3e-45
WP_058951485.1|68082_68637_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_004691836.1|68656_68902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171253710.1|68917_69460_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A223FZJ1	Rhodococcus_phage	33.1	3.0e-09
WP_058952484.1|69544_70579_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_058951487.1|70687_71050_-	HIT family protein	NA	NA	NA	NA	NA
WP_058951488.1|71125_71866_-	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_004647174.1|72033_72192_-	DUF1328 domain-containing protein	NA	A0A0R6PJ30	Moraxella_phage	59.6	3.4e-06
WP_058952485.1|72394_72847_+	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_058951489.1|72946_74224_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.1	3.1e-81
WP_005402021.1|74383_74797_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.9	1.4e-46
>prophage 2
NZ_CP010350	Acinetobacter johnsonii XBB1 chromosome, complete genome	3509795	265414	337670	3509795	tRNA,transposase	Bacillus_phage(20.0%)	59	NA	NA
WP_058951606.1|265414_265774_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_171253702.1|265873_267205_+	amino acid permease	NA	NA	NA	NA	NA
WP_058952495.1|267245_268658_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_058951608.1|268730_269630_-	DMT family transporter	NA	NA	NA	NA	NA
WP_004691559.1|269721_270270_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004691558.1|270346_271078_-	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_081316811.1|271157_271826_-	3'-5' exonuclease domain-containing protein 2	NA	NA	NA	NA	NA
WP_058951610.1|271918_272383_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_058951611.1|272671_273289_-	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_058951612.1|273288_273882_-	imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_004691552.1|273974_274352_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_058951613.1|274970_275723_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004691549.1|275733_276153_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_004978127.1|276281_277799_-	acetyl-CoA hydrolase/transferase family protein	NA	NA	NA	NA	NA
WP_005401377.1|278005_279466_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	27.5	1.9e-13
WP_004691545.1|279706_280471_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	35.7	2.8e-29
WP_058951614.1|280807_283159_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_058951615.1|283215_283533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058951616.1|283628_283952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058951617.1|284084_284972_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_058951618.1|285280_286558_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A0B5JD48	Pandoravirus	27.4	4.3e-14
WP_004691537.1|286854_288516_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.3	1.4e-41
WP_058951619.1|289491_290643_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_010327661.1|290782_291124_-	membrane protein	NA	NA	NA	NA	NA
WP_058951620.1|291444_292953_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_004978106.1|293101_293386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058951621.1|293775_294774_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010327653.1|295026_296046_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_058951622.1|296234_297158_+	16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH	NA	NA	NA	NA	NA
WP_058870427.1|297157_297490_+	cell division protein FtsL	NA	NA	NA	NA	NA
WP_004978097.1|297502_299326_+	penicillin-binding protein PBP3	NA	NA	NA	NA	NA
WP_058951623.1|299333_300830_+	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_058951624.1|300839_302249_+	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_058951625.1|302249_303368_+	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
WP_058951626.1|303438_304245_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_164996880.1|304316_306806_-	penicillin-binding protein PBP1a	NA	NA	NA	NA	NA
WP_005401352.1|309419_309947_+	pilus assembly protein PilP	NA	NA	NA	NA	NA
WP_006582413.1|310768_311719_-|transposase	IS481 family transposase	transposase	E2FK51	Porcine_endogenous_retrovirus	30.1	1.6e-05
WP_081241770.1|311829_313053_+	type IV pilus secretin PilQ	NA	NA	NA	NA	NA
WP_005401350.1|313090_313624_+	shikimate kinase AroK	NA	NA	NA	NA	NA
WP_005401349.1|313654_314740_+	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_010327647.1|314747_315587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171056726.1|316034_320510_+	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_005401346.1|320582_322004_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005401344.1|323240_323831_+	LemA family protein	NA	NA	NA	NA	NA
WP_005401343.1|323877_324951_+	TPM domain-containing protein	NA	NA	NA	NA	NA
WP_010327644.1|324944_325505_+	TPM domain-containing protein	NA	NA	NA	NA	NA
WP_058951627.1|327004_327937_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	40.3	1.9e-56
WP_058951628.1|328087_329692_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	52.6	8.9e-142
WP_004684362.1|329766_330102_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_058951629.1|330098_330482_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_004691472.1|330613_331078_-	bacterioferritin	NA	NA	NA	NA	NA
WP_010327639.1|331329_331524_-	bacterioferritin-associated ferredoxin	NA	NA	NA	NA	NA
WP_004691470.1|331679_332063_-	RidA family protein	NA	NA	NA	NA	NA
WP_005401339.1|332132_334232_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	J9Q7H7	Salmonella_phage	35.3	1.2e-08
WP_004978050.1|334455_334737_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_005401338.1|334814_335438_-	guanylate kinase	NA	A0A240FAU9	Liberibacter_phage	32.3	5.2e-13
WP_010327638.1|335572_336523_+	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_005401337.1|336737_337670_-|transposase	IS5-like element ISAjo1 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	41.4	8.7e-57
>prophage 3
NZ_CP010350	Acinetobacter johnsonii XBB1 chromosome, complete genome	3509795	937464	943681	3509795		Acinetobacter_phage(83.33%)	7	NA	NA
WP_010327245.1|937464_938841_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.4	5.3e-18
WP_010327244.1|938897_939257_-	DUF861 domain-containing protein	NA	NA	NA	NA	NA
WP_171054237.1|939343_939892_-	GTP cyclohydrolase I FolE	NA	A0A0P0HSD2	Acinetobacter_phage	94.0	4.9e-92
WP_010327243.1|939985_940672_-	Smr/MutS family protein	NA	A0A0P0IDT4	Acinetobacter_phage	74.7	1.3e-86
WP_010327242.1|941219_942026_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	82.5	2.5e-121
WP_004695696.1|942042_943089_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	84.5	1.7e-162
WP_171056750.1|943105_943681_-	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	A0A0P0IKJ1	Acinetobacter_phage	93.2	3.8e-103
>prophage 4
NZ_CP010350	Acinetobacter johnsonii XBB1 chromosome, complete genome	3509795	1190905	1201678	3509795		Tetraselmis_virus(14.29%)	12	NA	NA
WP_010327068.1|1190905_1191883_+	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	31.1	9.5e-38
WP_004982122.1|1191886_1192426_+	HAD-IIIA family hydrolase	NA	NA	NA	NA	NA
WP_005400648.1|1192460_1193003_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_010327067.1|1192992_1193559_+	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_004696348.1|1193558_1194305_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.2	1.1e-20
WP_010327065.1|1194551_1195148_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	39.5	2.4e-23
WP_004982112.1|1195140_1195752_+	acyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	50.8	2.0e-09
WP_010327064.1|1195880_1196723_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	33.9	3.8e-35
WP_010327063.1|1196864_1197530_-	O-methyltransferase	NA	S5YRC3	Mycobacterium_phage	37.3	1.0e-27
WP_004982106.1|1197661_1198381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010327061.1|1198513_1198837_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_010327060.1|1199044_1201678_-	DNA mismatch repair protein MutS	NA	A0A1V0SDQ0	Indivirus	24.7	1.1e-32
>prophage 5
NZ_CP010350	Acinetobacter johnsonii XBB1 chromosome, complete genome	3509795	1328918	1336478	3509795	tail,head	uncultured_Caudovirales_phage(50.0%)	9	NA	NA
WP_058951755.1|1328918_1330562_+|head,tail	head-tail connector protein	head,tail	A0A2H4J3N6	uncultured_Caudovirales_phage	45.6	2.7e-125
WP_101598938.1|1330558_1330984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058951756.1|1330976_1331657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058952508.1|1331673_1332573_+	hypothetical protein	NA	A0A2H4JC66	uncultured_Caudovirales_phage	33.0	1.6e-26
WP_058951757.1|1332646_1332847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058951758.1|1332905_1333469_+	hypothetical protein	NA	A0A0F7LAE8	uncultured_marine_virus	34.7	2.2e-23
WP_058951759.1|1333468_1335538_+	hypothetical protein	NA	A0A2H4J6H2	uncultured_Caudovirales_phage	28.0	2.4e-67
WP_058951760.1|1335540_1335990_+	GNAT family N-acetyltransferase	NA	X2L0B0	Vibrio_phage	29.5	7.8e-11
WP_058951761.1|1335992_1336478_+	hypothetical protein	NA	A0A1B2ANQ3	Pseudoalteromonas_phage	29.0	3.1e-13
>prophage 7
NZ_CP010350	Acinetobacter johnsonii XBB1 chromosome, complete genome	3509795	1692735	1721390	3509795	plate,transposase	Bacillus_virus(20.0%)	30	NA	NA
WP_007116247.1|1692735_1693764_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_058951957.1|1693964_1694456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058951958.1|1694902_1695358_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_058951959.1|1695433_1696456_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_058951960.1|1696567_1696897_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_058951961.1|1696914_1697799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058951962.1|1697795_1698806_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_171253714.1|1698878_1699751_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	37.5	4.7e-36
WP_058951964.1|1699774_1700719_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004693046.1|1700903_1701272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058951965.1|1701275_1701701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004693049.1|1701828_1702080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081316824.1|1702113_1702839_+	zeta toxin	NA	NA	NA	NA	NA
WP_058951967.1|1703312_1703729_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_058951968.1|1703730_1704153_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_058951969.1|1704149_1705019_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_058951970.1|1705252_1706026_+	alpha/beta fold hydrolase	NA	G1DB77	Mycobacterium_phage	37.6	1.8e-07
WP_058951971.1|1706026_1706998_-	M15 family metallopeptidase	NA	A0A0H4TGB9	Bacillus_phage	33.8	3.2e-09
WP_058951972.1|1706994_1707594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004979571.1|1707605_1708403_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_058951973.1|1708414_1709779_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_058951974.1|1709784_1710915_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_058952518.1|1710936_1713609_-	type VI secretion system ATPase TssH	NA	A0A248SJW6	Salicola_phage	30.2	7.2e-80
WP_004693281.1|1714210_1714975_+|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	36.6	5.7e-14
WP_004979583.1|1715533_1716037_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_004693079.1|1716029_1717511_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004693082.1|1717557_1718061_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_010326723.1|1718127_1718604_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_058951976.1|1718616_1720425_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_058951977.1|1720388_1721390_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 8
NZ_CP010350	Acinetobacter johnsonii XBB1 chromosome, complete genome	3509795	1896737	1942711	3509795	terminase,integrase,tail,capsid,transposase	Acinetobacter_phage(57.5%)	64	1891597:1891613	1941249:1941265
1891597:1891613	attL	CTAAAATCATTGTATAC	NA	NA	NA	NA
WP_094148958.1|1896737_1897488_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	44.9	2.7e-24
WP_058952008.1|1900825_1901467_-|tail	tail assembly protein	tail	A0A0R6PGH0	Moraxella_phage	59.1	3.2e-42
WP_058952009.1|1901459_1902203_-	C40 family peptidase	NA	A0A0R6PIM4	Moraxella_phage	55.7	2.9e-79
WP_058952010.1|1902205_1902994_-|tail	phage minor tail protein L	tail	A0A0R6PIJ5	Moraxella_phage	59.1	2.5e-81
WP_058952011.1|1902977_1903895_-	hypothetical protein	NA	J7I0X3	Acinetobacter_phage	48.2	1.5e-53
WP_058952012.1|1903947_1904289_-|tail	phage tail protein	tail	A0A0R6PIG5	Moraxella_phage	37.4	2.4e-12
WP_058952013.1|1904285_1904831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058952014.1|1905295_1905619_-	negative regulator GrlR	NA	NA	NA	NA	NA
WP_058952015.1|1908559_1908886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058952016.1|1909004_1909547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058952017.1|1909623_1910013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058952018.1|1909999_1910812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058952019.1|1911188_1911689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058952020.1|1911744_1912659_-	hypothetical protein	NA	A0A0P0IL42	Acinetobacter_phage	32.0	2.2e-36
WP_058952021.1|1912734_1912998_-	hypothetical protein	NA	A0A1B1P9E1	Acinetobacter_phage	57.1	1.8e-20
WP_058952022.1|1912987_1913530_-	antA/AntB antirepressor family protein	NA	A0A0R6PJV6	Moraxella_phage	36.8	7.4e-24
WP_129556776.1|1913855_1914344_-	hypothetical protein	NA	A0A1B1P9D6	Acinetobacter_phage	31.5	7.1e-10
WP_058952024.1|1914343_1914736_-	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	33.1	5.2e-11
WP_058952025.1|1914738_1915005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058952026.1|1915031_1915784_-	hypothetical protein	NA	A0A0P0J0C5	Acinetobacter_phage	32.0	1.0e-31
WP_058952027.1|1915812_1916169_-	hypothetical protein	NA	A0A1B1P9E3	Acinetobacter_phage	48.9	1.4e-26
WP_058951837.1|1916230_1916932_+|transposase	IS1 family transposase	transposase	A0A218MNG1	uncultured_virus	53.6	1.6e-34
WP_058952028.1|1916975_1917350_-	hypothetical protein	NA	A0A0D4DC24	Acinetobacter_phage	58.9	1.2e-33
WP_171253715.1|1917354_1917807_-	HeH/LEM domain protein	NA	J7I4P7	Acinetobacter_phage	41.4	2.1e-16
WP_058952029.1|1918031_1918988_-	hypothetical protein	NA	A0A0M3LQL5	Mannheimia_phage	67.5	1.5e-115
WP_058952030.1|1919008_1919758_-	hypothetical protein	NA	A0A0M3LQV7	Mannheimia_phage	60.4	6.1e-69
WP_058952031.1|1919864_1920221_-	hypothetical protein	NA	Q716B1	Shigella_phage	56.5	2.9e-29
WP_058952520.1|1920272_1920488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058952032.1|1920489_1921617_-|capsid	minor capsid protein	capsid	A0A0P0IR98	Acinetobacter_phage	54.6	1.8e-109
WP_058952033.1|1921619_1923056_-	DUF4055 domain-containing protein	NA	A0A0D4DCP1	Acinetobacter_phage	46.8	2.8e-118
WP_058952034.1|1923057_1924461_-|terminase	phage terminase large subunit	terminase	J7I460	Acinetobacter_phage	72.4	6.5e-197
WP_058952035.1|1924450_1924918_-	DUF2280 domain-containing protein	NA	A0A0D4DC15	Acinetobacter_phage	69.4	3.8e-53
WP_058952036.1|1924964_1925594_-	hypothetical protein	NA	A0A1B1P9K3	Acinetobacter_phage	54.8	3.0e-61
WP_164996885.1|1925859_1926033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058952521.1|1926183_1927251_-	RelA/SpoT domain-containing protein	NA	A0A1B0VBT5	Salmonella_phage	30.6	6.8e-29
WP_058952037.1|1928186_1928366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058952038.1|1928412_1928901_-	hypothetical protein	NA	A0A0P0IY98	Acinetobacter_phage	80.6	1.1e-71
WP_058952039.1|1928897_1929302_-	DUF559 domain-containing protein	NA	A0A0P0I8E8	Acinetobacter_phage	63.4	1.0e-41
WP_058952040.1|1929279_1929480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058952041.1|1929472_1929658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058952042.1|1929654_1929921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058952043.1|1929917_1930667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058952044.1|1930659_1931649_-	hypothetical protein	NA	A0A0D4DBT2	Acinetobacter_phage	70.3	7.8e-64
WP_058952045.1|1931731_1931950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058952046.1|1931955_1932315_-	hypothetical protein	NA	A0A0D4DBI9	Acinetobacter_phage	68.7	6.2e-35
WP_058952047.1|1932311_1932620_-	hypothetical protein	NA	A0A0P0I444	Acinetobacter_phage	40.7	1.7e-12
WP_058952522.1|1932616_1932907_-	hypothetical protein	NA	A0A0D4DCC3	Acinetobacter_phage	44.2	4.1e-05
WP_058952048.1|1932955_1933456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058952049.1|1933514_1933745_-	helix-turn-helix domain-containing protein	NA	A0A0R6PHP1	Moraxella_phage	39.7	8.3e-09
WP_058952050.1|1934657_1934966_+	hypothetical protein	NA	A0A0D4DCL0	Acinetobacter_phage	82.7	1.5e-37
WP_129556772.1|1935295_1935475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058952052.1|1935872_1936301_+	hypothetical protein	NA	A0A0D4DBH9	Acinetobacter_phage	44.9	4.0e-25
WP_058952053.1|1936300_1936606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058952054.1|1936618_1937752_+	ATP-binding protein	NA	A0A0P0HSM9	Acinetobacter_phage	79.7	7.4e-167
WP_058952055.1|1937882_1938122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081316831.1|1938223_1938634_+	hypothetical protein	NA	I2GUB5	Acinetobacter_phage	50.0	8.7e-09
WP_167541268.1|1939091_1939301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058952056.1|1939297_1939747_+	hypothetical protein	NA	S5VVC5	Pseudomonas_phage	33.6	2.0e-11
WP_058952524.1|1939746_1940031_+	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_058952057.1|1940027_1941047_-|integrase	site-specific integrase	integrase	A0A0R6PHH4	Moraxella_phage	41.9	9.8e-70
WP_010326624.1|1941329_1941698_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	35.4	2.6e-12
1941249:1941265	attR	CTAAAATCATTGTATAC	NA	NA	NA	NA
WP_010326623.1|1941742_1942093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010326622.1|1942103_1942385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004979945.1|1942399_1942711_+	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	43.1	2.9e-17
>prophage 9
NZ_CP010350	Acinetobacter johnsonii XBB1 chromosome, complete genome	3509795	2021492	2135313	3509795	protease,transposase,terminase,integrase,holin,tail,capsid,plate,head,portal	uncultured_Caudovirales_phage(22.5%)	108	2016810:2016826	2139334:2139350
2016810:2016826	attL	ATTAAGTTTTTTCAAAT	NA	NA	NA	NA
WP_010326555.1|2021492_2021780_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JAM4	uncultured_Caudovirales_phage	57.9	1.0e-24
WP_004693516.1|2022643_2022853_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	66.7	7.5e-17
WP_004693517.1|2023131_2023347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004980175.1|2023916_2025122_+	DUF1615 family protein	NA	NA	NA	NA	NA
WP_010326553.1|2025088_2025745_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_010326552.1|2025905_2026106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058952061.1|2026141_2027236_-	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_010326550.1|2027250_2028318_-	ferredoxin reductase	NA	NA	NA	NA	NA
WP_004693528.1|2028458_2029154_+	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_010326549.1|2029192_2030008_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_005399638.1|2030147_2030414_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_058869470.1|2030574_2033412_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	36.6	1.9e-22
WP_010326546.1|2033548_2034193_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_029575002.1|2034366_2035482_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_058952063.1|2035501_2036632_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_058952525.1|2036642_2038454_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.0	1.6e-17
WP_010326542.1|2038471_2039494_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004693547.1|2039604_2040240_+	CerR family C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_010326541.1|2040230_2041985_-	amidohydrolase	NA	NA	NA	NA	NA
WP_010326540.1|2042138_2043023_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004693553.1|2043131_2043707_+	chromate transporter	NA	NA	NA	NA	NA
WP_010326539.1|2043703_2044219_+	chromate transporter	NA	NA	NA	NA	NA
WP_130235085.1|2044366_2045722_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_058952064.1|2045781_2046714_+|transposase	IS5-like element ISAha1 family transposase	transposase	Q1MVF0	Enterobacteria_phage	40.8	6.3e-55
WP_010326537.1|2046747_2047023_+	EamA family transporter	NA	NA	NA	NA	NA
WP_010326536.1|2047159_2048347_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_010326535.1|2048343_2050479_-	type I secretion system permease/ATPase	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.8	5.7e-19
WP_010326534.1|2050475_2052092_-	TolC family protein	NA	NA	NA	NA	NA
WP_004980250.1|2052088_2053174_-	glycosyltransferase	NA	A0A1V0SAJ8	Catovirus	32.8	7.8e-41
WP_164996886.1|2053265_2058653_-	type I secretion C-terminal target domain-containing protein	NA	NA	NA	NA	NA
WP_058952065.1|2058860_2059760_-	BapA prefix-like domain-containing protein	NA	NA	NA	NA	NA
WP_007116247.1|2060490_2061519_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_035330447.1|2062073_2062775_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.2	5.8e-29
WP_050796976.1|2063577_2063925_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_010326529.1|2064040_2065204_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_029574999.1|2065436_2066381_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010326527.1|2066470_2067112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010326526.1|2067113_2067749_+	LysE family translocator	NA	NA	NA	NA	NA
WP_010326525.1|2068017_2068335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010326524.1|2068443_2069493_+	linear amide C-N hydrolase	NA	NA	NA	NA	NA
WP_010326523.1|2069723_2070347_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A2H4J538	uncultured_Caudovirales_phage	41.0	1.8e-26
WP_010326522.1|2070367_2071663_+	Y-family DNA polymerase	NA	A0A2H4JBL5	uncultured_Caudovirales_phage	50.6	6.8e-124
WP_010326521.1|2071724_2072231_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_010326520.1|2072440_2072794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004637176.1|2073061_2073994_+|transposase	IS5-like element ISAha1 family transposase	transposase	Q1MVF0	Enterobacteria_phage	40.8	2.2e-55
WP_010326519.1|2074023_2074881_+	P-loop ATPase	NA	R9TRQ8	Vibrio_phage	24.6	2.8e-09
WP_010326518.1|2074912_2076478_-	putative phage abortive infection protein	NA	NA	NA	NA	NA
WP_010326517.1|2076568_2077030_-	type II toxin-antitoxin system YafO family toxin	NA	NA	NA	NA	NA
WP_155115399.1|2077032_2077194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010326516.1|2077442_2078450_-|portal	phage portal protein	portal	A0A2H4J922	uncultured_Caudovirales_phage	55.9	7.6e-99
WP_058952066.1|2078449_2080234_-|terminase	terminase	terminase	Q9ZXM5	Pseudomonas_virus	61.8	1.0e-215
WP_029574996.1|2080443_2080623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010326514.1|2080843_2081665_+|capsid	GPO family capsid scaffolding protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	42.8	7.7e-49
WP_010326513.1|2081682_2082693_+|capsid	phage major capsid protein, P2 family	capsid	A4JWP9	Burkholderia_virus	51.3	4.5e-91
WP_010326512.1|2082700_2083384_+|terminase	terminase	terminase	Q9ZXM2	Pseudomonas_virus	44.6	5.1e-38
WP_010326511.1|2083479_2083932_+|head	head completion/stabilization protein	head	E5E3W6	Burkholderia_phage	43.0	6.6e-26
WP_010326510.1|2083928_2084138_+|tail	tail protein X	tail	A0A077K8R0	Ralstonia_phage	62.1	5.7e-17
WP_010326509.1|2084140_2084500_+	membrane protein	NA	NA	NA	NA	NA
WP_010326508.1|2084496_2084769_+|holin	phage holin family protein	holin	Q9ZXL7	Pseudomonas_virus	44.9	1.2e-09
WP_010326507.1|2084765_2085620_+	N-acetylmuramidase family protein	NA	Q9ZXL6	Pseudomonas_virus	44.9	3.8e-51
WP_010326506.1|2085616_2086144_+|tail	phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	41.5	4.5e-26
WP_010326505.1|2086154_2086595_+	phage virion morphogenesis protein	NA	A0A2H4J927	uncultured_Caudovirales_phage	42.4	2.1e-24
WP_010326504.1|2086689_2087319_+|plate	phage baseplate assembly protein V	plate	A0A2H4JFJ8	uncultured_Caudovirales_phage	38.1	1.6e-25
WP_010326503.1|2087315_2087660_+	GPW/gp25 family protein	NA	A0A2H4JE52	uncultured_Caudovirales_phage	49.6	2.2e-21
WP_010326502.1|2087656_2088568_+|plate	baseplate J/gp47 family protein	plate	D5LGZ3	Escherichia_phage	46.2	1.7e-65
WP_010326501.1|2088564_2089170_+|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	42.7	3.3e-33
WP_010326500.1|2089162_2091241_+	hypothetical protein	NA	A0A291LB82	Escherichia_phage	34.3	7.3e-96
WP_010326499.1|2091281_2092658_+|tail	phage tail protein	tail	A0A193GYM0	Enterobacter_phage	51.2	9.7e-121
WP_010326498.1|2092668_2092956_+	hypothetical protein	NA	A0A088FV63	Escherichia_phage	61.1	3.7e-22
WP_010326497.1|2093045_2094221_+|tail	phage tail sheath protein	tail	Q9ZXK4	Pseudomonas_virus	62.1	2.7e-140
WP_010326496.1|2094259_2094775_+|tail	phage major tail tube protein	tail	Q9ZXK3	Pseudomonas_virus	62.6	9.1e-56
WP_010326495.1|2094837_2095176_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_081241752.1|2095193_2095310_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_010326494.1|2095324_2097901_+|tail	phage tail tape measure protein	tail	A0A1W6JT50	Escherichia_phage	57.1	5.1e-99
WP_010326493.1|2097906_2098347_+|tail	phage tail protein	tail	A0A077K9Y7	Ralstonia_phage	50.4	4.6e-32
WP_010326492.1|2098343_2099651_+	primase	NA	Q9ZXJ8	Pseudomonas_virus	39.6	1.1e-78
WP_081241753.1|2099793_2100069_+	ogr/Delta-like zinc finger family protein	NA	E5E3T8	Burkholderia_phage	44.4	5.8e-09
WP_029574995.1|2100061_2100262_+	TraR/DksA C4-type zinc finger protein	NA	G3EN77	Psychrobacter_phage	46.0	2.2e-05
WP_155115398.1|2100258_2100420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035330444.1|2100899_2101172_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_081241754.1|2101190_2101385_-	hypothetical protein	NA	A0A0R6PIB1	Moraxella_phage	50.0	6.1e-05
WP_010326489.1|2101511_2101829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010326488.1|2101842_2102601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058952067.1|2103743_2104784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010326484.1|2105099_2105294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010326483.1|2105466_2105682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058952068.1|2105695_2106634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010326481.1|2106654_2106996_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010326480.1|2107088_2107280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010326477.1|2110082_2110361_+	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_010326476.1|2110395_2111421_-|integrase	site-specific integrase	integrase	A0A0R6PHH4	Moraxella_phage	44.5	1.7e-77
WP_010326475.1|2111684_2113676_-	DUF3488 domain-containing transglutaminase family protein	NA	NA	NA	NA	NA
WP_010326474.1|2113686_2114586_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_010326473.1|2114602_2115559_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_004693572.1|2116939_2117242_-	YbdD/YjiX family protein	NA	NA	NA	NA	NA
WP_171056738.1|2117252_2119271_-	carbon starvation protein A	NA	NA	NA	NA	NA
WP_004693574.1|2119523_2120093_-	elongation factor P	NA	NA	NA	NA	NA
WP_010326469.1|2120402_2121419_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_029574994.1|2121436_2123182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058952069.1|2123163_2125290_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004693579.1|2125437_2125665_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_010326467.1|2125870_2126851_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_010326466.1|2127018_2127420_-	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_010326465.1|2127542_2129684_-	MFS transporter	NA	NA	NA	NA	NA
WP_164996898.1|2129886_2132475_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_004693588.1|2132555_2132897_-	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_058952071.1|2133059_2134271_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_058952072.1|2134350_2135313_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	27.0	1.5e-22
2139334:2139350	attR	ATTTGAAAAAACTTAAT	NA	NA	NA	NA
>prophage 10
NZ_CP010350	Acinetobacter johnsonii XBB1 chromosome, complete genome	3509795	3420889	3429118	3509795		Enterobacteria_phage(33.33%)	8	NA	NA
WP_058952428.1|3420889_3421990_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5EQ73	Micromonas_sp._RCC1109_virus	21.7	1.3e-06
WP_058952429.1|3421989_3422865_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.9	5.4e-109
WP_058952430.1|3422864_3423929_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.3	4.7e-99
WP_058952431.1|3424038_3425898_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	26.1	6.9e-21
WP_058952432.1|3425959_3427129_-	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	A0A2K9L0G1	Tupanvirus	49.2	7.0e-104
WP_058952433.1|3427165_3427822_-	NeuD/PglB/VioB family sugar acetyltransferase	NA	NA	NA	NA	NA
WP_058952434.1|3427814_3428423_-	sugar transferase	NA	NA	NA	NA	NA
WP_058952435.1|3428578_3429118_-	serine acetyltransferase	NA	A0A191KBJ5	Streptococcus_virus	55.2	1.2e-45
>prophage 1
NZ_CP010358	Acinetobacter johnsonii XBB1 plasmid pXBB1-8, complete sequence	117483	142	95695	117483	transposase,protease,integrase	Clostridioides_phage(22.22%)	58	35200:35220	88505:88525
WP_058952654.1|142_3343_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_101598960.1|5751_6216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058952656.1|12132_12909_-	AAA family ATPase	NA	Q8JL10	Natrialba_phage	36.6	5.1e-18
WP_004637173.1|13820_14993_+	replication initiation protein	NA	A0A1V0E006	Clostridioides_phage	23.8	7.5e-05
WP_058952659.1|17079_18312_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_058952660.1|18583_18913_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_058952661.1|19121_19988_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_004704365.1|19998_20610_+	DUF1819 family protein	NA	NA	NA	NA	NA
WP_005403808.1|20626_21202_+	DUF1788 domain-containing protein	NA	NA	NA	NA	NA
WP_058952662.1|21242_24905_+	BREX system P-loop protein BrxC	NA	NA	NA	NA	NA
WP_058952663.1|24951_28461_+	BREX-1 system adenine-specific DNA-methyltransferase PglX	NA	A0A2R2ZGH5	Clostridioides_phage	21.3	5.3e-06
WP_058952664.1|28463_30404_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_058952665.1|30400_33025_+	BREX-1 system phosphatase PglZ type A	NA	NA	NA	NA	NA
WP_058952666.1|33054_35094_+|protease	protease Lon-related BREX system protein BrxL	protease	NA	NA	NA	NA
35200:35220	attL	TATTTTTAGGGGGGATTACCC	NA	NA	NA	NA
WP_039048208.1|35795_35996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039048207.1|36054_37203_+	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_058952667.1|37186_38269_+	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_058952668.1|38270_40391_+	ATP-binding cassette domain-containing protein	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	25.2	1.3e-60
WP_004812033.1|41693_42260_+	recombinase family protein	NA	Q2A092	Sodalis_phage	37.9	9.1e-25
WP_058952669.1|46294_47041_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000743272.1|48857_49790_-|transposase	IS5-like element IS17 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	42.3	3.4e-61
WP_019838315.1|49981_51271_+	salicylate 1-monooxygenase	NA	NA	NA	NA	NA
WP_058952671.1|52564_53917_+	MFS transporter	NA	NA	NA	NA	NA
WP_081316875.1|53968_54862_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_129556780.1|54893_55145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058952672.1|55429_56107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101598961.1|56303_57318_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	30.8	3.9e-18
WP_058952674.1|57436_58606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081293444.1|58648_59179_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_085947913.1|59253_60343_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_058952676.1|60492_61227_+	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_058952677.1|61371_62175_+	enoyl-ACP reductase	NA	NA	NA	NA	NA
WP_085947913.1|62329_63419_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_058952678.1|63573_64635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058952679.1|64631_66002_+	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_058952680.1|65998_66334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058952681.1|66380_67973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058952682.1|68033_68294_-	TetR family transcriptional regulator C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_058952684.1|69839_71054_-	4-hydroxybenzoate 3-monooxygenase	NA	NA	NA	NA	NA
WP_058952685.1|71209_72025_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_058952686.1|72117_72876_-	OmpW family protein	NA	NA	NA	NA	NA
WP_058952687.1|72944_74408_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_081316878.1|74893_75310_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_058952688.1|75509_76460_+	oxidoreductase	NA	NA	NA	NA	NA
WP_058952689.1|76486_77575_+	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_058952690.1|78684_80196_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_081293445.1|80894_81290_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_058952691.1|81237_81708_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_058952692.1|83259_84942_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_058952693.1|84971_87119_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_058952694.1|87102_87906_-|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	NA	NA	NA	NA
WP_098733269.1|88576_89651_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.6	4.4e-44
88505:88525	attR	GGGTAATCCCCCCTAAAAATA	NA	NA	NA	NA
WP_005006273.1|89661_90678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058952695.1|90928_92263_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_005199958.1|92441_92906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058952696.1|92899_94084_-	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_005199960.1|94058_94814_-	multiubiquitin domain-containing protein	NA	NA	NA	NA	NA
WP_058952697.1|94948_95695_-|transposase	IS5-like element ISAba31 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	37.4	1.6e-13
>prophage 1
NZ_CP010351	Acinetobacter johnsonii XBB1 plasmid pXBB1-9, complete sequence	398857	145490	188066	398857	transposase,integrase	uncultured_Caudovirales_phage(16.67%)	42	167376:167435	182595:183035
WP_101598957.1|145490_146566_-|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_005005993.1|146663_147038_+	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_003464986.1|148334_148616_-	DUF427 domain-containing protein	NA	NA	NA	NA	NA
WP_005005995.1|148683_148956_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	41.9	7.5e-09
WP_002118292.1|149409_150156_-	ferredoxin reductase	NA	NA	NA	NA	NA
WP_003464980.1|150148_150751_-	sulfite oxidase-like oxidoreductase	NA	NA	NA	NA	NA
WP_003464979.1|151218_151689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010591688.1|152014_152308_-	DUF1330 domain-containing protein	NA	NA	NA	NA	NA
WP_005006001.1|152366_152798_-	heme-binding protein	NA	NA	NA	NA	NA
WP_002118279.1|152870_153884_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_005006003.1|153929_154238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002118270.1|154329_155298_-	magnesium and cobalt transport protein CorA	NA	NA	NA	NA	NA
WP_005006007.1|155294_155999_-	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_003464967.1|156139_156679_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_003464965.1|156680_157124_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_074964445.1|157644_158403_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	36.4	2.1e-32
WP_081316857.1|159571_160600_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_002122354.1|160843_162196_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.8	2.9e-37
WP_058952570.1|162391_163324_-|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	42.9	4.1e-62
WP_005006018.1|163499_164879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005006020.1|165029_165590_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A2H4J538	uncultured_Caudovirales_phage	44.4	5.3e-33
WP_058952571.1|165586_166876_+	Y-family DNA polymerase	NA	A0A2H4JBL5	uncultured_Caudovirales_phage	45.9	9.1e-113
WP_033917550.1|167010_167259_-	hypothetical protein	NA	NA	NA	NA	NA
167376:167435	attL	GCTGTGACTGACCATTAAAGTCTCAAAAATGACATTAATGTTCTAAACTTTAACAATATA	NA	NA	NA	NA
WP_032495673.1|167945_168959_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	4.7e-72
WP_001749986.1|169131_169584_+	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_003159191.1|169722_170277_+	aminoglycoside N-acetyltransferase AAC(6')-Ib4	NA	NA	NA	NA	NA
WP_000679427.1|170445_170793_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|170786_171626_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000050481.1|172030_173572_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001100753.1|173884_174811_+	inhibitor-resistant class A extended-spectrum beta-lactamase PER-1	NA	NA	NA	NA	NA
WP_001176353.1|174884_175460_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_032495614.1|175498_177340_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.6	8.6e-32
WP_032495674.1|177710_178412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033917513.1|178384_178714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032495677.1|179212_179443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|179756_180596_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376623.1|180723_181224_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001381192.1|181192_182185_-	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_033917495.1|183006_183435_-	hypothetical protein	NA	NA	NA	NA	NA
182595:183035	attR	GCTGTGACTGACCATTAAAGTCTCAAAAATGACATTAATGTTCTAAACTTTAACAATATAGTTGTAAACTCAAAGAGGAAGTTTGAATGAATATTACGAAAAAATCAGATTCAATACTTGTGGTATTTTTTAAGTTGTTTCTTTGTAGCAGTGCATTTGTTGCATGTATTTTATTTGGATTTTGGTTGAGTCCAATGCAAGTACCATCCCCAATAGTCATTTTTATATCACTTGCAATCACCGTTTTATTTACTTATTGGATATTTGGAATAGGTAAACTCAAACATAAGTAAATTTACAACTATTATGTCATAAATGGATTGGTTATCTAAACTCAAAGTTCATTGAGTTTAGAACTATAATGTAAATTTACTGAATCATACCTAATGTAAGTTATTGATTTTATGATTCATCAGTTTAAGTCTTTAATGTGCAAAGACA	NA	NA	NA	NA
WP_033917496.1|184749_185175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058952573.1|185552_186701_-	hypothetical protein	NA	I6XKU1	Burkholderia_virus	28.3	1.8e-27
WP_079284005.1|187040_188066_+|transposase	IS30-like element ISAba125 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.8	2.1e-51
>prophage 2
NZ_CP010351	Acinetobacter johnsonii XBB1 plasmid pXBB1-9, complete sequence	398857	225405	298168	398857	transposase,integrase	Escherichia_phage(15.38%)	60	283349:283364	303126:303141
WP_101598943.1|225405_226496_-|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_058952586.1|227151_228087_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000762837.1|228209_228698_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_101598956.1|228737_229828_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_009499586.1|229914_230151_+	glutaredoxin	NA	A0A088C3W5	Shewanella_sp._phage	31.8	9.7e-05
WP_000483554.1|230182_230623_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_079381165.1|230644_230890_+	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_058952588.1|230940_231249_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_000857678.1|231245_232520_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_001281573.1|232529_233192_+	peptide-methionine (S)-S-oxide reductase	NA	NA	NA	NA	NA
WP_002119794.1|233412_234390_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	35.0	1.7e-18
WP_153310265.1|234761_234938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000257537.1|235007_236294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000088799.1|237382_237937_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_004911234.1|238074_238590_+	DUF417 family protein	NA	NA	NA	NA	NA
WP_057081898.1|239528_239741_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_057081899.1|239951_240242_+	hypothetical protein	NA	D2IZW1	Enterococcus_phage	41.1	2.7e-09
WP_057104322.1|240287_240908_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_058952589.1|240907_242431_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	39.4	2.4e-88
WP_081316859.1|242420_243593_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_058952590.1|243592_244528_+	DUF1016 family protein	NA	NA	NA	NA	NA
WP_081316860.1|244749_245685_+	Abi family protein	NA	A0A059NT88	Lactococcus_phage	23.5	2.5e-11
WP_058952591.1|245754_249036_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	26.6	4.2e-61
WP_057081905.1|249037_249784_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_057081906.1|250004_250187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057081907.1|250497_250731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081316861.1|251024_252470_+	site-specific DNA-methyltransferase	NA	S5VTV9	Campylobacter_phage	34.5	6.7e-56
WP_058952593.1|252462_255306_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_058952594.1|255365_258209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058952595.1|258507_259170_+	DUF2807 domain-containing protein	NA	NA	NA	NA	NA
WP_058952596.1|259251_260931_-	virulence-associated e family protein	NA	A0A0R6PCD2	Moraxella_phage	28.5	2.4e-12
WP_058952597.1|260947_261856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005028487.1|261924_263124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043041426.1|264220_264730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043041427.1|265085_267749_+	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	32.5	1.0e-65
WP_043041428.1|267765_268764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005028471.1|268959_269193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038350045.1|269273_271082_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_038350046.1|271283_271613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038350047.1|271855_272317_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_038350048.1|272428_272941_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_005006214.1|274458_275148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038350020.1|275365_276403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043041552.1|278549_279395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046127922.1|279509_280082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043041553.1|280108_281041_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A166YH27	Gordonia_phage	31.9	2.8e-15
WP_005006227.1|281116_281494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005006261.1|281931_282177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043041554.1|282252_282681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043041555.1|282870_283404_+	hypothetical protein	NA	NA	NA	NA	NA
283349:283364	attL	CTTATGATGCTGGTGC	NA	NA	NA	NA
WP_024160906.1|283442_284084_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_000557454.1|285747_286608_+	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_000587837.1|286620_287163_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000951934.1|287644_287836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000248278.1|287859_288087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014342213.1|290905_291031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034686254.1|292339_293113_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	57.0	8.2e-77
WP_034686252.1|293112_294132_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	46.4	8.0e-80
WP_058952600.1|295092_296439_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_047472181.1|297235_298168_-|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	42.9	5.3e-62
303126:303141	attR	GCACCAGCATCATAAG	NA	NA	NA	NA
>prophage 3
NZ_CP010351	Acinetobacter johnsonii XBB1 plasmid pXBB1-9, complete sequence	398857	314963	363857	398857	transposase	Escherichia_phage(26.67%)	45	NA	NA
WP_001067790.1|314963_315668_-|transposase	IS6-like element IS1008 family transposase	transposase	A0A077SL39	Escherichia_phage	84.5	5.1e-118
WP_010591498.1|315714_315894_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_171026923.1|315890_316517_-	organomercurial lyase MerB	NA	NA	NA	NA	NA
WP_033869423.1|316612_317266_-	phenylmercury resistance protein MerG	NA	NA	NA	NA	NA
WP_033917451.1|317301_319011_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.2	2.8e-37
WP_005028432.1|319197_319476_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_005028429.1|319489_319840_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_026040425.1|319857_320205_+	mercuric resistance transcriptional repressor protein MerD	NA	NA	NA	NA	NA
WP_010591735.1|320201_320438_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_033917452.1|320643_321990_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.3	8.5e-37
WP_033917453.1|322187_322754_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	83.5	1.7e-47
WP_001166626.1|324238_324694_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294659.1|324765_325116_+	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_004178136.1|325129_325405_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_000522996.1|325432_325858_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_058952602.1|325896_327531_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.9	1.0e-36
WP_033917456.1|327570_328197_+	organomercurial lyase MerB	NA	NA	NA	NA	NA
WP_033917457.1|328237_328603_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_001087807.1|328599_328836_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_000993245.1|328901_329114_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001067783.1|330371_331076_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	84.5	2.3e-118
WP_005093369.1|331387_332164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033917445.1|332163_332730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033917444.1|332731_336115_+	UvrD-helicase domain-containing protein	NA	G3MA40	Bacillus_virus	26.3	1.9e-37
WP_005093363.1|336213_336969_+	multiubiquitin domain-containing protein	NA	NA	NA	NA	NA
WP_005093361.1|336943_338128_+	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_005093359.1|338121_338595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019838313.1|339023_339917_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019838314.1|339966_341319_-	MFS transporter	NA	NA	NA	NA	NA
WP_058952603.1|341587_342508_-	catechol 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_019838315.1|342607_343897_-	salicylate 1-monooxygenase	NA	NA	NA	NA	NA
WP_158660397.1|344097_344994_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_020753574.1|345461_346727_+	CmlA/FloR family chloramphenicol efflux MFS transporter	NA	S4TR35	Salmonella_phage	29.0	3.2e-25
WP_020753573.1|346719_347925_+|transposase	ISL3 family transposase	transposase	A9YX10	Burkholderia_phage	58.6	4.2e-112
WP_081316864.1|347857_349294_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_019838318.1|349366_350458_+	NAD(P)-dependent alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	28.0	2.1e-30
WP_058952605.1|350771_351476_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	83.6	2.8e-116
WP_001067784.1|352287_352992_+|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
WP_033917554.1|353425_354940_-	MFS transporter	NA	NA	NA	NA	NA
WP_033917515.1|355168_356566_-	AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor	NA	NA	NA	NA	NA
WP_033917518.1|356645_359756_-	AdeB/AdeJ family multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	24.4	9.4e-63
WP_033917516.1|359755_360943_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_033917517.1|361081_361813_+	efflux system response regulator transcription factor AdeR	NA	NA	NA	NA	NA
WP_043041662.1|361802_362882_+	two-component sensor histidine kinase AdeS	NA	W8CYF6	Bacillus_phage	28.0	2.7e-25
WP_033917576.1|362894_363857_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	33.5	9.1e-33
