The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013183	Pseudomonas syringae pv. lapsa strain ATCC 10859 chromosome, complete genome	5918899	2357290	2416782	5918899	integrase,portal,protease,capsid,head,terminase,tail,tRNA	Pseudomonas_phage(60.38%)	79	2364693:2364743	2418137:2418187
WP_003315564.1|2357290_2359213_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.5	2.0e-124
WP_002553159.1|2359230_2359764_+	translation initiation factor IF-3	NA	A0A2I7S9Q1	Vibrio_phage	37.3	8.9e-14
WP_002553160.1|2359824_2360019_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_002553161.1|2360048_2360405_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_003367019.1|2360509_2361526_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	39.3	8.4e-29
WP_044311531.1|2361553_2363932_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_002553164.1|2363935_2364238_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	38.9	1.8e-11
WP_003315559.1|2364218_2364575_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
2364693:2364743	attL	AGCATGGGGTGCTAGGGGTCGAGTGTTCGAATCACTCCGTCCCGACCATAT	NA	NA	NA	NA
WP_057407326.1|2364828_2365941_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0U4JIT5	Pseudomonas_phage	31.4	3.1e-32
WP_005753573.1|2365940_2366153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057407328.1|2366190_2366514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024421391.1|2366638_2366851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057407330.1|2366853_2367489_-	hypothetical protein	NA	A0A059VF56	Pseudomonas_phage	63.1	5.2e-69
WP_057407332.1|2367485_2367812_-	hypothetical protein	NA	A0A023NGB2	Nitrincola_phage	43.3	1.6e-21
WP_057407333.1|2368068_2368329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057407335.1|2368468_2369251_-	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	30.6	6.3e-16
WP_057407336.1|2369330_2369519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024692364.1|2369644_2369878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057407339.1|2370128_2370392_+	DUF1652 domain-containing protein	NA	NA	NA	NA	NA
WP_057407342.1|2370958_2371816_-	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2K9VK66	Klebsiella_phage	35.2	1.5e-26
WP_057407343.1|2372093_2373722_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	79.6	1.9e-176
WP_057407344.1|2373915_2374539_-	hypothetical protein	NA	A0A2H4JC30	uncultured_Caudovirales_phage	42.4	4.1e-42
WP_057407346.1|2374594_2375599_-	nucleoid-associated protein YejK	NA	L7TI92	Pseudomonas_virus	65.6	3.1e-124
WP_057407348.1|2375669_2375924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057407350.1|2375920_2376508_-	hypothetical protein	NA	A0A1B0VMB1	Pseudomonas_phage	32.6	1.4e-12
WP_057407352.1|2376507_2376846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057407353.1|2377682_2377889_-	hypothetical protein	NA	A0A0U4IJ22	Pseudomonas_phage	55.9	1.1e-15
WP_057407354.1|2377951_2378353_-	helix-turn-helix transcriptional regulator	NA	A0A1B0YZX7	Pseudomonas_phage	47.7	1.4e-19
WP_057407356.1|2378706_2379015_+	DUF1654 domain-containing protein	NA	A0A2D1GND3	Pseudomonas_phage	56.6	2.2e-25
WP_057407374.1|2379064_2379292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144435847.1|2379383_2379671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080392041.1|2379736_2380591_-	S24 family peptidase	NA	A0A0S2SYF7	Pseudomonas_phage	63.6	1.8e-96
WP_057407375.1|2380678_2380855_+	Cro/Cl family transcriptional regulator	NA	A0A0S2SYB8	Pseudomonas_phage	62.7	3.0e-11
WP_057407360.1|2381336_2381759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057407361.1|2382004_2382802_+	hypothetical protein	NA	A0A2H4J580	uncultured_Caudovirales_phage	52.2	3.0e-66
WP_057407362.1|2382791_2383586_+	ATP-binding protein	NA	A0A2H4J3E5	uncultured_Caudovirales_phage	60.3	9.6e-89
WP_057407363.1|2383587_2383782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057407365.1|2383778_2384075_+	DUF1364 domain-containing protein	NA	A0A2D1GNQ4	Pseudomonas_phage	83.3	3.6e-41
WP_057407367.1|2384071_2384503_+	VRR-NUC domain-containing protein	NA	A0A2D1GNH3	Pseudomonas_phage	74.1	2.1e-53
WP_057407368.1|2384499_2385780_+|integrase	site-specific integrase	integrase	A0A2D1GND4	Pseudomonas_phage	86.2	2.5e-219
WP_033833054.1|2385796_2386012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057407371.1|2386367_2386751_+	antitermination protein Q	NA	A0A1W6JTD2	Pseudomonas_phage	52.4	3.1e-32
WP_057407372.1|2386940_2387495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058877183.1|2387600_2387972_+	hypothetical protein	NA	A0A059VK40	Pseudomonas_phage	87.0	8.9e-45
WP_024650633.1|2387971_2388310_+	hypothetical protein	NA	A0A059VJW1	Pseudomonas_phage	74.1	3.1e-28
WP_057405725.1|2388365_2388596_+	hypothetical protein	NA	A0A2C9CY14	Yersinia_phage	49.3	4.7e-12
WP_154232692.1|2388612_2388753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058877184.1|2388756_2389107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025168050.1|2389157_2389358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057405729.1|2389348_2389744_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	75.2	2.8e-57
WP_053275509.1|2389911_2390397_+|terminase	phage terminase small subunit P27 family	terminase	A0A2D1GNP3	Pseudomonas_phage	88.8	3.9e-77
WP_057405731.1|2390397_2392131_+|terminase	terminase large subunit	terminase	A0A2D1GNU5	Pseudomonas_phage	91.3	0.0e+00
WP_154635501.1|2392139_2392451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080348809.1|2392449_2393595_+|portal	phage portal protein	portal	A0A1V0E8B9	Vibrio_phage	57.5	1.6e-124
WP_057405735.1|2393598_2394462_+|protease	Clp protease ClpP	protease	A0A1V0E8B8	Vibrio_phage	62.1	7.7e-92
WP_057405737.1|2394458_2395652_+|capsid	phage major capsid protein	capsid	H2BDB0	Pseudomonas_virus	67.4	8.9e-139
WP_057405739.1|2395702_2396119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057405740.1|2396122_2396599_+|head,tail	phage gp6-like head-tail connector protein	head,tail	G3ENA1	Psychrobacter_phage	39.0	1.2e-14
WP_024669134.1|2396598_2396937_+|head	phage head closure protein	head	A0A1J0GUY4	Halomonas_phage	59.1	8.1e-29
WP_057405741.1|2396929_2397415_+	HK97 gp10 family phage protein	NA	A0A0U3TGT7	Pseudomonas_phage	67.7	2.3e-56
WP_003407814.1|2397414_2397783_+	DUF3168 domain-containing protein	NA	Q9MCA6	Pseudomonas_phage	65.0	1.9e-39
WP_057405742.1|2397846_2398350_+|tail	phage tail protein	tail	H2BDC0	Pseudomonas_virus	60.2	4.7e-49
WP_057405743.1|2398359_2398797_+|tail	phage tail protein	tail	Q9MCA4	Pseudomonas_phage	65.8	3.6e-37
WP_057405744.1|2399059_2399866_+	hypothetical protein	NA	A0A2H4J8D6	uncultured_Caudovirales_phage	47.8	2.8e-59
WP_057405746.1|2399922_2402493_+|tail	phage tail tape measure protein	tail	A0A2H4PI09	Pseudomonas_phage	49.8	8.3e-182
WP_057405749.1|2402492_2402837_+|tail	phage tail protein	tail	A0A2D1GNJ1	Pseudomonas_phage	53.5	5.2e-31
WP_057405750.1|2402873_2403572_+|tail	phage minor tail protein L	tail	A0A2D1GNF3	Pseudomonas_phage	81.8	7.4e-109
WP_057405751.1|2403574_2404357_+|tail	phage tail protein	tail	A0A2D1GNP8	Pseudomonas_phage	73.8	3.9e-119
WP_057405754.1|2404353_2404941_+|tail	tail assembly protein	tail	A0A2D1GNM2	Pseudomonas_phage	74.1	2.4e-76
WP_057405757.1|2404996_2409697_+	DUF1983 domain-containing protein	NA	A0A2D1GNE3	Pseudomonas_phage	50.0	0.0e+00
WP_057405759.1|2410013_2410700_+	hypothetical protein	NA	A0A2D1GNS6	Pseudomonas_phage	38.6	2.3e-38
WP_005739965.1|2411827_2412142_+	hypothetical protein	NA	A0A059VFX9	Pseudomonas_phage	49.5	1.4e-19
WP_057405761.1|2412155_2412524_+	hypothetical protein	NA	A0A059VFX9	Pseudomonas_phage	76.8	1.5e-39
WP_024684358.1|2412819_2413353_+	glycoside hydrolase family 19 protein	NA	A0A059VA40	Pseudomonas_phage	91.0	1.2e-87
WP_058877185.1|2413349_2413880_+	DUF2514 domain-containing protein	NA	A0A059VF51	Pseudomonas_phage	87.0	1.3e-65
WP_057406121.1|2413936_2414116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057406122.1|2414112_2415357_+	SGNH/GDSL hydrolase family protein	NA	A0A059VA35	Pseudomonas_phage	87.0	8.8e-206
WP_158510301.1|2415861_2416398_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_057406124.1|2416413_2416782_-	helix-turn-helix transcriptional regulator	NA	L7TKV7	Pseudomonas_virus	37.0	8.6e-08
2418137:2418187	attR	AGCATGGGGTGCTAGGGGTCGAGTGTTCGAATCACTCCGTCCCGACCATAT	NA	NA	NA	NA
>prophage 2
NZ_CP013183	Pseudomonas syringae pv. lapsa strain ATCC 10859 chromosome, complete genome	5918899	3232590	3295058	5918899	integrase,head,tail	Pseudomonas_phage(60.38%)	75	3235036:3235092	3292990:3293046
WP_057407220.1|3232590_3233679_+	molybdenum ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.3	9.0e-21
WP_057407221.1|3233768_3234839_+	DNA topoisomerase IB	NA	A0A0G2Y4T8	Acanthamoeba_polyphaga_mimivirus	33.7	7.5e-44
3235036:3235092	attL	GGACTTAAAATCCCTCGTCCTTTGGACGTGCCGGTTCGACCCCGGCTCGGGGCACCA	NA	NA	NA	NA
WP_057407222.1|3235278_3235623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057407223.1|3235637_3236882_-	SGNH/GDSL hydrolase family protein	NA	A0A059VA35	Pseudomonas_phage	86.5	6.8e-206
WP_010439676.1|3236878_3237091_-	hypothetical protein	NA	A0A059VK06	Pseudomonas_phage	51.4	1.5e-09
WP_058877195.1|3237103_3237631_-	DUF2514 domain-containing protein	NA	A0A059VF51	Pseudomonas_phage	82.3	1.3e-65
WP_058877196.1|3237627_3238161_-	glycoside hydrolase family 19 protein	NA	A0A059VA40	Pseudomonas_phage	89.8	3.0e-86
WP_057405761.1|3238455_3238824_-	hypothetical protein	NA	A0A059VFX9	Pseudomonas_phage	76.8	1.5e-39
WP_005739965.1|3238837_3239152_-	hypothetical protein	NA	A0A059VFX9	Pseudomonas_phage	49.5	1.4e-19
WP_057405760.1|3239151_3240255_-	hypothetical protein	NA	A0A059VJZ6	Pseudomonas_phage	74.8	4.5e-153
WP_057405759.1|3240280_3240967_-	hypothetical protein	NA	A0A2D1GNS6	Pseudomonas_phage	38.6	2.3e-38
WP_080399354.1|3241283_3242981_-	DUF1983 domain-containing protein	NA	A0A059VFW9	Pseudomonas_phage	66.2	1.3e-58
WP_057407054.1|3245428_3245827_-	hypothetical protein	NA	A0A059VK01	Pseudomonas_phage	97.0	2.2e-73
WP_057407055.1|3245829_3246432_-	hypothetical protein	NA	A0A059VA31	Pseudomonas_phage	96.5	2.6e-110
WP_057407056.1|3246431_3247016_-	hypothetical protein	NA	A0A059VJR9	Pseudomonas_phage	94.8	1.2e-101
WP_057407057.1|3247033_3250735_-|tail	phage tail tape measure protein	tail	A0A059VJZ1	Pseudomonas_phage	55.6	2.0e-301
WP_057407058.1|3250829_3251078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144435851.1|3251097_3251538_-	hypothetical protein	NA	A0A1B0VMH3	Pseudomonas_phage	31.7	2.2e-10
WP_057407077.1|3251801_3252476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057407060.1|3252564_3252927_-	DUF2513 domain-containing protein	NA	A0A2H4J4K9	uncultured_Caudovirales_phage	28.9	1.8e-05
WP_057407062.1|3253660_3254134_-	hypothetical protein	NA	A0A059VF34	Pseudomonas_phage	94.9	3.9e-77
WP_057407063.1|3255792_3256215_-	hypothetical protein	NA	A0A059VK45	Pseudomonas_phage	82.9	2.9e-60
WP_057407064.1|3256211_3256592_-	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	56.2	3.2e-34
WP_057407065.1|3256591_3256954_-	hypothetical protein	NA	A0A2H4IZB5	uncultured_Caudovirales_phage	46.9	6.9e-26
WP_057407066.1|3256956_3257334_-	hypothetical protein	NA	A0A2H4J0N2	uncultured_Caudovirales_phage	76.8	2.0e-44
WP_161806285.1|3257344_3257500_-	hypothetical protein	NA	A0A2D1GNQ9	Pseudomonas_phage	76.3	3.2e-09
WP_057407068.1|3257774_3258812_-	hypothetical protein	NA	A0A0B4ZZB1	Achromobacter_phage	50.8	1.2e-91
WP_080392015.1|3258818_3259589_-	hypothetical protein	NA	A0A2H4J0I7	uncultured_Caudovirales_phage	65.2	2.9e-74
WP_057407069.1|3259666_3259900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057407070.1|3259929_3260973_-|head	phage head morphogenesis protein	head	A0A0H5BBX3	Pseudomonas_phage	29.0	3.9e-29
WP_057407071.1|3260962_3262342_-	DUF4055 domain-containing protein	NA	A0A2H4J0H4	uncultured_Caudovirales_phage	80.1	1.0e-194
WP_057407072.1|3262341_3263832_-	hypothetical protein	NA	A0A2H4J2I1	uncultured_Caudovirales_phage	85.3	4.8e-259
WP_024683715.1|3263834_3264452_-	hypothetical protein	NA	G8C7P2	Escherichia_phage	47.8	2.7e-38
WP_024683714.1|3264540_3264885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057407073.1|3264900_3265152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024683712.1|3265148_3265340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057407075.1|3265684_3266023_+	YceK/YidQ family lipoprotein	NA	NA	NA	NA	NA
WP_057407076.1|3266184_3266523_-	hypothetical protein	NA	A0A059VJW1	Pseudomonas_phage	71.6	4.4e-27
WP_024660209.1|3266522_3266894_-	hypothetical protein	NA	A0A059VK40	Pseudomonas_phage	75.6	1.3e-43
WP_057406848.1|3266953_3267697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057406849.1|3267814_3268024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057406850.1|3268020_3268602_-	hypothetical protein	NA	A0A059VF83	Pseudomonas_phage	90.2	2.3e-100
WP_057406851.1|3268598_3269219_-	hypothetical protein	NA	A0A059VA66	Pseudomonas_phage	71.5	4.9e-72
WP_057406852.1|3269215_3269686_-	hypothetical protein	NA	A0A2H4J106	uncultured_Caudovirales_phage	61.5	1.2e-51
WP_057406853.1|3269682_3270480_-	hypothetical protein	NA	A0A1B0VMD9	Pseudomonas_phage	67.8	3.0e-90
WP_057406854.1|3270466_3271372_-	helix-turn-helix domain-containing protein	NA	A0A1B0VME0	Pseudomonas_phage	66.9	9.4e-48
WP_080391989.1|3271368_3271956_-	hypothetical protein	NA	A0A1B0VME0	Pseudomonas_phage	66.4	1.4e-39
WP_057406855.1|3271989_3272412_-	Rha family transcriptional regulator	NA	A0A2D1GNM7	Pseudomonas_phage	70.0	9.4e-51
WP_010430462.1|3272494_3272710_-	transcriptional regulator	NA	A0A125RNS7	Pseudomonas_phage	71.8	4.2e-23
WP_057406856.1|3272797_3273460_+	helix-turn-helix domain-containing protein	NA	K7P850	Enterobacteria_phage	46.6	4.6e-44
WP_004417578.1|3273603_3274026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080391990.1|3274223_3274397_-	DUF1652 domain-containing protein	NA	NA	NA	NA	NA
WP_057406857.1|3274545_3274809_-	DUF1652 domain-containing protein	NA	NA	NA	NA	NA
WP_057406858.1|3275374_3276154_+	hypothetical protein	NA	A0A1B0YZY3	Pseudomonas_phage	65.1	1.3e-93
WP_024961042.1|3276701_3276992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057406859.1|3277012_3277420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016567834.1|3277416_3277608_+	hypothetical protein	NA	A0A1B0VMB8	Pseudomonas_phage	60.3	7.8e-13
WP_057406860.1|3277937_3278825_+	recombinase RecT	NA	A0A0F6TJP0	Escherichia_coli_O157_typing_phage	66.4	3.1e-80
WP_057406861.1|3278821_3280495_+	heme peroxidase	NA	A0A2H4J6P1	uncultured_Caudovirales_phage	56.4	5.2e-161
WP_057406862.1|3280596_3281403_-	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_029572837.1|3281575_3281929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057406863.1|3281969_3282782_+	DUF2303 family protein	NA	I3PUY7	Vibrio_phage	38.8	1.4e-42
WP_057406864.1|3282879_3283101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057406865.1|3283207_3283981_+	hypothetical protein	NA	B5WZW7	Pseudomonas_phage	63.6	6.6e-42
WP_057406866.1|3284039_3284936_+	DNA cytosine methyltransferase	NA	W0LM09	Edwardsiella_phage	55.8	4.6e-95
WP_057406867.1|3284944_3286030_-	DUF4935 domain-containing protein	NA	NA	NA	NA	NA
WP_080391991.1|3286503_3287448_+	DNA cytosine methyltransferase	NA	A0A2I7QZY6	Vibrio_phage	60.0	1.3e-55
WP_158510302.1|3287525_3289325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057406871.1|3289535_3290186_+	hypothetical protein	NA	Q5QF30	Pseudomonas_virus	48.9	1.0e-43
WP_057406872.1|3290182_3290740_+	HNH endonuclease	NA	Q94MV4	Myxococcus_phage	58.7	1.8e-33
WP_057406873.1|3290742_3290955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057406874.1|3291079_3291541_+	hypothetical protein	NA	A0A0U4IIZ7	Pseudomonas_phage	71.5	5.1e-58
WP_032657892.1|3291621_3291837_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_057406875.1|3291837_3292872_+|integrase	tyrosine-type recombinase/integrase	integrase	C8CLF4	Xylella_phage	55.5	1.3e-96
WP_057406876.1|3293417_3295058_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.3	2.8e-50
3292990:3293046	attR	GGACTTAAAATCCCTCGTCCTTTGGACGTGCCGGTTCGACCCCGGCTCGGGGCACCA	NA	NA	NA	NA
>prophage 3
NZ_CP013183	Pseudomonas syringae pv. lapsa strain ATCC 10859 chromosome, complete genome	5918899	3613699	3624155	5918899	tRNA	uncultured_Caudovirales_phage(75.0%)	12	NA	NA
WP_057407129.1|3613699_3614371_-	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	92.4	8.7e-107
WP_003343442.1|3614723_3615632_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_057407130.1|3615617_3616397_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004417288.1|3616412_3617714_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.5	8.2e-61
WP_003317940.1|3617948_3618341_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	81.5	1.8e-56
WP_004417284.1|3618342_3618705_+	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	61.7	8.7e-37
WP_003395712.1|3618704_3619004_+	sulfurtransferase complex subunit TusB	NA	A0A2H4JG28	uncultured_Caudovirales_phage	62.6	3.2e-29
WP_003411635.1|3619000_3619336_+	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	79.3	3.0e-44
WP_057407131.1|3619332_3620334_+	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	84.2	3.3e-163
WP_057407132.1|3620430_3621429_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_044313373.1|3621479_3622874_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_003317946.1|3622874_3624155_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.8	4.1e-97
>prophage 4
NZ_CP013183	Pseudomonas syringae pv. lapsa strain ATCC 10859 chromosome, complete genome	5918899	5264239	5298064	5918899	tRNA,plate,bacteriocin,tail	Pseudomonas_phage(60.0%)	42	NA	NA
WP_057407249.1|5264239_5265451_-|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003422785.1|5265652_5267080_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A8ATH6	Listeria_phage	44.7	4.2e-18
WP_003316311.1|5267083_5268178_+	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_002551953.1|5268239_5268590_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.5	7.4e-25
WP_003411695.1|5268903_5269938_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_003316309.1|5270071_5270500_+	protoporphyrinogen oxidase HemJ	NA	NA	NA	NA	NA
WP_024683979.1|5270598_5271513_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_003341077.1|5271569_5272346_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003316306.1|5272449_5272788_+	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_057407247.1|5272909_5273557_+	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_003316303.1|5273626_5274421_-	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_003372688.1|5274663_5275086_-	OsmC family protein	NA	NA	NA	NA	NA
WP_057407245.1|5275288_5275933_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_016569116.1|5275944_5276640_-	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
WP_003316298.1|5276674_5277511_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	56.9	2.3e-69
WP_003316297.1|5277507_5278557_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	58.0	5.3e-111
WP_003341087.1|5278578_5279178_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	64.7	3.0e-74
WP_057407243.1|5279589_5280102_-	lysozyme	NA	B5TK84	Pseudomonas_phage	49.7	9.4e-29
WP_016569118.1|5280098_5280644_-	glycoside hydrolase family 19 protein	NA	A0A2H4JHX4	uncultured_Caudovirales_phage	73.9	5.3e-70
WP_010419610.1|5280697_5280847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057407241.1|5282527_5283127_-	DUF2313 domain-containing protein	NA	B5TK76	Pseudomonas_phage	71.9	4.9e-85
WP_024674763.1|5283114_5284155_-|plate	baseplate J/gp47 family protein	plate	B5TK75	Pseudomonas_phage	70.3	1.9e-132
WP_057407237.1|5284144_5284543_-	hypothetical protein	NA	B5TK74	Pseudomonas_phage	64.4	3.1e-43
WP_057407235.1|5284539_5285052_-|plate	phage baseplate assembly protein	plate	B5TK73	Pseudomonas_phage	74.4	3.7e-65
WP_057407234.1|5285048_5286176_-|plate	baseplate protein	plate	B5TK72	Pseudomonas_phage	58.7	1.2e-111
WP_057407233.1|5286179_5287694_-	hydroxyacid dehydrogenase	NA	B5TK71	Pseudomonas_phage	42.0	2.4e-104
WP_058877214.1|5287690_5290219_-|tail	phage tail tape measure protein	tail	U5P420	Shigella_phage	39.7	1.1e-74
WP_103363454.1|5290218_5290425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003316280.1|5290349_5290646_-|tail	phage tail assembly protein	tail	B5TK69	Pseudomonas_phage	76.0	4.3e-34
WP_003316279.1|5290642_5290990_-|tail	phage tail protein	tail	B5TK68	Pseudomonas_phage	70.4	8.6e-42
WP_057407230.1|5291050_5292547_-|tail	phage tail protein	tail	B5TK67	Pseudomonas_phage	80.1	2.4e-234
WP_002551914.1|5292565_5292754_-	DUF2635 domain-containing protein	NA	B5TK66	Pseudomonas_phage	74.5	1.2e-13
WP_003316276.1|5292750_5293341_-	hypothetical protein	NA	B5TK65	Pseudomonas_phage	52.0	1.1e-52
WP_003394900.1|5293387_5293726_-	hypothetical protein	NA	A0A059VJW1	Pseudomonas_phage	57.9	2.0e-19
WP_003411734.1|5293706_5294096_-	hypothetical protein	NA	A0A059VK40	Pseudomonas_phage	76.4	2.3e-43
WP_134943122.1|5294224_5294632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003316273.1|5294755_5295586_-|bacteriocin	lipid II-degrading bacteriocin	bacteriocin	NA	NA	NA	NA
WP_010438983.1|5295601_5295787_-	Com family DNA-binding transcriptional regulator	NA	B5TK59	Pseudomonas_phage	71.1	5.6e-08
WP_003422750.1|5296053_5296497_-	hypothetical protein	NA	A0A2H4J8A5	uncultured_Caudovirales_phage	45.8	3.5e-24
WP_057407229.1|5296686_5297298_+	helix-turn-helix domain-containing protein	NA	A0A0M4QWY1	Salmonella_phage	49.2	8.8e-50
WP_002551908.1|5297451_5297700_+	DUF1654 domain-containing protein	NA	NA	NA	NA	NA
WP_003316268.1|5297821_5298064_+	transcriptional regulator	NA	A0A2H4J8B4	uncultured_Caudovirales_phage	51.2	1.9e-16
>prophage 5
NZ_CP013183	Pseudomonas syringae pv. lapsa strain ATCC 10859 chromosome, complete genome	5918899	5396469	5426704	5918899	protease,transposase,holin	Bacillus_virus(20.0%)	23	NA	NA
WP_003393604.1|5396469_5396928_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_003402189.1|5397052_5398156_-	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_010407068.1|5398938_5399886_+|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_003316165.1|5399953_5400799_+|holin	choline ABC transporter permease subunit	holin	NA	NA	NA	NA
WP_003316164.1|5400795_5401974_+|holin	choline ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	36.4	2.2e-25
WP_024692062.1|5402234_5403488_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.7	1.6e-101
WP_003316161.1|5403505_5404756_+	sarcosine oxidase subunit beta family protein	NA	NA	NA	NA	NA
WP_003316160.1|5404771_5405068_+	sarcosine oxidase subunit delta	NA	NA	NA	NA	NA
WP_057406991.1|5405064_5408085_+	sarcosine oxidase subunit alpha	NA	NA	NA	NA	NA
WP_057406992.1|5408135_5408768_+	sarcosine oxidase subunit gamma family protein	NA	NA	NA	NA	NA
WP_003319123.1|5408965_5409823_+	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_003316157.1|5409934_5411134_+	formaldehyde dehydrogenase, glutathione-independent	NA	A0A2K9L7I1	Tupanvirus	27.7	2.2e-12
WP_057407085.1|5411189_5412212_-	RHS repeat-associated core domain-containing protein	NA	A0A1W5K0N1	Bacteriophage	42.9	2.1e-27
WP_057407084.1|5412331_5418148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024691901.1|5418328_5418892_+	DUF2780 domain-containing protein	NA	NA	NA	NA	NA
WP_057407083.1|5419296_5420190_-	acyltransferase	NA	NA	NA	NA	NA
WP_003393621.1|5420383_5420887_+|protease	ATP-dependent zinc protease	protease	NA	NA	NA	NA
WP_004415666.1|5421082_5421712_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_003316145.1|5421781_5421964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057407082.1|5421960_5423094_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_024649532.1|5423215_5424199_-	FecR family protein	NA	NA	NA	NA	NA
WP_057407081.1|5424195_5424714_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_046265637.1|5424997_5426704_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	29.0	1.9e-49
