The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013733	Campylobacter coli strain OR12, complete genome	2033903	641129	651294	2033903		uncultured_virus(14.29%)	11	NA	NA
WP_058914605.1|641129_643484_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	29.4	1.4e-74
WP_002777240.1|643480_643681_+	cbb3-type cytochrome oxidase assembly protein CcoS	NA	NA	NA	NA	NA
WP_002777238.1|643710_644010_-	cytochrome c	NA	NA	NA	NA	NA
WP_002790119.1|644128_644650_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_002796064.1|644646_645600_+	ADP-glyceromanno-heptose 6-epimerase	NA	A0A2K9L4U8	Tupanvirus	31.0	2.0e-24
WP_058914606.1|645592_646978_+	bifunctional heptose 7-phosphate kinase/heptose 1-phosphate adenyltransferase	NA	A0A0K0KVL9	Prochlorococcus_phage	45.4	2.5e-23
WP_002794353.1|646974_647535_+	phosphoheptose isomerase	NA	A0A067XQR2	Caulobacter_phage	36.7	5.3e-17
WP_002794354.1|647510_648476_-	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_002799677.1|648534_649371_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	37.6	5.5e-10
WP_002782985.1|649380_650259_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	62.8	4.9e-102
WP_002794358.1|650262_651294_+	dTDP-glucose 4,6-dehydratase	NA	H9NC62	Sphingomonas_phage	45.5	1.1e-73
>prophage 2
NZ_CP013733	Campylobacter coli strain OR12, complete genome	2033903	1751477	1774623	2033903	integrase,bacteriocin,tail,protease	Campylobacter_phage(30.0%)	33	1755484:1755500	1768692:1768708
WP_002778039.1|1751477_1752701_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	53.8	4.0e-118
WP_002778038.1|1752693_1753485_-	acyl-[acyl-carrier-protein]--UDP-N- acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_002782472.1|1753495_1753936_-	3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ	NA	NA	NA	NA	NA
WP_002778036.1|1754050_1755142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002778035.1|1755141_1755600_-	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
1755484:1755500	attL	AGGATAAAAATATAAAA	NA	NA	NA	NA
WP_002778034.1|1755596_1755803_-	tautomerase	NA	NA	NA	NA	NA
WP_002782466.1|1756129_1757044_+	branched-chain-amino-acid transaminase	NA	NA	NA	NA	NA
WP_002778030.1|1757059_1758142_+	membrane protein	NA	NA	NA	NA	NA
WP_002782463.1|1758152_1758683_+	DUF2393 domain-containing protein	NA	NA	NA	NA	NA
WP_002778025.1|1758682_1759192_+	DUF2393 domain-containing protein	NA	NA	NA	NA	NA
WP_058914722.1|1759304_1761422_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	78.2	6.7e-12
WP_002793925.1|1761620_1762298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002793922.1|1762299_1762923_-	hypothetical protein	NA	A5X9F5	Aeromonas_virus	33.1	4.7e-06
WP_002793921.1|1763065_1763266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058914723.1|1763262_1765338_+|integrase	integrase	integrase	A0A0M4U788	Ralstonia_phage	24.7	8.6e-12
WP_058914724.1|1765408_1766332_+|bacteriocin	bacteriocin	bacteriocin	A0A0N7ACA6	Bacillus_phage	26.5	7.4e-16
WP_002795448.1|1766334_1766526_+	DNA-directed RNA polymerase sigma-70 factor	NA	NA	NA	NA	NA
WP_002824157.1|1766522_1766708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002791419.1|1766764_1767106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002806832.1|1767212_1767698_+	host-nuclease inhibitor protein Gam	NA	A0A2H4JE65	uncultured_Caudovirales_phage	36.4	2.9e-19
WP_002791416.1|1767694_1767874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002791414.1|1767937_1768210_+	hypothetical protein	NA	A0A1D8EXF2	Campylobacter_phage	45.2	3.6e-11
WP_002834952.1|1768206_1768602_+	hypothetical protein	NA	X2KXC8	Campylobacter_phage	86.7	3.4e-34
WP_002804623.1|1768606_1769149_+	SAM-dependent DNA methyltransferase	NA	A0A1B0XVK2	Campylobacter_phage	79.1	9.8e-77
1768692:1768708	attR	AGGATAAAAATATAAAA	NA	NA	NA	NA
WP_002843357.1|1769173_1769560_+	hypothetical protein	NA	D5GVQ0	Campylobacter_virus	55.7	6.0e-36
WP_002791411.1|1769669_1770632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002784531.1|1770628_1770898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052783591.1|1770897_1771590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052774912.1|1771586_1772036_+	DUF1018 domain-containing protein	NA	NA	NA	NA	NA
WP_002791403.1|1772812_1773097_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_002793902.1|1773093_1774071_-|tail	tail protein	tail	NA	NA	NA	NA
WP_002793900.1|1774064_1774256_-|tail	tail protein	tail	NA	NA	NA	NA
WP_002793898.1|1774248_1774623_-|tail	tail protein	tail	NA	NA	NA	NA
>prophage 3
NZ_CP013733	Campylobacter coli strain OR12, complete genome	2033903	1780085	1800044	2033903	capsid,tail,plate	Campylobacter_phage(75.0%)	29	NA	NA
WP_002794190.1|1780085_1781063_-|capsid	minor capsid protein E	capsid	R9TRN2	Rhizobium_phage	23.7	3.9e-07
WP_002791394.1|1781065_1781593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002827123.1|1781595_1782411_-	hypothetical protein	NA	A0A2H4JAW3	uncultured_Caudovirales_phage	48.4	2.9e-24
WP_002784501.1|1782412_1782847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002827121.1|1782994_1783384_+	hypothetical protein	NA	A0A2I7R2R3	Vibrio_phage	43.3	6.5e-22
WP_002827119.1|1783394_1783736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002841920.1|1783732_1783981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002784492.1|1784092_1784407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002827116.1|1784406_1785039_+|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_002784486.1|1785047_1785239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002789997.1|1785235_1785526_+|plate	baseplate assembly protein	plate	Q75QM0	Wolbachia_phage	48.7	7.7e-12
WP_002827114.1|1785522_1786689_+|plate	baseplate assembly protein	plate	A0A1B2LRR9	Wolbachia_phage	50.0	4.5e-10
WP_002827112.1|1786685_1787306_+|tail	phage tail protein I	tail	A7YGG0	Campylobacter_phage	94.0	2.2e-56
WP_058914725.1|1787305_1788340_+|tail	phage tail protein	tail	A7YGA7	Campylobacter_phage	88.8	2.6e-78
WP_002784668.1|1788349_1788985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002784666.1|1788984_1790742_+	radical SAM protein	NA	NA	NA	NA	NA
WP_002789987.1|1790734_1791121_+	DUF1353 domain-containing protein	NA	A7YGM3	Campylobacter_phage	88.4	9.2e-61
WP_002794203.1|1791117_1792131_+	hypothetical protein	NA	A7YGY4	Campylobacter_phage	95.8	1.2e-184
WP_002794204.1|1792141_1793335_+|tail	phage tail sheath family protein	tail	A7YGY2	Campylobacter_phage	98.7	1.4e-200
WP_002794205.1|1793358_1793868_+|tail	tail protein	tail	A7YGZ4	Campylobacter_phage	99.4	5.6e-90
WP_002791367.1|1793971_1794211_+|tail	phage tail assembly protein	tail	A7YG75	Campylobacter_phage	89.9	1.5e-08
WP_002791365.1|1794322_1794628_-	hypothetical protein	NA	A7YG88	Campylobacter_phage	90.1	1.9e-32
WP_002791362.1|1794669_1797003_+|tail	phage tail tape measure protein	tail	A7YGE8	Campylobacter_phage	89.8	0.0e+00
WP_002791360.1|1797006_1797495_+	virion morphogenesis protein	NA	A7YGZ0	Campylobacter_phage	90.7	8.6e-80
WP_002794206.1|1797599_1798415_+	DNA adenine methylase	NA	A7YGG5	Campylobacter_phage	94.5	2.2e-144
WP_002784651.1|1798442_1798730_-	hypothetical protein	NA	A7YGG4	Campylobacter_phage	97.9	1.6e-46
WP_002784648.1|1798809_1799004_-	hypothetical protein	NA	A7YG72	Campylobacter_phage	96.9	1.1e-27
WP_002784647.1|1799013_1799334_-	hypothetical protein	NA	A7YG71	Campylobacter_phage	97.2	1.6e-50
WP_002784646.1|1799414_1800044_-	peptidase	NA	A7YG70	Campylobacter_phage	98.2	4.8e-59
>prophage 4
NZ_CP013733	Campylobacter coli strain OR12, complete genome	2033903	1830070	1919982	2033903	tRNA,bacteriocin,tail,protease,integrase,capsid,plate	Campylobacter_phage(48.72%)	99	1913626:1913646	1923645:1923665
WP_002777939.1|1830070_1831879_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	36.7	1.3e-112
WP_002781863.1|1832010_1832814_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_002790232.1|1837423_1842676_-	alpha-2-macroglobulin	NA	NA	NA	NA	NA
WP_002777931.1|1842859_1843213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002787562.1|1843315_1844464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002781850.1|1844463_1845645_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	33.2	7.0e-51
WP_002785406.1|1845714_1846443_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_002777919.1|1846444_1847782_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.4	2.5e-57
WP_002790228.1|1847785_1848433_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002777913.1|1848929_1849502_+	cytochrome c	NA	NA	NA	NA	NA
WP_002777910.1|1852198_1852546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002791262.1|1854233_1856015_+	PhoX family phosphatase	NA	NA	NA	NA	NA
WP_058914727.1|1856139_1857078_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	42.2	5.5e-59
WP_002778629.1|1857213_1857528_-	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	48.9	1.5e-21
WP_002778626.1|1857582_1857921_-	YraN family protein	NA	NA	NA	NA	NA
WP_002778624.1|1857920_1859171_-	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_002778622.1|1859172_1860378_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_002778620.1|1860390_1861197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058914728.1|1861190_1862138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002778617.1|1862130_1862814_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_002778615.1|1862826_1863651_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	39.0	1.3e-35
WP_002778612.1|1863653_1863854_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_002781505.1|1863932_1864586_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_002778609.1|1864586_1864994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002778601.1|1864994_1865417_-	cytochrome CBB3	NA	NA	NA	NA	NA
WP_002778599.1|1865416_1865998_-	6-carboxytetrahydropterin synthase	NA	NA	NA	NA	NA
WP_002781502.1|1865994_1866738_-	7-carboxy-7-deazaguanine synthase QueE	NA	H6SUE5	Campylobacter_virus	34.5	1.2e-32
WP_002778595.1|1866740_1867703_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_002778593.1|1867718_1868237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002778591.1|1868229_1868730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002778589.1|1868720_1869605_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_002781500.1|1869676_1870546_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_002778585.1|1870531_1871095_-	manganese efflux pump	NA	NA	NA	NA	NA
WP_002778581.1|1871502_1871910_+	membrane protein	NA	NA	NA	NA	NA
WP_002778578.1|1872040_1872334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002778576.1|1872439_1873102_+	superoxide dismutase	NA	NA	NA	NA	NA
WP_002778575.1|1873128_1874334_-	saccharopine dehydrogenase	NA	NA	NA	NA	NA
WP_002778573.1|1874369_1875275_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.4	6.4e-20
WP_002790598.1|1875261_1876878_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_002778568.1|1876877_1877882_-	Fe(3+) ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002826909.1|1878248_1879091_+	iron transporter	NA	NA	NA	NA	NA
WP_058914729.1|1879100_1881377_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_002791357.1|1881460_1881694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002784646.1|1881949_1882579_+	peptidase	NA	A7YG70	Campylobacter_phage	98.2	4.8e-59
WP_002784647.1|1882659_1882980_+	hypothetical protein	NA	A7YG71	Campylobacter_phage	97.2	1.6e-50
WP_002784648.1|1882989_1883184_+	hypothetical protein	NA	A7YG72	Campylobacter_phage	96.9	1.1e-27
WP_002784651.1|1883263_1883551_+	hypothetical protein	NA	A7YGG4	Campylobacter_phage	97.9	1.6e-46
WP_002794206.1|1883578_1884394_-	DNA adenine methylase	NA	A7YGG5	Campylobacter_phage	94.5	2.2e-144
WP_002791360.1|1884498_1884987_-	virion morphogenesis protein	NA	A7YGZ0	Campylobacter_phage	90.7	8.6e-80
WP_002791362.1|1884990_1887324_-|tail	phage tail tape measure protein	tail	A7YGE8	Campylobacter_phage	89.8	0.0e+00
WP_002791365.1|1887365_1887671_+	hypothetical protein	NA	A7YG88	Campylobacter_phage	90.1	1.9e-32
WP_002791367.1|1887782_1888022_-|tail	phage tail assembly protein	tail	A7YG75	Campylobacter_phage	89.9	1.5e-08
WP_002794205.1|1888125_1888635_-|tail	tail protein	tail	A7YGZ4	Campylobacter_phage	99.4	5.6e-90
WP_002794204.1|1888658_1889852_-|tail	phage tail sheath family protein	tail	A7YGY2	Campylobacter_phage	98.7	1.4e-200
WP_002794203.1|1889862_1890876_-	hypothetical protein	NA	A7YGY4	Campylobacter_phage	95.8	1.2e-184
WP_002789987.1|1890872_1891259_-	DUF1353 domain-containing protein	NA	A7YGM3	Campylobacter_phage	88.4	9.2e-61
WP_002784666.1|1891251_1893009_-	radical SAM protein	NA	NA	NA	NA	NA
WP_002784668.1|1893008_1893644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058914725.1|1893653_1894688_-|tail	phage tail protein	tail	A7YGA7	Campylobacter_phage	88.8	2.6e-78
WP_002827112.1|1894687_1895308_-|tail	phage tail protein I	tail	A7YGG0	Campylobacter_phage	94.0	2.2e-56
WP_002827114.1|1895304_1896471_-|plate	baseplate assembly protein	plate	A0A1B2LRR9	Wolbachia_phage	50.0	4.5e-10
WP_002789997.1|1896467_1896758_-|plate	baseplate assembly protein	plate	Q75QM0	Wolbachia_phage	48.7	7.7e-12
WP_002784486.1|1896754_1896946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002827116.1|1896954_1897587_-|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_002784492.1|1897586_1897901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002841920.1|1898012_1898261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002827119.1|1898257_1898599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002827121.1|1898609_1898999_-	hypothetical protein	NA	A0A2I7R2R3	Vibrio_phage	43.3	6.5e-22
WP_002784501.1|1899146_1899581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002827123.1|1899582_1900398_+	hypothetical protein	NA	A0A2H4JAW3	uncultured_Caudovirales_phage	48.4	2.9e-24
WP_002791394.1|1900400_1900928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002794190.1|1900930_1901908_+|capsid	minor capsid protein E	capsid	R9TRN2	Rhizobium_phage	23.7	3.9e-07
WP_002784509.1|1902023_1902482_+	DUF1320 domain-containing protein	NA	NA	NA	NA	NA
WP_002784511.1|1902474_1902957_+	DUF1804 domain-containing protein	NA	NA	NA	NA	NA
WP_002794188.1|1902956_1904627_+	hypothetical protein	NA	H1ZZE1	Pseudomonas_virus	41.2	1.1e-91
WP_002827126.1|1904636_1906007_+	DUF935 domain-containing protein	NA	A0A2H4JHL1	uncultured_Caudovirales_phage	26.3	1.0e-16
WP_002793896.1|1906009_1907245_+	hypothetical protein	NA	A0A0M4UTA3	Ralstonia_phage	33.0	1.4e-25
WP_002793898.1|1907370_1907745_+|tail	tail protein	tail	NA	NA	NA	NA
WP_002793900.1|1907737_1907929_+|tail	tail protein	tail	NA	NA	NA	NA
WP_002793902.1|1907922_1908900_+|tail	tail protein	tail	NA	NA	NA	NA
WP_002791403.1|1908896_1909181_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_052774912.1|1909957_1910407_-	DUF1018 domain-containing protein	NA	NA	NA	NA	NA
WP_052783591.1|1910403_1911096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002784531.1|1911095_1911365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002791411.1|1911361_1912324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002843357.1|1912433_1912820_-	hypothetical protein	NA	D5GVQ0	Campylobacter_virus	55.7	6.0e-36
WP_002804623.1|1912844_1913387_-	SAM-dependent DNA methyltransferase	NA	A0A1B0XVK2	Campylobacter_phage	79.1	9.8e-77
WP_002834952.1|1913391_1913787_-	hypothetical protein	NA	X2KXC8	Campylobacter_phage	86.7	3.4e-34
1913626:1913646	attL	AAGTCCTGTAAAAAGCTCTAT	NA	NA	NA	NA
WP_002791414.1|1913783_1914056_-	hypothetical protein	NA	A0A1D8EXF2	Campylobacter_phage	45.2	3.6e-11
WP_002793910.1|1914119_1914299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002793911.1|1914295_1914781_-	host-nuclease inhibitor protein Gam	NA	A0A2H4JE65	uncultured_Caudovirales_phage	34.4	5.4e-18
WP_002793912.1|1914781_1914979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002793915.1|1914975_1915314_-	DUF4406 domain-containing protein	NA	NA	NA	NA	NA
WP_002784541.1|1915515_1915701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052774911.1|1915697_1915889_-	RNA polymerase subunit sigma-70	NA	NA	NA	NA	NA
WP_058914724.1|1915891_1916815_-|bacteriocin	bacteriocin	bacteriocin	A0A0N7ACA6	Bacillus_phage	26.5	7.4e-16
WP_058914730.1|1916885_1918961_-|integrase	integrase	integrase	A0A0M4U788	Ralstonia_phage	24.7	8.6e-12
WP_002793921.1|1918957_1919158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002804144.1|1919307_1919982_+	signal peptidase	NA	X2KRC9	Campylobacter_phage	32.1	9.8e-26
1923645:1923665	attR	ATAGAGCTTTTTACAGGACTT	NA	NA	NA	NA
