The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012122	Lactiplantibacillus plantarum strain LZ95 chromosome, complete genome	3261418	317618	399557	3261418	protease,tRNA,bacteriocin	Bacillus_virus(20.0%)	77	NA	NA
WP_003643762.1|317618_318182_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_013355171.1|318375_319044_+	ribose 5-phosphate isomerase A	NA	NA	NA	NA	NA
WP_013355172.1|319201_320707_+	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_013355173.1|320971_321340_+	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_003641932.1|321452_321962_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_013355174.1|321992_323189_-	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_003646440.1|323298_323769_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_003641935.1|323787_324243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013355176.1|324346_324919_+	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit	NA	NA	NA	NA	NA
WP_013355177.1|325084_326005_-	ribonucleoside hydrolase RihC	NA	NA	NA	NA	NA
WP_013355178.1|326141_327053_+	oxidoreductase	NA	NA	NA	NA	NA
WP_003646442.1|327799_328246_-	ribonuclease H	NA	NA	NA	NA	NA
WP_003641940.1|328483_330010_+	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_003641941.1|330010_330982_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	1.7e-23
WP_003646444.1|331059_332391_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003643773.1|332856_334374_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_003641944.1|334388_336218_+	type 1 glycerol-3-phosphate oxidase	NA	NA	NA	NA	NA
WP_003641945.1|336232_336955_+	aquaporin family protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	31.9	3.2e-30
WP_058906756.1|337537_341221_+	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_058906757.1|341222_342986_+	pre-toxin TG domain-containing protein	NA	NA	NA	NA	NA
WP_003641948.1|342982_343900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003641949.1|343943_344207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003641950.1|344318_344597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003641952.1|344976_345363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003641954.1|345812_346004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114071742.1|346206_346353_+	glycohydrolase toxin TNT-related protein	NA	NA	NA	NA	NA
WP_003641956.1|346429_346837_+	immunity 63 family protein	NA	NA	NA	NA	NA
WP_003641960.1|348107_348383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003641962.1|348764_349382_-	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_003641963.1|349385_350540_-	MFS transporter	NA	NA	NA	NA	NA
WP_011100993.1|350543_351335_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_058906758.1|351405_352278_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_003641966.1|352437_353253_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_011100994.1|353778_355155_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_011100995.1|355199_356384_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_003641969.1|356768_356972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003641971.1|357383_358052_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003641972.1|358048_358222_-|bacteriocin	two-peptide bacteriocin plantaricin JK subunit PlnK	bacteriocin	NA	NA	NA	NA
WP_003641973.1|358252_358420_-|bacteriocin	two-peptide bacteriocin plantaricin JK subunit PlnJ	bacteriocin	NA	NA	NA	NA
WP_003641974.1|359281_359482_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003641975.1|359609_359777_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003641976.1|359894_361094_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_003641977.1|361124_361871_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003641979.1|362748_362895_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_011100998.1|363085_364414_+	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_058906759.1|364414_365158_+	LytTR family transcriptional regulator DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003641982.1|365276_366020_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003646470.1|366324_367098_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003643811.1|367196_367355_-|bacteriocin	two-peptide bacteriocin plantaricin EF subunit PlnF	bacteriocin	NA	NA	NA	NA
WP_003641985.1|367379_367550_-|bacteriocin	two-peptide bacteriocin plantaricin EF subunit PlnE	bacteriocin	NA	NA	NA	NA
WP_003641986.1|367816_369967_+	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	27.9	6.1e-45
WP_003641987.1|369982_371359_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_003641990.1|372205_372874_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003641991.1|372960_373641_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003641992.1|373734_374421_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003641993.1|374558_374762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003641994.1|374856_377166_-	ATP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003643814.1|377424_378201_+	carbon-nitrogen family hydrolase	NA	NA	NA	NA	NA
WP_003643815.1|378639_379656_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003641997.1|380063_380774_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003641998.1|380846_382208_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003641999.1|382214_382403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003642000.1|382392_382815_+	DUF3284 domain-containing protein	NA	NA	NA	NA	NA
WP_003643816.1|383037_384393_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003642002.1|384410_385847_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.5	9.7e-31
WP_003642003.1|385967_386864_+	ROK family protein	NA	NA	NA	NA	NA
WP_003642004.1|387013_387760_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003643818.1|387872_388886_+|tRNA	tRNA-dihydrouridine synthase family protein	tRNA	NA	NA	NA	NA
WP_003642006.1|389339_390473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003643820.1|390477_391272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003642008.1|391440_392358_+	Ppx/GppA family phosphatase	NA	NA	NA	NA	NA
WP_003642009.1|392403_393678_+	hydroxymethylglutaryl-CoA reductase, degradative	NA	NA	NA	NA	NA
WP_003642010.1|393670_394630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003642011.1|394651_395356_+	NAD-dependent protein deacylase	NA	NA	NA	NA	NA
WP_003642012.1|395355_396198_+	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_003646492.1|396794_397184_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_003643823.1|397505_399557_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	35.8	2.7e-90
>prophage 2
NZ_CP012122	Lactiplantibacillus plantarum strain LZ95 chromosome, complete genome	3261418	1007054	1015565	3261418		Synechococcus_phage(33.33%)	9	NA	NA
WP_003645861.1|1007054_1007537_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.0	2.3e-16
WP_011101896.1|1007520_1008651_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_003642587.1|1008653_1009385_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4SM18	Cyanophage	37.3	1.6e-37
WP_003642588.1|1009386_1009641_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_011101895.1|1009640_1010321_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003645864.1|1010313_1012533_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.3	4.5e-144
WP_058906790.1|1012517_1013972_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.0	1.9e-50
WP_013355836.1|1013968_1014994_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	40.7	5.4e-60
WP_003645867.1|1014986_1015565_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	33.9	1.3e-21
>prophage 3
NZ_CP012122	Lactiplantibacillus plantarum strain LZ95 chromosome, complete genome	3261418	1200852	1306044	3261418	terminase,integrase,portal,plate,capsid,protease,lysis,holin,head,tail	Lactobacillus_phage(50.65%)	126	1202189:1202248	1256469:1256540
WP_058906800.1|1200852_1202121_-|integrase	site-specific integrase	integrase	A0A0P0I3D2	Lactobacillus_phage	42.2	8.2e-90
1202189:1202248	attL	AAGCGAGTGACGGGAATCGGACCCGCGACTACAGCTTGGAAGGCTGTCGTTTTACCACTA	NA	NA	NA	NA
WP_080396925.1|1202302_1202479_-	hypothetical protein	NA	A0A2P0ZL93	Lactobacillus_phage	53.4	9.1e-08
WP_058906802.1|1202983_1203775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003644968.1|1203797_1204211_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0M4RD70	Bacillus_phage	31.3	3.4e-05
WP_003644967.1|1204222_1204591_-	helix-turn-helix transcriptional regulator	NA	E9LUL4	Lactobacillus_phage	44.1	5.7e-20
WP_003644966.1|1204740_1204977_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024623923.1|1205227_1205743_+	hypothetical protein	NA	D6PST4	Lactobacillus_phage	38.6	1.7e-25
WP_058906804.1|1205755_1206001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162922000.1|1206310_1206820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058906805.1|1206822_1207638_+	recombinase RecT	NA	A8ATY6	Listeria_phage	53.0	7.9e-62
WP_080396927.1|1207657_1208419_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	E9LUM4	Lactobacillus_phage	40.7	3.5e-48
WP_058906806.1|1208498_1209404_+	DnaD domain protein	NA	NA	NA	NA	NA
WP_058906807.1|1209417_1209918_+	hypothetical protein	NA	O03915	Lactobacillus_phage	88.6	5.0e-83
WP_058906808.1|1209914_1210292_+	endodeoxyribonuclease	NA	NA	NA	NA	NA
WP_058906809.1|1210288_1210723_+	hypothetical protein	NA	A0A288TZS1	Enterococcus_phage	48.8	3.6e-29
WP_058906810.1|1210722_1210953_+	hypothetical protein	NA	O03916	Lactobacillus_phage	61.8	3.5e-23
WP_058906811.1|1211412_1211724_+	hypothetical protein	NA	A0A2P0ZLB4	Lactobacillus_phage	89.3	3.6e-47
WP_162922001.1|1212632_1212797_+	hypothetical protein	NA	Q597S5	Lactobacillus_virus	86.5	4.6e-14
WP_080396929.1|1212941_1213373_+	hypothetical protein	NA	K4I239	Lactobacillus_phage	60.0	2.1e-37
WP_058906812.1|1213369_1213783_+	DUF1642 domain-containing protein	NA	E9LUP3	Lactobacillus_phage	58.7	1.3e-36
WP_080396930.1|1213779_1213947_+	hypothetical protein	NA	E9LUP4	Lactobacillus_phage	91.5	2.8e-14
WP_058906813.1|1214074_1214536_+	transcriptional regulator	NA	D6PSV8	Lactobacillus_phage	57.0	6.9e-39
WP_022638321.1|1214901_1215246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058906814.1|1215307_1215553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053267733.1|1215549_1215813_+	hypothetical protein	NA	A0A1S5RCN3	Lactobacillus_phage	69.8	2.4e-28
WP_080396931.1|1216420_1217710_+|terminase	PBSX family phage terminase large subunit	terminase	G8FUZ2	Pediococcus_virus	79.9	8.3e-207
WP_058906965.1|1217736_1219275_+|portal	phage portal protein	portal	G8FUZ1	Pediococcus_virus	66.0	1.7e-190
WP_058906816.1|1219192_1219999_+|capsid	minor capsid protein	capsid	G8FUZ0	Pediococcus_virus	66.4	6.5e-101
WP_058906817.1|1220014_1220236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058906818.1|1220378_1220969_+	DUF4355 domain-containing protein	NA	Q597V6	Lactobacillus_virus	45.7	9.2e-20
WP_058906819.1|1220988_1221849_+	hypothetical protein	NA	K4I067	Lactobacillus_virus	89.9	1.9e-143
WP_119724049.1|1221869_1222124_+	Ig-like domain-containing protein	NA	G8FUY7	Pediococcus_virus	63.5	1.0e-15
WP_058906820.1|1222183_1222522_+|head,tail	phage head-tail connector protein	head,tail	K4I470	Lactobacillus_virus	78.6	3.3e-46
WP_058906821.1|1222518_1222797_+	hypothetical protein	NA	G8FUY5	Pediococcus_virus	75.0	3.8e-32
WP_058906822.1|1222789_1223164_+	HK97 gp10 family phage protein	NA	G8FUY4	Pediococcus_virus	62.9	4.0e-37
WP_058906823.1|1223163_1223517_+	hypothetical protein	NA	K4I072	Lactobacillus_virus	70.9	9.6e-41
WP_058906824.1|1223536_1224325_+|tail	phage major tail protein, TP901-1 family	tail	Q597U9	Lactobacillus_virus	92.1	7.8e-99
WP_058906825.1|1224345_1224759_+	hypothetical protein	NA	A0A2K9VBY8	Lactobacillus_phage	59.9	6.2e-39
WP_058906827.1|1225079_1228520_+|tail	phage tail tape measure protein	tail	A0A2P0ZL32	Lactobacillus_phage	53.6	8.6e-17
WP_058906828.1|1228532_1229918_+|tail	phage tail family protein	tail	A0A2P0ZL23	Lactobacillus_phage	50.7	1.2e-123
WP_058906829.1|1232145_1234155_+|plate	BppU family phage baseplate upper protein	plate	A0A2P0ZKZ2	Lactobacillus_phage	73.4	2.5e-72
WP_058906830.1|1234167_1234551_+	hypothetical protein	NA	A0A2P0ZLF7	Lactobacillus_phage	92.9	2.3e-64
WP_058906831.1|1234553_1234748_+	hypothetical protein	NA	A0A2P0ZLG4	Lactobacillus_phage	92.2	4.2e-22
WP_058906832.1|1234747_1235032_+|lysis	lysis protein	lysis	A0A2P0ZLE8	Lactobacillus_phage	94.7	6.6e-40
WP_058906833.1|1235031_1236102_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A2P0ZLG2	Lactobacillus_phage	77.1	3.1e-98
WP_058906834.1|1236289_1237204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003646619.1|1237995_1238187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058906835.1|1238591_1240586_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	41.3	7.2e-32
WP_003642762.1|1240603_1242181_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_003642763.1|1242152_1243916_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	40.9	4.8e-96
WP_003639252.1|1244855_1244999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011101805.1|1245521_1245665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058906836.1|1246352_1249079_+	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_013355761.1|1249178_1251155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003642771.1|1251209_1251695_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003642772.1|1251743_1252016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003642773.1|1252040_1252274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003642774.1|1252686_1252893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058906837.1|1253244_1254366_-|integrase	site-specific integrase	integrase	D6PSS4	Lactobacillus_phage	32.1	8.4e-46
WP_058906838.1|1254543_1255407_-	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
WP_058906839.1|1255373_1256414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003642778.1|1256597_1256774_-	hypothetical protein	NA	A0A2P0ZL93	Lactobacillus_phage	51.7	2.6e-10
1256469:1256540	attR	AAGCGAGTGACGGGAATCGGACCCGCGACTACAGCTTGGAAGGCTGTCGTTTTACCACTAAACTACACTCGC	NA	NA	NA	NA
WP_022638129.1|1257149_1257431_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_022638128.1|1257461_1257821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021356373.1|1257847_1258225_-	large-conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_022638127.1|1258679_1259243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022638126.1|1259269_1260349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013355756.1|1261033_1261753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058906840.1|1261859_1262282_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0S2SXM3	Bacillus_phage	34.4	1.1e-11
WP_013355754.1|1262296_1262800_-	helix-turn-helix transcriptional regulator	NA	S6C481	Thermus_phage	42.6	1.7e-22
WP_033099030.1|1262945_1263200_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013355753.1|1263256_1263571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011101085.1|1263608_1263845_-	helix-turn-helix transcriptional regulator	NA	A0A0K2CNE2	Brevibacillus_phage	30.7	8.5e-09
WP_011101086.1|1263991_1264192_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003642792.1|1264350_1264521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058906841.1|1264532_1264838_+	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_022638124.1|1264905_1265418_+	helix-turn-helix transcriptional regulator	NA	D6PST4	Lactobacillus_phage	39.4	2.0e-23
WP_022638122.1|1265788_1266169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058906842.1|1266171_1267059_+	recombinase RecT	NA	E9LUM3	Lactobacillus_phage	53.7	2.0e-63
WP_162922002.1|1267090_1267843_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A0P0IZH9	Lactobacillus_phage	52.2	1.1e-73
WP_058906844.1|1267921_1268830_+	DnaD domain protein	NA	NA	NA	NA	NA
WP_013355745.1|1268826_1269114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011101096.1|1269110_1269641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013355744.1|1269637_1270156_+	hypothetical protein	NA	O03915	Lactobacillus_phage	69.1	4.5e-55
WP_013355743.1|1270152_1270533_+	endodeoxyribonuclease	NA	NA	NA	NA	NA
WP_058906845.1|1270617_1271109_+	methyltransferase domain-containing protein	NA	O03918	Lactobacillus_phage	93.1	2.5e-87
WP_154698893.1|1271176_1271350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058906846.1|1271352_1271571_+	hypothetical protein	NA	A0A2P0ZLC3	Lactobacillus_phage	87.8	2.3e-13
WP_058906847.1|1271563_1271989_+	hypothetical protein	NA	K4I239	Lactobacillus_phage	95.7	4.2e-75
WP_058906848.1|1271991_1272372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058906849.1|1272368_1272815_+	hypothetical protein	NA	A0A2P0ZLB8	Lactobacillus_phage	39.4	9.7e-22
WP_080396932.1|1272929_1273097_+	hypothetical protein	NA	E9LUP4	Lactobacillus_phage	76.6	4.1e-10
WP_058906850.1|1273223_1273685_+	transcriptional regulator	NA	D6PSV8	Lactobacillus_phage	56.3	9.0e-39
WP_119724041.1|1273907_1274075_+	BC1881 family protein	NA	NA	NA	NA	NA
WP_058906851.1|1274071_1274281_-	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_013355741.1|1274571_1275348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013355740.1|1275475_1275682_+	hypothetical protein	NA	E9LUP6	Lactobacillus_phage	56.5	7.6e-06
WP_013355739.1|1275915_1276443_+|terminase	terminase small subunit	terminase	O03926	Lactobacillus_phage	75.7	4.5e-58
WP_033098955.1|1276432_1277671_+|terminase	PBSX family phage terminase large subunit	terminase	M1PG09	Streptococcus_phage	61.3	1.9e-139
WP_013355738.1|1277682_1279191_+|portal	phage portal protein	portal	V5US18	Oenococcus_phage	52.0	1.8e-136
WP_024971552.1|1279120_1279417_+|protease	ribosomal-processing cysteine protease Prp	protease	D2J003	Enterococcus_phage	40.2	1.1e-10
WP_013355736.1|1279563_1281249_+|capsid	minor capsid protein	capsid	V5US81	Oenococcus_phage	58.0	6.5e-119
WP_003642815.1|1281223_1281502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013355734.1|1281553_1281760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013355733.1|1281932_1282610_+	DUF4355 domain-containing protein	NA	Q6SE80	Lactobacillus_prophage	32.1	6.0e-15
WP_013355732.1|1282624_1282972_+	hypothetical protein	NA	V5UTH9	Oenococcus_phage	63.8	4.4e-30
WP_003642819.1|1282991_1284014_+|capsid	major capsid protein	capsid	V5US24	Oenococcus_phage	62.5	3.7e-117
WP_003642820.1|1284026_1284203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013355731.1|1284214_1284547_+|head,tail	phage head-tail connector protein	head,tail	V9QJ97	Oenococcus_phage	45.3	1.8e-12
WP_003642822.1|1284546_1284894_+	hypothetical protein	NA	V5US85	Oenococcus_phage	62.3	3.2e-36
WP_013355730.1|1284895_1285447_+	HK97 gp10 family phage protein	NA	V5URV0	Oenococcus_phage	62.3	2.0e-64
WP_013355729.1|1285446_1285812_+	hypothetical protein	NA	V5UQS4	Oenococcus_phage	53.4	3.0e-29
WP_099447638.1|1285913_1286297_+|tail	phage tail protein	tail	V5USQ9	Oenococcus_phage	58.4	1.8e-37
WP_003642826.1|1286396_1286795_+	hypothetical protein	NA	V9QJA0	Oenococcus_phage	74.8	3.0e-46
WP_031275283.1|1286902_1287166_+	hypothetical protein	NA	V9QKH3	Oenococcus_phage	65.4	2.3e-23
WP_057138638.1|1287181_1293013_+	hypothetical protein	NA	V5URV5	Oenococcus_phage	40.9	6.6e-227
WP_058906852.1|1293026_1293389_+	hypothetical protein	NA	V5UQS8	Oenococcus_phage	70.3	3.3e-44
WP_058906853.1|1293403_1298674_+	hypothetical protein	NA	Q6SE68	Lactobacillus_prophage	59.4	3.7e-144
WP_003642831.1|1298680_1299130_+	DUF1617 family protein	NA	A0A2P0ZLE0	Lactobacillus_phage	40.5	6.1e-24
WP_003642832.1|1299132_1299567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013355723.1|1299745_1300861_+	LysM peptidoglycan-binding domain-containing protein	NA	O03950	Lactobacillus_phage	64.2	1.7e-46
WP_016511341.1|1300861_1301158_+	hypothetical protein	NA	A0A1I9KK55	Lactobacillus_phage	77.6	4.4e-39
WP_058906854.1|1301144_1301528_+|holin	holin	holin	A0A2H4PBB2	Lactobacillus_phage	85.4	2.9e-14
WP_003644667.1|1302623_1303475_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_003641420.1|1303697_1304090_+	YxeA family protein	NA	NA	NA	NA	NA
WP_003644665.1|1304313_1306044_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.6	2.6e-46
>prophage 4
NZ_CP012122	Lactiplantibacillus plantarum strain LZ95 chromosome, complete genome	3261418	2136041	2148819	3261418		Lactobacillus_phage(70.0%)	11	NA	NA
WP_013355474.1|2136041_2136986_-	glycosyltransferase family 2 protein	NA	V5USA4	Oenococcus_phage	45.5	2.0e-72
WP_013355473.1|2137010_2137676_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_021356352.1|2138385_2139078_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.6	5.3e-35
WP_022638019.1|2139070_2140438_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	31.0	3.4e-25
WP_013355470.1|2140828_2141269_+	nucleoside 2-deoxyribosyltransferase	NA	A0A2P0ZL88	Lactobacillus_phage	97.9	1.2e-75
WP_013355469.1|2141339_2141900_-	hypothetical protein	NA	A0A2P0ZL75	Lactobacillus_phage	98.4	6.5e-100
WP_022638021.1|2141987_2144426_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	99.6	0.0e+00
WP_003643097.1|2144428_2145043_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	100.0	6.3e-112
WP_003643099.1|2145385_2146333_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	100.0	2.7e-178
WP_013355468.1|2146518_2147490_+	peptidase S41	NA	A0A2P0ZL68	Lactobacillus_phage	98.5	3.5e-181
WP_013355467.1|2147580_2148819_-	hypothetical protein	NA	A0A2P0ZL72	Lactobacillus_phage	98.7	2.4e-219
>prophage 5
NZ_CP012122	Lactiplantibacillus plantarum strain LZ95 chromosome, complete genome	3261418	2825741	2834365	3261418		Streptococcus_phage(66.67%)	11	NA	NA
WP_013355240.1|2825741_2826737_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.5	2.0e-51
WP_003640969.1|2826875_2827661_-	acyl-ACP thioesterase	NA	NA	NA	NA	NA
WP_013355239.1|2827664_2828561_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	55.7	4.4e-82
WP_003640967.1|2828659_2829007_-	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	33.3	2.4e-12
WP_058906925.1|2829031_2830051_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	33.5	2.1e-32
WP_003640965.1|2830067_2830397_-	cyclic-di-AMP receptor	NA	NA	NA	NA	NA
WP_011101140.1|2830393_2831059_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	52.7	1.4e-53
WP_003640957.1|2831456_2831708_-	YaaL family protein	NA	NA	NA	NA	NA
WP_003637790.1|2831722_2832322_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_003640956.1|2832337_2832646_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_013355236.1|2832667_2834365_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	37.0	3.0e-55
>prophage 1
NZ_CP012123	Lactiplantibacillus plantarum strain LZ95 plasmid LZ95p1, complete sequence	48556	16675	24379	48556	transposase	Enterococcus_phage(28.57%)	7	NA	NA
WP_112260613.1|16675_17451_-|transposase	IS5-like element ISLpl3 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	53.2	2.1e-27
WP_013356283.1|17558_18461_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	40.3	6.3e-52
WP_046783566.1|18547_19180_-	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	33.2	3.6e-14
WP_112260612.1|19293_20106_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	29.5	6.3e-11
WP_046811155.1|20233_21184_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	54.3	1.2e-98
WP_010623241.1|21198_22125_-	ribonucleotide-diphosphate reductase subunit beta	NA	A0A2H4P8A9	Corynebacterium_phage	32.1	5.9e-37
WP_029508458.1|22231_24379_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	60.3	9.4e-256
