The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013722	Listeria monocytogenes strain Lm 3163 chromosome, complete genome	2927751	205290	266479	2927751	tRNA,protease	Streptococcus_phage(16.67%)	59	NA	NA
WP_010989734.1|205290_206997_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003723454.1|207036_208299_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_010989733.1|208312_209455_-	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_003732813.1|209469_210258_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_003732812.1|210271_211030_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	42.1	4.4e-22
WP_003723450.1|211259_211817_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_003723449.1|211816_212545_-	UMP kinase	NA	NA	NA	NA	NA
WP_003723448.1|212837_213212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989732.1|213189_214395_+	helicase SNF2	NA	L0P6E9	Lactobacillus_phage	47.1	4.9e-92
WP_003723446.1|214384_215689_+	DUF3440 domain-containing protein	NA	A0A220GKF8	Streptococcus_phage	52.1	9.5e-134
WP_003723445.1|215698_216205_+	ParB-like nuclease domain-containing protein	NA	A0A220GKT8	Streptococcus_phage	66.7	4.0e-56
WP_003723444.1|216226_216958_+	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	59.1	1.2e-80
WP_003723443.1|216976_217819_+	DUF2785 domain-containing protein	NA	NA	NA	NA	NA
WP_003723442.1|217869_218109_-	YneF family protein	NA	NA	NA	NA	NA
WP_031645059.1|218329_220324_-	transketolase	NA	NA	NA	NA	NA
WP_003723440.1|220470_220698_-	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_003723439.1|220789_221119_-	cell division suppressor protein YneA	NA	NA	NA	NA	NA
WP_003723438.1|221276_221891_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	62.1	9.3e-15
WP_003723437.1|221921_222443_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012951579.1|222486_223782_-	arsenic transporter	NA	A0A2H4PQU3	Staphylococcus_phage	61.9	2.8e-146
WP_003723435.1|223925_225260_-	type I glutamate--ammonia ligase	NA	A0A1V0SJ53	Klosneuvirus	26.4	2.0e-06
WP_003719570.1|225330_225699_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010989728.1|225902_227129_-	methionine gamma-lyase family protein	NA	NA	NA	NA	NA
WP_077441550.1|227121_228345_-	GTPase HflX	NA	NA	NA	NA	NA
WP_003719566.1|228455_228689_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_012951578.1|228811_229729_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_003723738.1|229854_231531_-	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_058876222.1|231763_232462_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	33.0	3.4e-13
WP_012951576.1|232674_234543_+	acetyltransferase	NA	B5WZU0	Pseudomonas_phage	31.9	6.5e-43
WP_058876223.1|234576_236373_-	class 1 internalin InlK	NA	NA	NA	NA	NA
WP_058876224.1|236704_238438_-	LapB repeat-containing protein	NA	NA	NA	NA	NA
WP_009913867.1|238764_239232_-	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_058876225.1|239314_241774_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	31.6	3.6e-102
WP_003723731.1|241770_243738_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	42.5	6.7e-123
WP_003732802.1|243918_244326_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_003724132.1|244483_245080_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_009932949.1|245121_245994_-	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_003724130.1|245996_246308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012951573.1|246330_246750_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_003726695.1|246852_247632_-	GTP-sensing pleiotropic transcriptional regulator CodY	NA	NA	NA	NA	NA
WP_010989722.1|247652_249062_-|protease	ATP-dependent protease ATPase subunit HslU	protease	W6AS21	Erwinia_phage	27.7	4.9e-43
WP_003724001.1|249075_249615_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_009911635.1|249635_250538_-	tyrosine recombinase XerC	NA	A0A097EYL9	Mycobacterium_phage	28.6	1.2e-13
WP_009924616.1|250820_252125_-|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
WP_009924617.1|252187_254266_-	type I DNA topoisomerase	NA	A0A1V0SB35	Catovirus	37.7	1.4e-107
WP_003723892.1|254537_255398_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_003723891.1|255531_256317_-	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	39.2	3.0e-26
WP_003723890.1|256313_257177_-	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_003723889.1|257186_257729_-	type I signal peptidase SipZ	NA	NA	NA	NA	NA
WP_009924619.1|257830_258400_-	type I signal peptidase SipY	NA	NA	NA	NA	NA
WP_003723887.1|258434_259001_-	type I signal peptidase SipX	NA	NA	NA	NA	NA
WP_003723886.1|259119_260379_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	63.2	1.4e-145
WP_003723884.1|260564_261848_-	trigger factor	NA	NA	NA	NA	NA
WP_003732796.1|261962_262901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058876226.1|263162_263828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989719.1|263845_264379_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_003727524.1|264497_264713_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003723563.1|264863_265259_+	helix-turn-helix transcriptional regulator	NA	A9D9J6	Lactobacillus_prophage	57.4	1.3e-14
WP_058876227.1|265339_266479_+|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 2
NZ_CP013722	Listeria monocytogenes strain Lm 3163 chromosome, complete genome	2927751	398332	405755	2927751		Hokovirus(33.33%)	8	NA	NA
WP_020246560.1|398332_399889_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	28.1	2.3e-17
WP_003732712.1|400017_400422_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_023549061.1|400482_400791_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_003727000.1|400803_401628_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	52.6	9.7e-68
WP_003721509.1|401639_403130_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	49.7	9.5e-114
WP_058876248.1|403338_404352_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	32.0	4.6e-11
WP_014600722.1|404366_405350_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	35.3	3.1e-12
WP_003721506.1|405371_405755_-	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	40.7	1.4e-16
>prophage 3
NZ_CP013722	Listeria monocytogenes strain Lm 3163 chromosome, complete genome	2927751	1396796	1403321	2927751	tail	Streptococcus_pyogenes_phage(33.33%)	10	NA	NA
WP_009911828.1|1396796_1397615_-|tail	phage tail family protein	tail	A0A060AFE1	Staphylococcus_phage	35.0	7.2e-39
WP_058876393.1|1397611_1399480_-	hypothetical protein	NA	A0A097PAU2	Streptococcus_pyogenes_phage	45.8	3.5e-20
WP_077947099.1|1399466_1399871_-	phenylalanine racemase	NA	NA	NA	NA	NA
WP_003721745.1|1399912_1400215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003721744.1|1400262_1400775_-|tail	phage major tail protein, TP901-1 family	tail	A0A097PBF4	Streptococcus_pyogenes_phage	62.7	1.2e-47
WP_003732221.1|1400787_1401177_-	DUF5072 domain-containing protein	NA	NA	NA	NA	NA
WP_058876394.1|1401454_1401871_-	hypothetical protein	NA	A8ASQ1	Listeria_phage	38.6	6.5e-20
WP_003732219.1|1401882_1402311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003721740.1|1402527_1402863_+	helix-turn-helix transcriptional regulator	NA	A0A2H4JAR9	uncultured_Caudovirales_phage	52.5	4.0e-20
WP_003721739.1|1402868_1403321_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A059T7S0	Listeria_phage	47.9	4.0e-31
>prophage 4
NZ_CP013722	Listeria monocytogenes strain Lm 3163 chromosome, complete genome	2927751	1628102	1638134	2927751		Tupanvirus(33.33%)	7	NA	NA
WP_003725314.1|1628102_1629557_-	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	30.3	1.9e-50
WP_003734073.1|1629584_1629935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003722120.1|1630073_1631684_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.5	1.4e-46
WP_003722119.1|1631741_1632272_+	ADP-ribose-binding protein	NA	A0A0K1L687	Scale_drop_disease_virus	49.3	2.6e-29
WP_058876427.1|1632557_1634024_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.0	6.1e-97
WP_003732117.1|1634184_1635957_+	DNA helicase RecQ	NA	A0A2K9L3P7	Tupanvirus	37.1	6.3e-80
WP_003722116.1|1635980_1638134_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	34.1	4.0e-44
>prophage 5
NZ_CP013722	Listeria monocytogenes strain Lm 3163 chromosome, complete genome	2927751	1923697	1931541	2927751		Streptococcus_phage(50.0%)	7	NA	NA
WP_003722610.1|1923697_1924657_+	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	53.7	2.0e-88
WP_012952019.1|1924775_1925759_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	37.2	5.8e-51
WP_026750232.1|1925775_1926837_+	galactose mutarotase	NA	NA	NA	NA	NA
WP_012952017.1|1926878_1928609_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	54.0	3.0e-175
WP_003722606.1|1928716_1929592_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.7	1.9e-08
WP_003722605.1|1929593_1930562_+	YvcK family protein	NA	A1IMD5	Streptococcus_phage	43.3	6.7e-68
WP_003722604.1|1930569_1931541_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	39.4	5.2e-52
>prophage 6
NZ_CP013722	Listeria monocytogenes strain Lm 3163 chromosome, complete genome	2927751	1935459	1977846	2927751	tail,terminase,holin,integrase	Listeria_phage(91.07%)	57	1937900:1937919	1977291:1977310
WP_003722600.1|1935459_1936056_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.4	6.6e-58
WP_058876464.1|1936212_1937649_+	chitin-binding protein	NA	A0A2D1GD28	Mycobacterium_phage	29.1	5.7e-07
1937900:1937919	attL	AAGTTCAAATAAAGTACAAA	NA	NA	NA	NA
WP_003731216.1|1937924_1939055_-|integrase	site-specific integrase	integrase	A8ATX2	Listeria_phage	100.0	9.8e-212
WP_003731217.1|1939118_1939628_-	hypothetical protein	NA	A8ATX3	Listeria_phage	100.0	2.6e-87
WP_003731218.1|1939654_1940146_-	hypothetical protein	NA	A8ATX4	Listeria_phage	100.0	2.6e-92
WP_015987417.1|1940177_1940486_-	helix-turn-helix transcriptional regulator	NA	A8ATX5	Listeria_phage	100.0	9.3e-48
WP_003731220.1|1940634_1940886_+	helix-turn-helix transcriptional regulator	NA	A8ATX6	Listeria_phage	100.0	7.6e-40
WP_015987418.1|1940889_1941126_+	hypothetical protein	NA	A8ATX7	Listeria_phage	100.0	1.1e-37
WP_003731222.1|1941122_1941476_+	hypothetical protein	NA	A8ATX8	Listeria_phage	100.0	9.9e-54
WP_003731223.1|1941453_1941996_-	hypothetical protein	NA	A8ATX9	Listeria_phage	100.0	2.8e-95
WP_015987419.1|1942059_1942833_+	phage repressor protein/antirepressor Ant	NA	A8ATY0	Listeria_phage	100.0	1.1e-140
WP_015987420.1|1942954_1943479_+	hypothetical protein	NA	A8ATY1	Listeria_phage	100.0	6.3e-89
WP_003731810.1|1943485_1943722_+	DUF771 domain-containing protein	NA	A8ATY2	Listeria_phage	100.0	1.9e-40
WP_003722564.1|1943830_1944019_+	hypothetical protein	NA	Q9T175	Listeria_phage	82.3	1.8e-22
WP_003723967.1|1944251_1945763_+	hypothetical protein	NA	A0A2I7SC81	Paenibacillus_phage	36.2	6.1e-76
WP_058876465.1|1945755_1946667_+	recombinase RecT	NA	NA	NA	NA	NA
WP_058876466.1|1946704_1947619_+	DnaD domain-containing protein	NA	A0A0B5D175	Listeria_phage	90.5	8.1e-140
WP_070004445.1|1947615_1948929_+	DNA (cytosine-5-)-methyltransferase	NA	A0A141E1L1	Streptococcus_phage	57.1	1.1e-129
WP_058876467.1|1948925_1949489_+	DUF1642 domain-containing protein	NA	A8ATY9	Listeria_phage	61.9	7.1e-54
WP_014601510.1|1949709_1950111_+	hypothetical protein	NA	A8ATD9	Listeria_phage	100.0	2.6e-74
WP_014601509.1|1950107_1950317_+	hypothetical protein	NA	A8ATE0	Listeria_phage	100.0	1.7e-32
WP_015967170.1|1950313_1950712_+	hypothetical protein	NA	A8ATZ3	Listeria_phage	100.0	4.4e-66
WP_015967173.1|1951155_1951557_+	hypothetical protein	NA	A8ATZ6	Listeria_phage	100.0	1.4e-67
WP_015967174.1|1951553_1952036_+	single-stranded DNA-binding protein	NA	A8ATZ7	Listeria_phage	100.0	1.1e-82
WP_015967175.1|1952067_1952373_+	hypothetical protein	NA	A8ATZ8	Listeria_phage	100.0	1.7e-46
WP_014601286.1|1952369_1952510_+	BH0509 family protein	NA	A8ATZ9	Listeria_phage	100.0	2.6e-18
WP_003769966.1|1952475_1952880_+	endodeoxyribonuclease	NA	A8AU00	Listeria_phage	100.0	5.4e-72
WP_015967177.1|1953008_1953173_+	hypothetical protein	NA	A8AU02	Listeria_phage	100.0	3.9e-21
WP_015967178.1|1953191_1953626_+	hypothetical protein	NA	A8AU03	Listeria_phage	100.0	5.1e-76
WP_015987428.1|1953807_1954440_+	hypothetical protein	NA	A8AU05	Listeria_phage	100.0	1.1e-114
WP_012951944.1|1954520_1954748_+	hypothetical protein	NA	A8AU06	Listeria_phage	100.0	1.5e-34
WP_015987406.1|1954787_1955528_+	hypothetical protein	NA	A8ATU5	Listeria_phage	100.0	3.7e-135
WP_033918288.1|1955520_1956840_+|terminase	PBSX family phage terminase large subunit	terminase	A8ATU6	Listeria_phage	99.8	1.5e-264
WP_015987416.1|1956854_1958411_+	hypothetical protein	NA	A8ATU7	Listeria_phage	100.0	4.8e-302
WP_015987421.1|1958415_1959456_+	hypothetical protein	NA	A8ATU8	Listeria_phage	100.0	1.6e-200
WP_015987425.1|1959551_1960106_+	hypothetical protein	NA	A8ATU9	Listeria_phage	100.0	2.3e-89
WP_015987427.1|1960128_1961001_+	F420-dependent oxidoreductase	NA	A8ATV0	Listeria_phage	100.0	1.2e-161
WP_012951937.1|1961182_1961536_+	hypothetical protein	NA	A8ATV2	Listeria_phage	100.0	7.6e-62
WP_015987430.1|1961535_1961901_+	hypothetical protein	NA	A8ATV3	Listeria_phage	100.0	4.4e-65
WP_015987407.1|1961890_1962208_+	HK97 gp10 family phage protein	NA	A8ATV4	Listeria_phage	100.0	9.9e-53
WP_003725064.1|1962204_1962576_+	hypothetical protein	NA	A8ATV5	Listeria_phage	100.0	8.5e-64
WP_015987408.1|1962580_1963267_+	Ig domain-containing protein	NA	A8ATV6	Listeria_phage	100.0	9.4e-117
WP_015987409.1|1963322_1963754_+	hypothetical protein	NA	A8ATV7	Listeria_phage	100.0	9.6e-75
WP_072225507.1|1963750_1964062_+	hypothetical protein	NA	A8ATV8	Listeria_phage	98.9	1.2e-42
WP_058876468.1|1964066_1968866_+|tail	phage tail tape measure protein	tail	A8ATV9	Listeria_phage	99.9	0.0e+00
WP_015987412.1|1968862_1970431_+	gp16	NA	A8ATW0	Listeria_phage	100.0	7.3e-306
WP_015987413.1|1970443_1972606_+	gp17	NA	A8ATW1	Listeria_phage	100.0	0.0e+00
WP_003733957.1|1972656_1972962_+	hypothetical protein	NA	A0A059T5E6	Listeria_phage	100.0	1.8e-43
WP_003723294.1|1972961_1973243_+|holin	phage holin	holin	A8ATW3	Listeria_phage	100.0	3.0e-45
WP_015987415.1|1973242_1973950_+	M15 family metallopeptidase	NA	A8ATW4	Listeria_phage	100.0	8.2e-132
WP_003722520.1|1973990_1974764_-	DUF3825 domain-containing protein	NA	A8ATW5	Listeria_phage	100.0	9.5e-150
WP_003733661.1|1975038_1975536_-	AP2 domain-containing protein	NA	A8ATW6	Listeria_phage	100.0	3.8e-91
WP_003722518.1|1975560_1976010_-	anti-CRISPR protein AcrIIA1	NA	A8ATW7	Listeria_phage	100.0	2.4e-76
WP_003731276.1|1976010_1976262_-	hypothetical protein	NA	A8ATW8	Listeria_phage	100.0	2.0e-40
WP_003731277.1|1976293_1976527_-	hypothetical protein	NA	A8ATW9	Listeria_phage	100.0	4.3e-13
WP_009924650.1|1976825_1977059_+	hypothetical protein	NA	A8ATX0	Listeria_phage	100.0	3.3e-37
WP_003722598.1|1977510_1977846_-	membrane protein	NA	S5MNN8	Brevibacillus_phage	76.6	6.0e-16
1977291:1977310	attR	AAGTTCAAATAAAGTACAAA	NA	NA	NA	NA
>prophage 7
NZ_CP013722	Listeria monocytogenes strain Lm 3163 chromosome, complete genome	2927751	2635285	2643571	2927751		Synechococcus_phage(33.33%)	8	NA	NA
WP_020246648.1|2635285_2636578_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.0	2.5e-17
WP_014931516.1|2636658_2637372_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3F9V5	Synechococcus_phage	37.8	8.8e-41
WP_015454911.1|2637383_2637629_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_003722247.1|2637632_2638316_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_058876548.1|2638308_2640528_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.2	1.0e-159
WP_003722245.1|2640512_2641940_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.6	1.1e-53
WP_031665593.1|2641958_2643008_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.4	9.2e-63
WP_031665594.1|2643004_2643571_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.9	7.0e-25
