The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013711	Klebsiella pneumoniae strain J1 chromosome, complete genome	5278493	226876	232694	5278493		Enterobacteria_phage(100.0%)	8	NA	NA
WP_058836854.1|226876_227443_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	62.2	8.2e-58
WP_058836855.1|227460_227706_-	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	56.8	2.5e-19
WP_058836856.1|227702_228440_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.7	9.3e-70
WP_004132554.1|228990_229257_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_058836857.1|229253_229805_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	64.8	1.6e-26
WP_004098168.1|229801_230029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058836858.1|230025_230346_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_058836859.1|230360_232694_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	83.0	0.0e+00
>prophage 2
NZ_CP013711	Klebsiella pneumoniae strain J1 chromosome, complete genome	5278493	1459336	1465144	5278493		Enterobacteria_phage(100.0%)	8	NA	NA
WP_049007024.1|1459336_1461670_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	84.3	0.0e+00
WP_049007022.1|1461684_1462005_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_058836911.1|1462001_1462229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058836912.1|1462225_1462777_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	72.2	1.5e-35
WP_003827209.1|1462773_1463040_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.0e-30
WP_049007016.1|1463581_1464319_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	65.3	6.9e-81
WP_023345339.1|1464315_1464561_+	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	76.5	4.8e-31
WP_058836914.1|1464577_1465144_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	61.1	1.4e-54
>prophage 3
NZ_CP013711	Klebsiella pneumoniae strain J1 chromosome, complete genome	5278493	1844562	1851817	5278493	integrase	uncultured_Caudovirales_phage(66.67%)	12	1838668:1838682	1847641:1847655
1838668:1838682	attL	AGGCCAGCAGCGCCA	NA	NA	NA	NA
WP_058836925.1|1844562_1845786_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	72.2	5.1e-182
WP_058836926.1|1845782_1846538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071888062.1|1846615_1846822_+	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	74.6	5.8e-22
WP_058836927.1|1846961_1847774_+	antA/AntB antirepressor family protein	NA	A0A0R6PJV6	Moraxella_phage	54.5	2.1e-22
1847641:1847655	attR	TGGCGCTGCTGGCCT	NA	NA	NA	NA
WP_058836928.1|1848195_1848381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058836929.1|1848576_1848789_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	50.9	9.9e-09
WP_126065409.1|1848781_1848988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058836930.1|1848980_1849181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048294171.1|1849173_1849452_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_058836931.1|1849444_1849642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040968884.1|1849634_1850006_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.3	3.5e-49
WP_058836932.1|1850002_1851817_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	44.3	3.0e-130
>prophage 4
NZ_CP013711	Klebsiella pneumoniae strain J1 chromosome, complete genome	5278493	2563316	2573257	5278493	integrase	Enterobacteria_phage(75.0%)	12	2560750:2560772	2573308:2573330
2560750:2560772	attL	GTGTACCTAAACGTGTACCAATT	NA	NA	NA	NA
WP_058836959.1|2563316_2565659_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	81.3	0.0e+00
WP_014837515.1|2565673_2565994_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_015585919.1|2565990_2566218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071824676.1|2566214_2566763_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	66.7	3.5e-29
WP_015585920.1|2566759_2567026_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	70.5	1.3e-29
WP_015585921.1|2567565_2568303_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	60.1	1.9e-70
WP_015585922.1|2568299_2568545_+	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	58.0	1.4e-19
WP_015585923.1|2568562_2569129_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.2	1.6e-58
WP_071888066.1|2569677_2570217_-	protein kinase	NA	A0A2K9L111	Tupanvirus	28.5	4.5e-13
WP_148677364.1|2570303_2570777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015585925.1|2570792_2572040_-	DUF3644 domain-containing protein	NA	NA	NA	NA	NA
WP_058836960.1|2572036_2573257_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	48.9	1.1e-104
2573308:2573330	attR	GTGTACCTAAACGTGTACCAATT	NA	NA	NA	NA
>prophage 5
NZ_CP013711	Klebsiella pneumoniae strain J1 chromosome, complete genome	5278493	2613316	2704333	5278493	tail,portal,capsid,head,integrase,terminase,tRNA,plate,holin	Salmonella_phage(26.0%)	102	2623128:2623142	2632949:2632963
WP_002914089.1|2613316_2614402_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_002914088.1|2614460_2615150_-	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	53.0	1.3e-57
WP_002914084.1|2615462_2615846_+	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	79.3	4.0e-32
WP_002914082.1|2615891_2617223_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.9	6.2e-48
WP_023286788.1|2617354_2618092_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_004144357.1|2618076_2619696_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_121980491.1|2620024_2620120_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_002914074.1|2620116_2620692_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_002914072.1|2620724_2621375_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_023286787.1|2621374_2622331_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_023286786.1|2622327_2622807_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
2623128:2623142	attL	TACAGTCAACCTAAG	NA	NA	NA	NA
WP_023301229.1|2623238_2624468_+|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	96.3	1.3e-238
WP_058836961.1|2624445_2624721_-	excisionase Xis	NA	H6WRW8	Salmonella_phage	72.7	2.0e-30
WP_176377574.1|2624759_2625020_-	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	71.8	4.6e-24
WP_058836962.1|2625006_2625315_-	hypothetical protein	NA	I6PD68	Cronobacter_phage	56.9	3.2e-24
WP_058836963.1|2625311_2625923_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	77.3	8.3e-40
WP_032755248.1|2625915_2626260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058837156.1|2626294_2627404_-	recombinase RecT	NA	H6WRX0	Salmonella_phage	70.5	2.7e-153
WP_058836964.1|2627416_2630404_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	H6WRX1	Salmonella_phage	60.3	5.3e-289
WP_023282477.1|2630541_2630697_-	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	71.2	2.0e-14
WP_004179600.1|2630705_2630897_-	YebW family protein	NA	NA	NA	NA	NA
WP_058836965.1|2631411_2631591_+	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	75.0	1.6e-15
WP_058837157.1|2631615_2632005_-	hypothetical protein	NA	A0A1V0E5P0	Salmonella_phage	56.0	3.1e-16
WP_148677365.1|2632022_2632490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058836966.1|2632523_2632907_-	helix-turn-helix domain-containing protein	NA	K7PHG0	Enterobacteria_phage	82.7	2.2e-51
WP_023282398.1|2633005_2633224_+	helix-turn-helix domain-containing protein	NA	K7PKS2	Enterobacteria_phage	64.8	8.9e-21
2632949:2632963	attR	CTTAGGTTGACTGTA	NA	NA	NA	NA
WP_058836967.1|2633226_2633763_+	toxin YdaT domain-containing protein	NA	K7PJT7	Enterobacteria_phage	69.3	6.8e-62
WP_071785976.1|2633850_2634039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058836968.1|2634053_2634962_+	hypothetical protein	NA	V5URT9	Shigella_phage	54.1	2.2e-89
WP_058836969.1|2634964_2635714_+	ATP-binding protein	NA	H6WRX8	Salmonella_phage	82.7	6.4e-119
WP_023286280.1|2635721_2636057_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	43.0	5.8e-11
WP_058836970.1|2636049_2636841_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	53.7	1.3e-64
WP_058836971.1|2636833_2637211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032429364.1|2637207_2637387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077264308.1|2637383_2637860_+	DUF551 domain-containing protein	NA	A0A0M4RTV1	Salmonella_phage	56.3	7.7e-17
WP_148677366.1|2638018_2638246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004184503.1|2638621_2638855_+	DinI-like family protein	NA	K7PM44	Enterobacteria_phage	68.8	2.9e-25
WP_071557491.1|2638960_2639209_+	hypothetical protein	NA	K7PHG9	Enterobacteria_phage	67.9	5.0e-28
WP_016946309.1|2639243_2639840_+	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	80.1	1.3e-90
WP_020804598.1|2640048_2640345_+	DUF1364 domain-containing protein	NA	E5AGG0	Erwinia_phage	74.5	1.7e-35
WP_058836972.1|2640341_2640698_+	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	65.0	5.2e-42
WP_023287514.1|2640813_2641635_+	antitermination protein	NA	K7PKS8	Enterobacteria_phage	67.5	1.1e-98
WP_012542609.1|2641888_2642158_+|holin	holin	holin	K7P6H9	Enterobacteria_phage	78.3	2.8e-32
WP_058837158.1|2642135_2642633_+	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	82.4	1.1e-77
WP_058836974.1|2642629_2642980_+	hypothetical protein	NA	H2EQH5	Salmonella_phage	39.8	6.0e-11
WP_058837159.1|2643454_2644093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088717015.1|2644125_2644590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058836975.1|2644947_2645511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058836976.1|2645452_2647576_+|terminase	phage terminase large subunit family protein	terminase	A0A0C5ABH4	Bacteriophage	34.1	2.0e-96
WP_032735077.1|2647584_2647848_+|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
WP_058836977.1|2647847_2649485_+|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	35.6	6.8e-89
WP_058836978.1|2649481_2650351_+	S49 family peptidase	NA	K4I1N3	Providencia_phage	39.0	2.1e-52
WP_058836979.1|2650352_2650937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058836980.1|2650936_2651341_+|head	head decoration protein	head	NA	NA	NA	NA
WP_058836981.1|2651438_2652488_+|capsid	major capsid protein	capsid	V5Q8G6	Xylella_phage	32.9	8.9e-50
WP_058836982.1|2652489_2652870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058836983.1|2652875_2653235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058836984.1|2653231_2653777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058836985.1|2653780_2653963_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_058836986.1|2653959_2655471_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	B5TK67	Pseudomonas_phage	43.8	1.5e-103
WP_058836987.1|2655475_2655847_+|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_058836988.1|2655848_2656127_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_058836989.1|2656268_2658143_+	hypothetical protein	NA	T1SBJ1	Salmonella_phage	41.9	2.1e-17
WP_058836990.1|2658187_2659588_+	DNA circularization protein	NA	NA	NA	NA	NA
WP_058836991.1|2659584_2660664_+|tail	phage tail protein	tail	Q8SBG7	Shigella_phage	30.2	3.1e-37
WP_058836992.1|2660660_2661248_+|plate	phage baseplate assembly protein	plate	A0A077KAY0	Edwardsiella_phage	31.6	1.7e-05
WP_058836993.1|2661240_2661690_+	phage GP46 family protein	NA	A0A0C4UR04	Shigella_phage	42.9	5.9e-19
WP_058836994.1|2661679_2662828_+|plate	baseplate J/gp47 family protein	plate	A0A0A8WEY6	Clostridium_phage	29.9	4.1e-08
WP_058836995.1|2662824_2663508_+	YmfQ family protein	NA	NA	NA	NA	NA
WP_071888070.1|2663523_2664384_+	hypothetical protein	NA	A0A1I9SEW2	Klebsiella_phage	55.7	3.1e-48
WP_077265482.1|2664615_2667465_+	hypothetical protein	NA	A0A1I9SEN3	Klebsiella_phage	89.3	0.0e+00
WP_002914069.1|2667921_2669721_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.4	5.5e-23
WP_002914067.1|2669736_2670711_+	signal peptidase I	NA	NA	NA	NA	NA
WP_002914065.1|2670960_2671641_+	ribonuclease III	NA	A0A0P0YM82	Yellowstone_lake_phycodnavirus	29.7	1.6e-20
WP_002914063.1|2671637_2672543_+	GTPase Era	NA	NA	NA	NA	NA
WP_058836997.1|2672554_2673292_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_004180923.1|2673303_2674035_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_004144351.1|2674034_2674415_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_023286785.1|2674427_2674688_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	2.9e-18
WP_004144349.1|2674744_2675593_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002914050.1|2675806_2676442_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_002914049.1|2676471_2677014_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	33.8	2.6e-05
WP_004144346.1|2677010_2678627_-	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_023286784.1|2678802_2682690_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	58.9	8.5e-130
WP_002914044.1|2683280_2684702_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	25.8	1.1e-13
WP_002914033.1|2684731_2685418_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_004149357.1|2685404_2686742_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	35.0	1.0e-10
WP_002914032.1|2686807_2687146_+	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_004185137.1|2687220_2688411_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_002914027.1|2688736_2689990_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.1	1.9e-99
WP_002914024.1|2690045_2690468_-	DoxX family protein	NA	NA	NA	NA	NA
WP_058836998.1|2690541_2691738_-	ROK family transcriptional regulator	NA	NA	NA	NA	NA
WP_023286783.1|2691850_2695126_+	DUF5107 domain-containing protein	NA	NA	NA	NA	NA
WP_002914018.1|2695195_2696632_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_021463550.1|2696631_2697465_+	aldose 1-epimerase	NA	NA	NA	NA	NA
WP_004149349.1|2697547_2698684_+	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_004149348.1|2698680_2699958_-	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
WP_023286782.1|2700082_2700721_+	DUF1007 family protein	NA	NA	NA	NA	NA
WP_004185122.1|2700711_2701692_+	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_014907114.1|2701791_2702628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002913995.1|2702674_2703478_-	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_002913994.1|2703598_2704333_+|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
>prophage 6
NZ_CP013711	Klebsiella pneumoniae strain J1 chromosome, complete genome	5278493	3068346	3075252	5278493	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_004175147.1|3068346_3069210_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_004180550.1|3069220_3069994_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_004151134.1|3070235_3071132_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004144192.1|3071374_3072736_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004175198.1|3073054_3073777_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_019705218.1|3073773_3075252_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 7
NZ_CP013711	Klebsiella pneumoniae strain J1 chromosome, complete genome	5278493	3853277	3862741	5278493	protease,tRNA	Dickeya_phage(16.67%)	8	NA	NA
WP_002896440.1|3853277_3854393_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_023286192.1|3854389_3856330_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896516.1|3856406_3856628_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_002896520.1|3856953_3857271_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896522.1|3857301_3859581_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_001040187.1|3859701_3859920_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002898014.1|3860273_3860975_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_004224003.1|3861019_3862741_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
>prophage 8
NZ_CP013711	Klebsiella pneumoniae strain J1 chromosome, complete genome	5278493	4144488	4193714	5278493	portal,tail,capsid,transposase,terminase,tRNA	Escherichia_phage(21.05%)	52	NA	NA
WP_004892876.1|4144488_4144989_-|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_014907796.1|4145235_4146372_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_002901096.1|4146542_4146785_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	72.2	4.1e-27
WP_002901192.1|4147055_4147475_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	5.5e-35
WP_004176544.1|4147477_4148743_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	79.1	1.9e-195
WP_004190873.1|4148749_4149655_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009485415.1|4149821_4150571_+	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	29.1	9.6e-14
WP_023284999.1|4150567_4151785_-	MFS transporter	NA	NA	NA	NA	NA
WP_004176540.1|4151960_4152842_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004179388.1|4153099_4153411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002901230.1|4153532_4154015_-	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	39.1	1.6e-17
WP_002901231.1|4154173_4154737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152363.1|4154782_4156066_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	1.7e-10
WP_002901234.1|4156151_4158086_-	protein kinase YeaG	NA	NA	NA	NA	NA
WP_023328051.1|4158164_4160099_+	recombinase family protein	NA	NA	NA	NA	NA
WP_023328050.1|4160623_4161001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023328049.1|4161352_4161505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023328048.1|4161578_4162079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023328047.1|4162144_4162606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023328046.1|4163226_4163940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071836349.1|4164151_4164598_+	hypothetical protein	NA	A0A218M4J4	Erwinia_phage	39.2	1.4e-15
WP_032435857.1|4164605_4164962_+	DUF1493 family protein	NA	A0A218M4K1	Erwinia_phage	45.3	3.5e-14
WP_023328045.1|4164974_4165460_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_023328044.1|4165490_4166174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023328042.1|4166291_4166600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023328041.1|4166761_4167292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023328040.1|4167302_4167593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023328039.1|4167689_4168811_-	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_023328038.1|4169054_4169636_+|terminase	terminase small subunit	terminase	NA	NA	NA	NA
WP_023328036.1|4171470_4172001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058837079.1|4172000_4173503_+|portal	phage portal protein	portal	D5LH02	Escherichia_phage	27.0	9.2e-32
WP_013815099.1|4173885_4174854_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.1	1.0e-185
WP_077265484.1|4174897_4176313_+|capsid	phage major capsid protein	capsid	D5LH01	Escherichia_phage	22.9	2.9e-11
WP_023328033.1|4176325_4176649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058837082.1|4176648_4177041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023328032.1|4177056_4179810_+|tail	tail fiber domain-containing protein	tail	K7P802	Escherichia_phage	47.0	2.0e-85
WP_032435856.1|4179867_4180329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023328030.1|4180386_4180686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049183613.1|4180787_4181075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013815099.1|4182808_4183777_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.1	1.0e-185
WP_023328022.1|4186104_4186752_+	hypothetical protein	NA	G8C7R6	Escherichia_phage	47.4	1.6e-49
WP_023328021.1|4186789_4187062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032435853.1|4187072_4187516_-	glycoside hydrolase family protein	NA	H6X3N0	Enterobacteria_phage	48.2	9.0e-28
WP_023328020.1|4187556_4188006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023328019.1|4188008_4188578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023328018.1|4188579_4188891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023328017.1|4188887_4189178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023328016.1|4189189_4190479_-	hypothetical protein	NA	R9TRQ8	Vibrio_phage	33.0	5.0e-26
WP_023328015.1|4190520_4191231_+	methyltransferase	NA	A0A2K9VN86	Shigella_phage	57.1	9.2e-75
WP_000517707.1|4191322_4191544_+	DUF2188 domain-containing protein	NA	A0A142KA22	Gordonia_phage	49.2	8.8e-08
WP_002901236.1|4192021_4192768_+	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_072143276.1|4192898_4193714_+	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	26.5	2.9e-16
>prophage 9
NZ_CP013711	Klebsiella pneumoniae strain J1 chromosome, complete genome	5278493	4325807	4399815	5278493	portal,tail,capsid,integrase,head,terminase,protease,transposase,plate,holin	Klebsiella_phage(30.0%)	74	4361725:4361740	4391393:4391408
WP_004176437.1|4325807_4326569_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	6.3e-21
WP_004183778.1|4326785_4328318_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	8.8e-22
WP_032422207.1|4328516_4329065_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_047719115.1|4329262_4330444_+|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	83.5	1.8e-200
WP_004198241.1|4330424_4330616_-	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	3.9e-20
WP_047719113.1|4330751_4330973_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	84.9	1.1e-26
WP_058837088.1|4330969_4331533_-	hypothetical protein	NA	A0A088C4R7	Shewanella_sp._phage	36.7	1.2e-24
WP_058837089.1|4331529_4332246_-	Rha family transcriptional regulator	NA	A0A286S260	Klebsiella_phage	98.7	8.0e-127
WP_058837090.1|4332251_4332770_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	3.8e-94
WP_023317661.1|4332810_4333251_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	78.1	1.2e-56
WP_004177208.1|4333247_4333466_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	98.6	6.6e-32
WP_004177206.1|4333437_4333692_-	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	92.9	2.5e-38
WP_023304721.1|4333684_4334050_-	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	97.5	5.8e-57
WP_004177202.1|4334050_4334275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058837091.1|4334456_4334870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064765747.1|4335033_4335693_-	LexA family transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	79.0	2.7e-97
WP_071646927.1|4335848_4336082_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPK9	Escherichia_phage	63.9	2.2e-17
WP_040182571.1|4336752_4337121_+	hypothetical protein	NA	A0A286S263	Klebsiella_phage	82.8	6.7e-53
WP_058837094.1|4337162_4338809_+	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	86.6	1.8e-291
WP_023317657.1|4338810_4339773_+	toprim domain-containing protein	NA	A0A286N2Q0	Klebsiella_phage	99.7	1.3e-183
WP_058837095.1|4339769_4340552_+	antitermination protein	NA	F1C595	Cronobacter_phage	79.2	7.7e-115
WP_032692764.1|4340870_4341440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_170826749.1|4341839_4342685_+	hypothetical protein	NA	A0A1B2IGT1	Erwinia_phage	73.1	1.6e-110
WP_032692691.1|4342687_4342837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142721747.1|4342874_4342994_-	small membrane protein	NA	NA	NA	NA	NA
WP_017145563.1|4343665_4344061_+|holin	phage holin family protein	holin	K7PHB9	Enterobacterial_phage	98.5	2.6e-63
WP_019705280.1|4344047_4344329_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	3.9e-37
WP_058837096.1|4344328_4344958_+	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	90.4	1.3e-104
WP_058837097.1|4344965_4345241_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	73.0	8.9e-26
WP_040225576.1|4345697_4346048_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	78.9	1.5e-49
WP_001119413.1|4346432_4346930_+|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	71.3	7.4e-63
WP_058837098.1|4346933_4348685_+|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	72.3	4.0e-252
WP_023313057.1|4348832_4350059_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	85.0	4.2e-208
WP_000999827.1|4350051_4350651_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	82.5	1.0e-90
WP_058837099.1|4350660_4351899_+|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	69.2	5.2e-158
WP_023316722.1|4351976_4352294_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	52.0	4.8e-23
WP_058837100.1|4352302_4352641_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	73.2	3.2e-41
WP_058837101.1|4352637_4353087_+	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	81.2	5.7e-62
WP_023302599.1|4353083_4353431_+	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	63.7	2.8e-32
WP_058837102.1|4353487_4354192_+	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	66.5	2.8e-79
WP_016530184.1|4354222_4354627_+|tail	phage tail assembly chaperone	tail	K7PKV6	Enterobacterial_phage	57.4	3.2e-32
WP_016530183.1|4354629_4354935_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	64.6	4.7e-28
WP_058837103.1|4355008_4355242_+	hypothetical protein	NA	K7PH16	Enterobacteria_phage	45.8	4.2e-08
WP_013815099.1|4355442_4356411_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.1	1.0e-185
WP_004177132.1|4359776_4360250_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	62.1	1.4e-55
WP_047683562.1|4360236_4360713_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	63.9	1.5e-49
WP_058837105.1|4360725_4361106_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	81.0	1.9e-58
WP_058837106.1|4361102_4364180_+	kinase	NA	A0A286S259	Klebsiella_phage	62.2	0.0e+00
4361725:4361740	attL	TGGCAGGGGATCGTCG	NA	NA	NA	NA
WP_064765748.1|4364257_4367074_+	hypothetical protein	NA	A0A1I9SEN3	Klebsiella_phage	85.2	0.0e+00
WP_058837107.1|4367104_4367335_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	44.8	5.4e-08
WP_071888080.1|4367868_4368291_+|integrase	site-specific integrase	integrase	K7P834	Enterobacteria_phage	45.3	6.1e-26
WP_187106154.1|4368555_4369763_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	4.4e-101
WP_019705237.1|4370049_4370298_-	DinI-like family protein	NA	S5MQI1	Escherichia_phage	70.4	1.0e-25
WP_004176434.1|4371143_4371635_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_058837109.1|4371677_4373222_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_023286325.1|4373231_4374575_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004176431.1|4374571_4375261_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_023286326.1|4375257_4376964_+	OmpA family protein	NA	NA	NA	NA	NA
WP_002902160.1|4376968_4377460_+	type VI secretion system effector Hcp	NA	NA	NA	NA	NA
WP_023286327.1|4377724_4380379_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.6	4.5e-98
WP_164943374.1|4380380_4382723_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.2	2.6e-17
WP_023286329.1|4382737_4384672_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_004190528.1|4384668_4384929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015958252.1|4384915_4385683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004179560.1|4385862_4386384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096106475.1|4386576_4387674_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.0	1.3e-46
WP_032421276.1|4388558_4388783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023282457.1|4389122_4390331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172418355.1|4390279_4393783_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
4391393:4391408	attR	TGGCAGGGGATCGTCG	NA	NA	NA	NA
WP_023286337.1|4393782_4395381_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_023286338.1|4395411_4396467_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_071787022.1|4396491_4396935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004212348.1|4397011_4398766_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_023283613.1|4398729_4399815_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 10
NZ_CP013711	Klebsiella pneumoniae strain J1 chromosome, complete genome	5278493	4588723	4599610	5278493		Escherichia_phage(87.5%)	9	NA	NA
WP_002210516.1|4588723_4589344_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
WP_004224682.1|4589336_4590602_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.8	7.8e-234
WP_058837118.1|4590613_4591516_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	1.3e-158
WP_002210513.1|4591776_4592538_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004176269.1|4592558_4593419_-	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_004176262.1|4593716_4593977_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_001620097.1|4594063_4595152_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_023286398.1|4595182_4596448_-	oligosaccharide MFS transporter	NA	NA	NA	NA	NA
WP_023286399.1|4596502_4599610_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
>prophage 1
NZ_CP013712	Klebsiella pneumoniae strain J1 plasmid 1, complete sequence	74973	35358	42283	74973	holin,transposase	Salmonella_phage(33.33%)	7	NA	NA
WP_017898990.1|35358_35721_-	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	81.7	3.4e-57
WP_032416992.1|35874_36096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017898986.1|37472_37823_-	hypothetical protein	NA	R9TPM9	Aeromonas_phage	39.8	1.8e-10
WP_049015475.1|37819_38317_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	85.2	9.6e-79
WP_017880269.1|38316_38532_-|holin	class II holin family protein	holin	A5LH82	Enterobacteria_phage	87.3	7.9e-30
WP_013815099.1|39681_40650_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.1	1.0e-185
WP_049014149.1|40951_42283_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.1	2.8e-24
>prophage 1
NZ_CP013713	Klebsiella pneumoniae strain J1 plasmid 2, complete sequence	53400	13737	22126	53400	transposase	Stx2-converting_phage(33.33%)	6	NA	NA
WP_048298753.1|13737_15330_-|transposase	IS66-like element ISKox1 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.6	6.1e-175
WP_048298754.1|15360_15711_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	62.9	1.2e-38
WP_048298755.1|15707_16148_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	59.0	1.3e-18
WP_004117790.1|18248_19220_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.9	7.0e-150
WP_023287153.1|19219_20386_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.2	7.5e-223
WP_017900946.1|21115_22126_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	53.5	1.1e-86
