The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013692	Paucibacter sp. KCTC 42545, complete genome	5169161	464253	470264	5169161		Escherichia_phage(50.0%)	6	NA	NA
WP_058718692.1|464253_465312_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	50.3	7.5e-89
WP_058718693.1|465323_466211_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.4	3.0e-22
WP_058718694.1|466308_467199_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	60.3	6.7e-99
WP_058718695.1|467207_467759_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	51.7	1.8e-46
WP_058718696.1|467894_469115_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HYW7	Paramecium_bursaria_Chlorella_virus	26.6	3.5e-21
WP_058718697.1|469118_470264_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAI1	Catovirus	25.1	2.2e-25
>prophage 2
NZ_CP013692	Paucibacter sp. KCTC 42545, complete genome	5169161	486061	493784	5169161		Prochlorococcus_phage(16.67%)	8	NA	NA
WP_058718710.1|486061_486910_-	NAD-dependent epimerase/dehydratase family protein	NA	Q58M85	Prochlorococcus_phage	27.5	1.2e-09
WP_058718711.1|486912_487449_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	H9NC63	Sphingomonas_phage	37.1	2.3e-25
WP_058718712.1|487459_488812_-	lipopolysaccharide biosynthesis protein RfbH	NA	A0A0P0YLZ6	Yellowstone_lake_phycodnavirus	34.2	3.0e-50
WP_058718713.1|488808_489873_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	25.2	1.2e-14
WP_058718714.1|489879_490653_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_082679715.1|490688_491681_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_058718716.1|491701_492823_-	GDP-mannose 4,6-dehydratase	NA	M1IBC3	Acanthocystis_turfacea_Chlorella_virus	68.9	6.7e-136
WP_058718717.1|492860_493784_-	GDP-L-fucose synthase	NA	M1HWW2	Paramecium_bursaria_Chlorella_virus	54.4	1.8e-94
>prophage 3
NZ_CP013692	Paucibacter sp. KCTC 42545, complete genome	5169161	964929	993417	5169161	protease,transposase	Bacillus_phage(25.0%)	18	NA	NA
WP_058719037.1|964929_966198_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	55.6	5.6e-131
WP_058719038.1|966320_968729_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.5	1.4e-223
WP_058722079.1|969707_971147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156421886.1|971208_972981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082680291.1|973294_974911_+	hypothetical protein	NA	A0A2H4J185	uncultured_Caudovirales_phage	27.4	1.0e-28
WP_156421887.1|975086_976212_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.7	4.6e-52
WP_156421888.1|976205_976841_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_058719044.1|977419_978289_+	biotin/lipoyl-binding protein	NA	NA	NA	NA	NA
WP_156421889.1|979044_979200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058719045.1|980052_981018_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	74.5	1.2e-136
WP_058719046.1|981401_981668_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_058719047.1|982123_983404_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_156421890.1|983474_983840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156421891.1|984413_985580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156421892.1|985609_987736_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	25.3	5.8e-32
WP_058719049.1|987817_988012_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_058718811.1|989790_990528_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	62.0	5.8e-80
WP_058719050.1|991890_993417_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	36.9	2.7e-47
>prophage 4
NZ_CP013692	Paucibacter sp. KCTC 42545, complete genome	5169161	1298370	1340836	5169161	portal,transposase,capsid,tail,head,terminase	Acidithiobacillus_phage(45.16%)	48	NA	NA
WP_058719265.1|1298370_1298634_+	hypothetical protein	NA	K4I3X3	Acidithiobacillus_phage	65.5	1.6e-24
WP_058719266.1|1298645_1299128_+	hypothetical protein	NA	K4HZ96	Acidithiobacillus_phage	63.0	8.2e-51
WP_058719267.1|1299124_1299973_+	ATP-binding protein	NA	K4HZX9	Acidithiobacillus_phage	71.7	7.3e-111
WP_024973179.1|1299978_1300605_+	hypothetical protein	NA	K4ICM8	Acidithiobacillus_phage	67.5	4.5e-73
WP_058719268.1|1300615_1301470_+	hypothetical protein	NA	A0A0S2SYC0	Pseudomonas_phage	43.1	2.6e-23
WP_058719269.1|1301466_1301967_+	hypothetical protein	NA	K4I3X7	Acidithiobacillus_phage	73.6	7.0e-69
WP_058719270.1|1301963_1302701_+	hypothetical protein	NA	K4HZA0	Acidithiobacillus_phage	76.6	1.2e-109
WP_045535108.1|1302697_1302952_+	hypothetical protein	NA	K4I1D6	Acidithiobacillus_phage	68.1	6.7e-20
WP_058719271.1|1302948_1305240_+	hypothetical protein	NA	K4HZY1	Acidithiobacillus_phage	63.1	9.3e-286
WP_058722118.1|1305368_1305833_+	hypothetical protein	NA	K4ICN3	Acidithiobacillus_phage	71.1	1.5e-57
WP_058719272.1|1305834_1306044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058719273.1|1306036_1306453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058722119.1|1306768_1308178_+	site-specific DNA-methyltransferase	NA	K4I3Y2	Acidithiobacillus_phage	60.0	1.2e-161
WP_058719274.1|1308174_1309446_+	site-specific DNA-methyltransferase	NA	A0A2H4JGF1	uncultured_Caudovirales_phage	92.2	3.8e-228
WP_058719275.1|1309409_1309778_-	hypothetical protein	NA	A0A2H4JI44	uncultured_Caudovirales_phage	87.5	2.4e-58
WP_058719276.1|1309876_1310236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058719277.1|1310265_1310790_-	DUF3489 domain-containing protein	NA	A0A2H4JE21	uncultured_Caudovirales_phage	81.1	3.3e-37
WP_058719278.1|1310888_1311086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058719279.1|1311203_1311743_+	hypothetical protein	NA	A0A2H4JCL4	uncultured_Caudovirales_phage	92.7	4.4e-85
WP_058722120.1|1311745_1313710_+|terminase	phage terminase large subunit family protein	terminase	A0A2H4JIC6	uncultured_Caudovirales_phage	88.7	0.0e+00
WP_058719280.1|1313727_1314219_+	hypothetical protein	NA	A0A0F6WCR7	Sinorhizobium_phage	49.1	7.2e-26
WP_058719281.1|1314218_1314611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058719282.1|1314610_1314832_+	hypothetical protein	NA	A0A2H4JCJ9	uncultured_Caudovirales_phage	61.6	8.2e-14
WP_058719283.1|1314831_1316343_+|portal	phage portal protein	portal	A0A1B2LRR5	Wolbachia_phage	56.1	2.6e-151
WP_058719284.1|1316352_1317582_+	S49 family peptidase	NA	K4HZZ6	Acidithiobacillus_phage	43.2	1.2e-64
WP_058719285.1|1317583_1317964_+|head	head decoration protein	head	A0A1B2LRT0	Wolbachia_phage	48.4	1.6e-25
WP_058719286.1|1317981_1319001_+|capsid	major capsid protein	capsid	Q9JMM2	Wolbachia_phage	66.8	7.7e-131
WP_058719287.1|1318997_1319300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058719288.1|1319304_1319751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058719289.1|1319756_1319951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058719290.1|1319947_1320700_+	hypothetical protein	NA	A0A2D2W2E0	Stenotrophomonas_phage	44.2	8.6e-47
WP_058719291.1|1320711_1321113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058719292.1|1321109_1321313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058719293.1|1321318_1321963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058719294.1|1321966_1326010_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	29.5	3.2e-31
WP_058719295.1|1326020_1326428_+	hypothetical protein	NA	A0A0M4UTA7	Ralstonia_phage	50.0	8.8e-30
WP_058719296.1|1326429_1329993_+	hypothetical protein	NA	A0A0M4U447	Ralstonia_phage	40.6	1.4e-235
WP_058719297.1|1330016_1331288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058719298.1|1331291_1332377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058719299.1|1332373_1332769_+	hypothetical protein	NA	Q6VSZ7	Vibrio_phage	33.6	7.8e-07
WP_058719300.1|1332772_1334791_+	hypothetical protein	NA	A0A0M4UKC5	Ralstonia_phage	37.2	2.1e-55
WP_058719301.1|1334783_1335005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058719302.1|1335081_1335384_+	hypothetical protein	NA	K4I011	Acidithiobacillus_phage	65.3	2.6e-26
WP_058719303.1|1335380_1335857_+	hypothetical protein	NA	K4ICR8	Acidithiobacillus_phage	89.1	4.7e-75
WP_058719304.1|1335853_1336318_+	lysozyme	NA	K4I410	Acidithiobacillus_phage	78.2	5.1e-66
WP_058719305.1|1336325_1337087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156421911.1|1338980_1339670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058719307.1|1339885_1340836_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP013692	Paucibacter sp. KCTC 42545, complete genome	5169161	1372806	1380011	5169161	transposase	Acidithiobacillus_phage(66.67%)	8	NA	NA
WP_058719329.1|1372806_1374165_-	recombinase family protein	NA	K4ICM1	Acidithiobacillus_phage	56.8	2.2e-133
WP_082679821.1|1374161_1374518_-	DUF2924 domain-containing protein	NA	K4I3X1	Acidithiobacillus_phage	38.7	3.3e-12
WP_058719330.1|1374577_1375525_+	hypothetical protein	NA	A0A0B5A5I4	Achromobacter_phage	36.1	8.9e-49
WP_058719331.1|1375612_1376059_+	hypothetical protein	NA	A0A0B5A4F6	Achromobacter_phage	41.7	9.4e-09
WP_058719332.1|1376064_1376892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156421912.1|1377217_1377589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058718811.1|1377699_1378437_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	62.0	5.8e-80
WP_058718810.1|1378460_1380011_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	57.1	3.8e-158
>prophage 6
NZ_CP013692	Paucibacter sp. KCTC 42545, complete genome	5169161	1493846	1501792	5169161		uncultured_Mediterranean_phage(33.33%)	8	NA	NA
WP_058719416.1|1493846_1494596_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	51.0	1.9e-62
WP_058719417.1|1494592_1495411_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	42.8	9.4e-31
WP_058719418.1|1495568_1496453_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_156421919.1|1496479_1497523_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	31.6	3.1e-26
WP_058719419.1|1497544_1498942_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	26.2	6.8e-29
WP_058719420.1|1499101_1499797_-	Bax inhibitor-1/YccA family protein	NA	A2VCJ8	Vaccinia_virus	30.3	2.7e-10
WP_058719421.1|1499955_1500360_+	heme-binding protein	NA	NA	NA	NA	NA
WP_058722138.1|1500631_1501792_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	33.4	3.2e-48
>prophage 7
NZ_CP013692	Paucibacter sp. KCTC 42545, complete genome	5169161	1581517	1589142	5169161	integrase,transposase	Staphylococcus_phage(33.33%)	10	1578204:1578219	1589165:1589180
1578204:1578219	attL	GCAAGGCGGCCGAGGC	NA	NA	NA	NA
WP_156421925.1|1581517_1582712_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	1.1e-56
WP_156421926.1|1582776_1583130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156421927.1|1583144_1583315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082679842.1|1583333_1583687_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4J6I5	uncultured_Caudovirales_phage	41.7	2.9e-05
WP_156421896.1|1583711_1584838_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.7	6.0e-52
WP_058719495.1|1584903_1586004_-	hypothetical protein	NA	I6X828	Pseudomonas_phage	34.1	2.2e-27
WP_058719496.1|1586187_1586544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058719497.1|1587003_1587510_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_058719498.1|1587506_1587977_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	37.4	4.0e-18
WP_058719499.1|1588005_1589142_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	36.5	1.8e-48
1589165:1589180	attR	GCCTCGGCCGCCTTGC	NA	NA	NA	NA
>prophage 8
NZ_CP013692	Paucibacter sp. KCTC 42545, complete genome	5169161	1801735	1819855	5169161	integrase,protease,transposase	Leptospira_phage(50.0%)	15	1803579:1803597	1826226:1826244
WP_082679864.1|1801735_1802020_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_058719654.1|1802523_1803813_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
1803579:1803597	attL	TATTGCAGCGCAGGATTTG	NA	NA	NA	NA
WP_156421942.1|1803907_1804084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156421943.1|1804117_1804984_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_082679866.1|1805012_1805516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156421944.1|1805508_1806635_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.7	4.6e-52
WP_082679867.1|1806570_1808391_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	26.1	2.7e-33
WP_082680311.1|1808860_1811149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058719659.1|1811388_1812879_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_058719660.1|1812875_1814057_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_058719661.1|1814449_1816405_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_058719662.1|1816401_1817073_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_156421945.1|1817280_1817523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058719664.1|1817572_1818571_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_082680312.1|1818766_1819855_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
1826226:1826244	attR	CAAATCCTGCGCTGCAATA	NA	NA	NA	NA
>prophage 9
NZ_CP013692	Paucibacter sp. KCTC 42545, complete genome	5169161	2158127	2214626	5169161	integrase,protease,transposase,tRNA	Acidithiobacillus_phage(28.57%)	55	2197051:2197071	2220207:2220227
WP_058719888.1|2158127_2159672_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	56.1	4.2e-157
WP_058719889.1|2159775_2160513_+	AAA family ATPase	NA	K4HZD4	Acidithiobacillus_phage	62.1	2.9e-79
WP_082680320.1|2160579_2161767_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.3	7.3e-08
WP_058719891.1|2162918_2163455_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_058722204.1|2163553_2164003_+	DUF393 domain-containing protein	NA	NA	NA	NA	NA
WP_058719892.1|2164034_2164931_+	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_058719893.1|2164927_2165320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058719894.1|2165316_2165829_+	DUF2269 domain-containing protein	NA	NA	NA	NA	NA
WP_058722205.1|2165818_2167147_-	2-oxo acid dehydrogenase subunit E2	NA	NA	NA	NA	NA
WP_058719895.1|2167146_2168187_-	alpha-ketoacid dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_156421964.1|2169666_2169978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082679914.1|2170154_2171084_-	sensor domain-containing diguanylate cyclase	NA	NA	NA	NA	NA
WP_058719898.1|2171196_2172060_-	DNA ligase	NA	A0A1X9VNY8	Mimivirus	32.8	3.7e-25
WP_058719899.1|2172130_2173573_-	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_082680321.1|2173724_2176037_+	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_156421965.1|2176054_2177080_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_058719901.1|2177084_2178206_-	beta-ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_058719902.1|2178448_2179426_+	GMP reductase	NA	Q4ZCY7	Staphylococcus_virus	64.8	2.4e-121
WP_058719903.1|2179606_2180662_-	alkene reductase	NA	NA	NA	NA	NA
WP_058719904.1|2181018_2183880_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.2	4.5e-136
WP_082679915.1|2183818_2184823_-	phosphoglycerate dehydrogenase	NA	NA	NA	NA	NA
WP_058719905.1|2184963_2185863_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	50.7	1.7e-70
WP_058719906.1|2185991_2186219_-	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_058719907.1|2186287_2186824_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_058719908.1|2186826_2187750_-	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	39.0	2.2e-52
WP_058719909.1|2188194_2188776_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_156421966.1|2188814_2189747_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_058722206.1|2189853_2190891_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_058719911.1|2190931_2191669_+	2OG-Fe dioxygenase family protein	NA	NA	NA	NA	NA
WP_082679916.1|2191780_2192887_+	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_156421967.1|2192977_2193706_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	28.8	8.4e-15
WP_058719522.1|2193714_2194512_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.7	3.8e-16
WP_058719913.1|2194508_2195594_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_058722208.1|2195617_2196541_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
2197051:2197071	attL	CTTGTCTTGCTTCACAAAGGC	NA	NA	NA	NA
WP_058719914.1|2198001_2199282_+|integrase	site-specific integrase	integrase	Q19US1	Mannheimia_phage	27.0	5.8e-11
WP_058719915.1|2199445_2199922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082679917.1|2200652_2201672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156421968.1|2201876_2202314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156421969.1|2202324_2202648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058719919.1|2202777_2203143_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_156421970.1|2203304_2203883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156421971.1|2204210_2204546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058719922.1|2204680_2205520_+	site-specific DNA-methyltransferase	NA	A0A2I7RE86	Vibrio_phage	29.2	2.0e-15
WP_082679918.1|2205531_2205888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156421972.1|2205915_2206164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058719923.1|2206274_2206637_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_082679919.1|2206716_2208603_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_156421973.1|2208774_2208927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156421974.1|2208926_2209241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082679920.1|2209642_2210128_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_156421975.1|2210124_2210778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058718810.1|2211508_2213059_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	57.1	3.8e-158
WP_058718811.1|2213082_2213820_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	62.0	5.8e-80
WP_082679921.1|2213892_2214318_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_156421976.1|2214350_2214626_-|transposase	transposase	transposase	NA	NA	NA	NA
2220207:2220227	attR	CTTGTCTTGCTTCACAAAGGC	NA	NA	NA	NA
>prophage 10
NZ_CP013692	Paucibacter sp. KCTC 42545, complete genome	5169161	2822602	2875982	5169161	protease,transposase	Acidithiobacillus_phage(20.0%)	48	NA	NA
WP_058720341.1|2822602_2823553_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_058720342.1|2823791_2824628_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_058720343.1|2824779_2825136_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_082680341.1|2825455_2826736_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_058720345.1|2827207_2828764_+	cytochrome d terminal oxidase subunit 1	NA	NA	NA	NA	NA
WP_058720346.1|2828774_2829917_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_156422219.1|2830018_2830606_+	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_082679994.1|2830621_2830747_+	cytochrome bd-I oxidase subunit CydX	NA	NA	NA	NA	NA
WP_156422008.1|2830837_2831248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156422009.1|2832704_2834249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156422010.1|2834226_2835352_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.1	3.5e-52
WP_058719889.1|2835587_2836325_-	AAA family ATPase	NA	K4HZD4	Acidithiobacillus_phage	62.1	2.9e-79
WP_058719888.1|2836428_2837973_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	56.1	4.2e-157
WP_156421925.1|2838467_2839663_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	1.1e-56
WP_058720354.1|2840132_2840420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058720355.1|2840464_2841913_-	replicative DNA helicase	NA	O80281	Escherichia_phage	50.6	7.8e-121
WP_058720356.1|2842158_2842614_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_058720357.1|2842627_2842918_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_058720358.1|2842962_2843271_-	primosomal replication protein N	NA	NA	NA	NA	NA
WP_058720359.1|2843305_2843668_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_058720360.1|2843838_2845941_-	cation acetate symporter	NA	NA	NA	NA	NA
WP_058720361.1|2846066_2848475_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	35.7	1.3e-160
WP_058720362.1|2848799_2849621_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_058720363.1|2849622_2850498_+	EamA family transporter	NA	NA	NA	NA	NA
WP_058720364.1|2850500_2851274_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_058720365.1|2851274_2851907_-	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	38.4	5.6e-23
WP_058720366.1|2851872_2853039_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_058720367.1|2853046_2853829_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_058722291.1|2853843_2854287_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_058722292.1|2854289_2855360_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_058720368.1|2855368_2855890_-	OmpH family outer membrane protein	NA	NA	NA	NA	NA
WP_058720369.1|2855889_2858205_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_058720370.1|2858213_2859581_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_058720371.1|2859577_2860777_-	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_058720372.1|2860773_2861634_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_156422220.1|2861653_2862364_-	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	31.9	3.1e-14
WP_058720374.1|2862400_2862961_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_058720375.1|2863005_2863716_-	UMP kinase	NA	NA	NA	NA	NA
WP_058720376.1|2863857_2864748_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_058720377.1|2864873_2865620_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_058720378.1|2865940_2867248_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_058722293.1|2867339_2868818_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_058720379.1|2868941_2871272_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	34.2	1.7e-69
WP_058720380.1|2871706_2872228_-	phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_058722294.1|2872263_2873607_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.2	2.7e-67
WP_058720381.1|2873659_2874823_-	ATP phosphoribosyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_082680343.1|2874876_2875032_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_058720383.1|2875082_2875982_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
>prophage 11
NZ_CP013692	Paucibacter sp. KCTC 42545, complete genome	5169161	2938296	3015720	5169161	integrase,transposase,tRNA	Acidithiobacillus_phage(41.67%)	58	2938188:2938214	2984337:2984363
2938188:2938214	attL	TGGGTTCGATTCCCATCACCCGCTCCA	NA	NA	NA	NA
WP_156422013.1|2938296_2940318_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_058722306.1|2940347_2940593_-	type II toxin-antitoxin system CcdA family antitoxin	NA	NA	NA	NA	NA
WP_156422014.1|2941291_2941435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058720422.1|2941715_2944949_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	27.3	1.2e-60
WP_058722307.1|2945104_2946181_-	Fic family protein	NA	D7RWK9	Brochothrix_phage	26.6	1.5e-20
WP_058720423.1|2946356_2951144_-	DUF3320 domain-containing protein	NA	NA	NA	NA	NA
WP_058720424.1|2951269_2952511_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_058720425.1|2952500_2954072_-	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	32.0	3.5e-50
WP_156422015.1|2954776_2955553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082680346.1|2956702_2957851_-	DUF3466 family protein	NA	NA	NA	NA	NA
WP_156422016.1|2958597_2960040_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_156422017.1|2960443_2960812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156421925.1|2960946_2962141_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	1.1e-56
WP_058720430.1|2962315_2963179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058719889.1|2964999_2965737_-	AAA family ATPase	NA	K4HZD4	Acidithiobacillus_phage	62.1	2.9e-79
WP_058719888.1|2965840_2967385_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	56.1	4.2e-157
WP_058720432.1|2968287_2968620_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_058720433.1|2968616_2968970_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_082680347.1|2969389_2969872_+	50S ribosomal protein L6	NA	NA	NA	NA	NA
WP_058720435.1|2970989_2971550_-	DUF4268 domain-containing protein	NA	NA	NA	NA	NA
WP_082680001.1|2971657_2971843_-	PEP-CTERM sorting domain-containing protein	NA	NA	NA	NA	NA
WP_058720436.1|2972171_2972582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156422018.1|2973695_2974028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058720438.1|2974752_2975262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058720439.1|2975840_2976215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058718811.1|2976411_2977149_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	62.0	5.8e-80
WP_058718810.1|2977172_2978723_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	57.1	3.8e-158
WP_156422019.1|2978762_2979878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058720441.1|2981263_2982157_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_156422020.1|2982193_2982925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156422021.1|2983497_2983764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058720443.1|2984712_2984958_+	hypothetical protein	NA	NA	NA	NA	NA
2984337:2984363	attR	TGGGTTCGATTCCCATCACCCGCTCCA	NA	NA	NA	NA
WP_082680003.1|2985153_2986944_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_058720445.1|2987465_2990744_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_058722308.1|2991009_2992542_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_058720446.1|2992662_2994150_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_058720447.1|2994344_2996999_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	40.4	1.1e-80
WP_058720448.1|2997082_2997793_+	UPF0149 family protein	NA	NA	NA	NA	NA
WP_058720449.1|2997914_2998406_-	SET domain-containing protein	NA	NA	NA	NA	NA
WP_058720450.1|2998717_2999245_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_058720451.1|2999353_2999614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058720452.1|2999847_3000339_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_058720453.1|3000335_3000932_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_058720454.1|3001099_3001702_+	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_058720455.1|3001701_3001956_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_156422022.1|3001945_3002623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156422023.1|3002683_3003520_+	DUF2987 domain-containing protein	NA	NA	NA	NA	NA
WP_058720458.1|3003568_3004057_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_058720459.1|3004166_3005135_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_058722309.1|3005139_3005448_-	DUF4212 domain-containing protein	NA	NA	NA	NA	NA
WP_156422024.1|3005618_3006722_+	peptide chain release factor 2	NA	NA	NA	NA	NA
WP_058722311.1|3006808_3009502_+	aminopeptidase N	NA	NA	NA	NA	NA
WP_058720460.1|3009506_3010520_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	35.3	4.4e-46
WP_058720462.1|3011424_3012063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082680004.1|3012526_3014140_+	SAM-dependent DNA methyltransferase	NA	A0A220A2U4	Liberibacter_phage	40.1	2.3e-97
WP_058720463.1|3014136_3014607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156421976.1|3014575_3014851_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_082680005.1|3014883_3015720_+|transposase	IS3 family transposase	transposase	K4HZD4	Acidithiobacillus_phage	69.1	1.8e-32
>prophage 12
NZ_CP013692	Paucibacter sp. KCTC 42545, complete genome	5169161	3127449	3138842	5169161		Escherichia_phage(22.22%)	10	NA	NA
WP_058720538.1|3127449_3128475_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	43.7	4.7e-72
WP_156422031.1|3128505_3129951_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	28.7	3.3e-47
WP_058720539.1|3130084_3131365_+	nucleotide sugar dehydrogenase	NA	NA	NA	NA	NA
WP_058720540.1|3131385_3132444_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	50.3	7.5e-89
WP_058720541.1|3132455_3133337_+	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	32.1	3.3e-21
WP_058720542.1|3133409_3134300_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	59.9	4.4e-98
WP_058720543.1|3134308_3134860_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	51.6	1.7e-47
WP_058720544.1|3134934_3136272_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	40.2	4.9e-77
WP_058720545.1|3136353_3137361_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	26.8	9.2e-28
WP_058720546.1|3137735_3138842_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	38.0	5.5e-58
>prophage 13
NZ_CP013692	Paucibacter sp. KCTC 42545, complete genome	5169161	4200150	4245265	5169161	protease,transposase,tRNA	Catovirus(11.11%)	34	NA	NA
WP_058721271.1|4200150_4201464_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_058721272.1|4201711_4203406_+	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	25.3	9.1e-36
WP_058721273.1|4203478_4204609_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_156422096.1|4204765_4205188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058721275.1|4205262_4207851_-|protease	zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_058721276.1|4208116_4208785_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_058722441.1|4208947_4209595_+	LysE family translocator	NA	NA	NA	NA	NA
WP_058721277.1|4209594_4210137_+	DUF2939 domain-containing protein	NA	NA	NA	NA	NA
WP_058721278.1|4210133_4211675_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_058721279.1|4211840_4213103_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_058721280.1|4213225_4214716_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_058721281.1|4214738_4215281_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	43.8	5.3e-30
WP_156422097.1|4215576_4215810_+	DUF2805 domain-containing protein	NA	NA	NA	NA	NA
WP_058721283.1|4215854_4216958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058722442.1|4217173_4218565_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_082680146.1|4219111_4219750_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_082680147.1|4219659_4222434_+	serine/threonine protein kinase	NA	A0A2P1EMR8	Moumouvirus	29.0	5.0e-15
WP_156422098.1|4222575_4223523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058721289.1|4223688_4225413_-	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_082680148.1|4225409_4225742_-	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_082680372.1|4225760_4226231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054021782.1|4226251_4226386_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_156422243.1|4226879_4228367_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_058721292.1|4228491_4229613_+	DNA polymerase III subunit beta	NA	R9TRR6	Rhizobium_phage	33.0	1.2e-44
WP_082680150.1|4229724_4232319_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	35.1	8.8e-115
WP_058722445.1|4232816_4234346_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_082680151.1|4234335_4235055_+	AAA family ATPase	NA	U5N3V8	Enterobacteria_phage	35.1	3.1e-17
WP_156422099.1|4234996_4236192_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	8.6e-57
WP_058719050.1|4236647_4238174_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	36.9	2.7e-47
WP_156422100.1|4239709_4240165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058718810.1|4240204_4241755_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	57.1	3.8e-158
WP_156422101.1|4243012_4243195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082680154.1|4243510_4244362_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_082680155.1|4244575_4245265_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP013692	Paucibacter sp. KCTC 42545, complete genome	5169161	4510394	4586668	5169161	integrase,transposase,tRNA	Acinetobacter_phage(22.22%)	56	4512279:4512295	4555999:4556015
WP_058721493.1|4510394_4511438_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_058721494.1|4511473_4512661_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
4512279:4512295	attL	TGCTGGGCCAGCTGAAG	NA	NA	NA	NA
WP_058721495.1|4512754_4513636_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_156422120.1|4513651_4514035_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_058721497.1|4514212_4515487_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_058721498.1|4515495_4516725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058722479.1|4516739_4517270_-	class IV adenylate cyclase	NA	NA	NA	NA	NA
WP_082680380.1|4517317_4518268_-	DMT family transporter	NA	NA	NA	NA	NA
WP_058721499.1|4518462_4518921_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_058721500.1|4518938_4519769_+	hydroxypyruvate isomerase family protein	NA	NA	NA	NA	NA
WP_058721501.1|4519761_4522632_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	25.2	2.8e-37
WP_058721502.1|4522840_4524319_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_058721503.1|4524523_4524967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058721504.1|4524957_4526040_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_058721505.1|4526150_4526771_-	D-alanyl-D-alanine dipeptidase	NA	NA	NA	NA	NA
WP_058721506.1|4526767_4527670_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_082680192.1|4527704_4529318_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_058721507.1|4529594_4530395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058721508.1|4530442_4531372_-	agmatinase	NA	NA	NA	NA	NA
WP_156421925.1|4532169_4533365_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	1.1e-56
WP_058721509.1|4533755_4535216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058721510.1|4535335_4535722_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_058721511.1|4535785_4536754_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.3	2.4e-17
WP_058721512.1|4536746_4537718_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	31.1	3.1e-12
WP_058721513.1|4537721_4538639_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_058721514.1|4538808_4539816_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_058721515.1|4539838_4540711_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A076YN96	Rhizobium_phage	25.0	7.5e-10
WP_058721516.1|4540865_4541453_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	43.0	7.0e-20
WP_058721517.1|4541495_4542311_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_058721518.1|4542470_4543607_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	45.2	2.7e-84
WP_058721519.1|4543679_4544168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156422121.1|4544171_4544822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156422122.1|4545047_4546385_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_156422123.1|4546501_4548397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058721523.1|4548400_4550440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058721524.1|4550439_4550907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058721526.1|4551494_4552088_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_082680193.1|4551969_4552389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058721527.1|4552561_4554265_-	flotillin	NA	NA	NA	NA	NA
WP_058721528.1|4554300_4554933_-	YqiJ family protein	NA	NA	NA	NA	NA
WP_058721529.1|4554929_4555616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058721530.1|4555617_4556139_-	hypothetical protein	NA	NA	NA	NA	NA
4555999:4556015	attR	CTTCAGCTGGCCCAGCA	NA	NA	NA	NA
WP_058721531.1|4556274_4556721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082680194.1|4556717_4557215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058721533.1|4557213_4558245_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_058721534.1|4558291_4558579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058721535.1|4558717_4559056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156422124.1|4559052_4578249_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_082680195.1|4578276_4580139_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_058722482.1|4581269_4581983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156422125.1|4582290_4583151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156422126.1|4583161_4583743_+	hypothetical protein	NA	S5FXQ0	Shigella_phage	36.0	1.1e-17
WP_156422127.1|4583820_4583988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156422128.1|4584677_4585765_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.4	9.0e-45
WP_082680197.1|4585709_4586360_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_156421976.1|4586392_4586668_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP013692	Paucibacter sp. KCTC 42545, complete genome	5169161	4822722	4846636	5169161	protease,transposase	Rhodococcus_phage(50.0%)	27	NA	NA
WP_058721715.1|4822722_4823610_+|protease	metalloprotease	protease	A0A1I9SA48	Rhodococcus_phage	40.6	3.2e-32
WP_058721716.1|4823799_4824405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058721717.1|4824487_4824727_+	HPr-rel-A system PqqD family peptide chaperone	NA	NA	NA	NA	NA
WP_058721718.1|4824723_4825647_+	HprK-related kinase A	NA	NA	NA	NA	NA
WP_058721719.1|4825643_4826747_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_058721720.1|4826802_4827423_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_058721721.1|4827463_4827748_-	DUF2917 domain-containing protein	NA	NA	NA	NA	NA
WP_058721722.1|4827901_4829356_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_058721723.1|4829316_4830303_-	DMT family transporter	NA	NA	NA	NA	NA
WP_058721724.1|4830679_4830964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058721725.1|4831000_4832263_-	glycolate oxidase subunit GlcF	NA	NA	NA	NA	NA
WP_156422254.1|4832262_4832922_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_058721727.1|4832947_4834045_-	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
WP_058722508.1|4834048_4835524_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_058721728.1|4835586_4836351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058721729.1|4836378_4837359_-	TraB/GumN family protein	NA	NA	NA	NA	NA
WP_058721730.1|4837355_4837859_-|protease	TIGR02281 family clan AA aspartic protease	protease	NA	NA	NA	NA
WP_058721731.1|4838054_4839608_-	ammonium transporter	NA	NA	NA	NA	NA
WP_058721732.1|4839681_4840020_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_058721733.1|4840071_4840839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156422154.1|4841523_4842387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058719059.1|4842423_4843455_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_156422155.1|4843547_4844150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156421896.1|4844186_4845312_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.7	6.0e-52
WP_082680226.1|4845371_4845605_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_156422156.1|4845653_4846004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082680227.1|4846255_4846636_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP013692	Paucibacter sp. KCTC 42545, complete genome	5169161	4860822	4877814	5169161	integrase,transposase	Acidithiobacillus_phage(57.14%)	14	4873590:4873605	4878961:4878976
WP_156421896.1|4860822_4861949_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.7	6.0e-52
WP_156422159.1|4861969_4862140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058721749.1|4862270_4863716_-	S8 family peptidase	NA	NA	NA	NA	NA
WP_058718810.1|4863861_4865412_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	57.1	3.8e-158
WP_058718811.1|4865435_4866173_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	62.0	5.8e-80
WP_156422160.1|4866306_4867470_-	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_058721751.1|4867524_4868508_-	ATP-binding protein	NA	A0A2K9R7H3	Dishui_lake_phycodnavirus	31.2	1.0e-10
WP_156422099.1|4869335_4870530_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	8.6e-57
WP_058719888.1|4871199_4872744_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	56.1	4.2e-157
WP_058719889.1|4872847_4873585_+	AAA family ATPase	NA	K4HZD4	Acidithiobacillus_phage	62.1	2.9e-79
WP_156422161.1|4873544_4873895_-	hypothetical protein	NA	NA	NA	NA	NA
4873590:4873605	attL	CCTGCGCCACCCGGCC	NA	NA	NA	NA
WP_058721752.1|4873897_4874788_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_058721753.1|4874784_4876743_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_058719307.1|4876863_4877814_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
4878961:4878976	attR	GGCCGGGTGGCGCAGG	NA	NA	NA	NA
