The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	0	85155	5106662	portal,integrase,head,transposase,plate,capsid,tail,holin,terminase	Enterobacteria_phage(40.74%)	110	70750:70765	90074:90089
WP_000979945.1|587_1076_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_000905061.1|1104_1704_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	98.9	3.8e-98
WP_023363133.1|1931_2717_+	hypothetical protein	NA	Q858V4	Yersinia_virus	76.6	1.1e-108
WP_001554335.1|2718_3246_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	93.7	2.6e-90
WP_000972134.1|3274_3808_-|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	98.9	4.2e-96
WP_021538277.1|3810_5796_-|tail	phage tail fiber protein	tail	A0A0A7NV63	Enterobacteria_phage	86.0	3.2e-173
WP_000071703.1|5798_6329_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.2	3.6e-92
WP_001111954.1|6321_7218_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	3.3e-154
WP_000213444.1|7221_7572_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	99.1	3.5e-59
WP_001271941.1|7568_8150_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	98.4	3.3e-102
WP_000356366.1|8146_8782_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	4.1e-114
WP_000921127.1|8774_9242_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	95.5	3.5e-83
WP_000202148.1|9265_11143_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	80.2	2.7e-299
WP_000780577.1|11281_11677_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	93.3	1.0e-59
WP_000072341.1|11673_12066_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	96.9	1.9e-69
WP_001342221.1|12062_12386_-|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	93.5	1.7e-47
WP_000864901.1|12388_12589_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000063100.1|12588_13083_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	97.0	1.9e-87
WP_000632309.1|13184_13985_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	89.1	6.9e-127
WP_001055083.1|14030_15083_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	94.3	1.4e-188
WP_001262655.1|15106_15943_-|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.6	2.7e-150
WP_000613780.1|16097_17849_+|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	97.8	0.0e+00
WP_000087814.1|17848_18895_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	2.2e-202
WP_000236495.1|18909_19434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001068329.1|20157_20655_+	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
WP_000193205.1|20694_21537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000211282.1|21620_21935_-	plasmid partition protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.3	4.1e-19
WP_000686485.1|21939_22899_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	4.2e-179
WP_000123489.1|22975_25798_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	98.4	0.0e+00
WP_000599382.1|25804_26170_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	97.5	1.7e-61
WP_023142408.1|26166_26784_-	hypothetical protein	NA	S5MQL6	Escherichia_phage	42.0	1.5e-09
WP_000104290.1|26795_27095_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.9	2.4e-40
WP_000153700.1|27091_27358_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	75.9	2.0e-30
WP_000985157.1|27354_27558_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000543036.1|27581_27992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021715.1|28085_28199_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	89.2	1.8e-09
WP_000514277.1|28195_28438_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000159455.1|28449_28728_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	79.3	3.1e-34
WP_000776267.1|28738_29089_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	93.1	8.1e-56
WP_001287828.1|29226_29418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204236.1|29850_30372_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001368591.1|30476_30818_+	helix-turn-helix transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	51.2	4.7e-16
WP_000023739.1|30887_31880_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	56.2	1.3e-103
WP_000850306.1|32179_34624_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
WP_000213098.1|34634_35252_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000534666.1|35253_36117_+	dimethyl sulfoxide reductase anchor subunit DmsC	NA	NA	NA	NA	NA
WP_000165876.1|36152_36779_-	hydrolase	NA	NA	NA	NA	NA
WP_000109283.1|37092_38241_+	MFS transporter	NA	NA	NA	NA	NA
WP_000111043.1|38337_39078_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
WP_001292822.1|39269_41552_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
WP_001295917.1|41606_42464_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_000194832.1|42869_44630_-	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_000642852.1|44759_45452_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_000057158.1|45650_46739_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	2.7e-81
WP_000445240.1|46809_48093_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000904922.1|48348_48921_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	85.2	4.6e-85
WP_063269479.1|48980_49505_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	48.6	1.8e-35
WP_000072165.1|49504_50119_+|tail	tail assembly protein	tail	Q9MCR5	Enterobacteria_phage	60.5	2.5e-60
WP_023142129.1|50125_50587_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	50.0	3.9e-34
WP_023363137.1|50597_51845_-|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	43.7	2.0e-40
WP_000138756.1|51847_52426_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.8	1.7e-66
WP_001219098.1|52418_53522_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	55.2	1.4e-106
WP_000859111.1|53512_53860_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	62.4	5.9e-35
WP_000148266.1|53914_54511_-|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	45.2	3.2e-36
WP_000808007.1|54507_55662_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	47.6	1.9e-85
WP_012602373.1|55649_55865_-	membrane protein	NA	Q6QIA3	Burkholderia_phage	57.1	1.2e-17
WP_000458387.1|55861_56746_-|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	47.9	6.8e-51
WP_000016538.1|56745_59697_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	29.9	9.8e-86
WP_001202894.1|59772_59931_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_000084213.1|59854_60190_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000110114.1|60287_60569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000034294.1|60571_61093_-|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	67.6	1.8e-67
WP_000729834.1|61092_62520_-|tail	tail protein	tail	A4JWK5	Burkholderia_virus	76.3	4.5e-214
WP_012602372.1|62509_62764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101804.1|62760_63225_-	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
WP_000271668.1|63224_63671_-	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
WP_000537457.1|63672_64011_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_001286908.1|64020_64974_-	hypothetical protein	NA	A4JWK0	Burkholderia_virus	43.8	3.4e-64
WP_001273074.1|64988_66104_-	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.6	9.4e-98
WP_000135514.1|66318_66777_-	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	2.6e-30
WP_000117548.1|66779_67601_-|capsid	minor capsid protein	capsid	A4JWJ6	Burkholderia_virus	61.9	1.8e-98
WP_000090684.1|67581_69078_-	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.0	9.7e-167
WP_001295924.1|69077_70610_-	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.8	6.2e-185
WP_000124060.1|70669_71215_-	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
70750:70765	attL	CGGCGTTGCTGGCTGC	NA	NA	NA	NA
WP_000227701.1|71214_71526_-	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
WP_000175099.1|71525_71852_-	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	48.6	1.1e-17
WP_000264665.1|71848_72499_-	hypothetical protein	NA	J9SVN7	Pseudomonas_phage	32.9	2.8e-09
WP_001104440.1|72482_73223_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	51.4	2.5e-62
WP_000793146.1|73225_73576_-	membrane protein	NA	A4JWP3	Burkholderia_virus	53.0	1.5e-22
WP_000194951.1|73706_74435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000972294.1|74410_74815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001069610.1|74813_75032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000783854.1|75222_75987_+	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	64.4	5.2e-100
WP_000031013.1|76103_76460_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000123378.1|76553_76742_+	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	71.0	3.9e-17
WP_000047759.1|76794_77103_+	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	55.9	2.7e-23
WP_000533817.1|77113_78034_+	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	56.2	1.6e-74
WP_001095645.1|78033_78351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000186588.1|78366_80136_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A4JWN2	Burkholderia_virus	69.4	1.5e-227
WP_000960679.1|80146_81313_+	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	59.4	2.2e-121
WP_000843446.1|81315_81585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001140136.1|81612_82143_+	host-nuclease inhibitor protein Gam	NA	L7P7T1	Pseudomonas_phage	66.7	1.2e-58
WP_000632576.1|82431_82704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295929.1|82713_83010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763554.1|83024_83240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000132039.1|83236_83920_+	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	36.1	1.1e-32
WP_000631813.1|83916_84147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000206212.1|84136_84343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001170114.1|84344_84794_+	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	45.1	6.1e-24
WP_001281701.1|84765_85155_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	54.2	1.5e-31
90074:90089	attR	CGGCGTTGCTGGCTGC	NA	NA	NA	NA
>prophage 2
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	88880	93420	5106662		Bacillus_phage(100.0%)	3	NA	NA
WP_000167336.1|88880_89165_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000705731.1|89370_91635_+	ComEC family protein	NA	NA	NA	NA	NA
WP_000551259.1|91671_93420_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	3.3e-57
>prophage 3
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	108125	119711	5106662	tRNA	Bacillus_virus(33.33%)	9	NA	NA
WP_001295932.1|108125_108674_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_001109456.1|108700_109348_+	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_000462681.1|109397_110588_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_000977908.1|110772_111861_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	2.8e-99
WP_000117888.1|112463_113864_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	6.9e-82
WP_001295933.1|114032_115235_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000193867.1|115500_118113_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	5.3e-19
WP_001090493.1|118155_118923_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	7.5e-30
WP_023363144.1|118919_119711_-	aliphatic sulfonate ABC transporter permease SsuC	NA	G3M9Y4	Bacillus_virus	24.5	1.4e-15
>prophage 4
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	127678	129586	5106662		Tupanvirus(100.0%)	1	NA	NA
WP_000053085.1|127678_129586_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	1.1e-53
>prophage 5
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	142196	144251	5106662		Bacillus_phage(100.0%)	1	NA	NA
WP_001295938.1|142196_144251_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	1.0e-20
>prophage 6
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	148485	149145	5106662	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000375136.1|148485_149145_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
>prophage 7
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	160142	172559	5106662		Morganella_phage(20.0%)	13	NA	NA
WP_000066490.1|160142_160355_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_071524879.1|160365_160554_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001309400.1|160528_160759_+	protein YmcE	NA	NA	NA	NA	NA
WP_001019197.1|160748_160922_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000818460.1|160970_162044_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001054734.1|162126_164859_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	32.5	1.8e-38
WP_001264949.1|164941_165970_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001120112.1|165942_166635_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001230247.1|166764_167937_+	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001063148.1|167936_170483_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	30.8	1.5e-71
WP_000209903.1|170479_171079_+	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_000024569.1|171333_171639_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000420625.1|171638_172559_-	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	4.2e-11
>prophage 8
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	175589	177689	5106662		Enterobacteria_phage(100.0%)	3	NA	NA
WP_001273658.1|175589_175763_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_001295943.1|175845_177174_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.4	5.3e-233
WP_001028098.1|177194_177689_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	96.9	1.1e-50
>prophage 9
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	192010	193075	5106662		Cronobacter_phage(100.0%)	1	NA	NA
WP_000258777.1|192010_193075_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	3.6e-91
>prophage 10
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	199893	201261	5106662		Bacillus_phage(100.0%)	1	NA	NA
WP_000409838.1|199893_201261_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.0	2.5e-20
>prophage 11
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	204652	205486	5106662		Pelagibacter_phage(100.0%)	1	NA	NA
WP_001189322.1|204652_205486_-	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 12
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	209623	210157	5106662		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
WP_000857405.1|209623_210157_+	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	5.9e-26
>prophage 13
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	219464	220385	5106662		Morganella_phage(100.0%)	1	NA	NA
WP_001295958.1|219464_220385_-	kdo(2)-lipid IV(A) lauroyltransferase	NA	A0A1W6JP29	Morganella_phage	41.9	3.9e-57
>prophage 14
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	225046	225292	5106662		Salmonella_phage(100.0%)	1	NA	NA
WP_001217754.1|225046_225292_-	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 15
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	241172	242114	5106662		Brevibacillus_phage(100.0%)	1	NA	NA
WP_001295961.1|241172_242114_+	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	3.6e-10
>prophage 16
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	254470	255652	5106662		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_001008535.1|254470_255205_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.3e-15
WP_000103754.1|255415_255652_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
>prophage 17
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	258924	260567	5106662		Pseudomonas_phage(50.0%)	2	NA	NA
WP_001257002.1|258924_259566_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
WP_001267919.1|259562_260567_+	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	30.9	8.4e-05
>prophage 18
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	272889	273147	5106662		Erwinia_phage(100.0%)	1	NA	NA
WP_000800153.1|272889_273147_+	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 19
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	280433	284156	5106662		Planktothrix_phage(50.0%)	4	NA	NA
WP_001033695.1|280433_281135_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.9e-35
WP_001251354.1|281134_282379_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_000291272.1|282407_283319_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_000952746.1|283334_284156_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
>prophage 20
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	287431	289409	5106662		Mycoplasma_phage(100.0%)	2	NA	NA
WP_000799382.1|287431_288289_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	26.2	4.3e-10
WP_000531594.1|288272_289409_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
>prophage 21
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	294430	350987	5106662	portal,integrase,transposase,head,tRNA,lysis,capsid,tail,holin,terminase	Enterobacteria_phage(53.7%)	70	289117:289132	351236:351251
289117:289132	attL	TAGCTTTGGAAAACAG	NA	NA	NA	NA
WP_000423736.1|294430_295801_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	7.9e-107
WP_001295971.1|295804_296446_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001295972.1|296481_297588_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|297641_298103_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248677.1|298112_298766_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444487.1|298937_300188_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741335.1|300301_301444_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	100.0	3.6e-206
WP_000088653.1|301433_301670_-	excisionase	NA	NA	NA	NA	NA
WP_000490213.1|301809_302049_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.2	4.7e-39
WP_000002139.1|302032_302359_-	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	95.7	9.8e-48
WP_060667437.1|302358_302610_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	93.0	1.7e-31
WP_085949154.1|302648_303795_+|transposase	IS3-like element ISEc52 family transposase	transposase	Q716C2	Shigella_phage	96.3	2.4e-173
WP_021533932.1|303931_304213_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	95.7	3.0e-45
WP_000548516.1|304223_304415_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	93.7	1.8e-25
WP_000149537.1|304387_304570_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.3	1.8e-27
WP_000186848.1|304566_305247_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_000100847.1|305243_306029_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995418.1|306034_306331_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	8.9e-48
WP_000233576.1|306406_306613_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000259990.1|307208_307964_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	1.4e-92
WP_001067458.1|308002_308233_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_001182900.1|308302_308842_+	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	67.0	2.6e-61
WP_001435464.1|308928_309858_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.1	6.1e-111
WP_000788794.1|309854_310556_+	replication protein P of bacteriophage	NA	M1FJ72	Enterobacteria_phage	97.0	1.5e-125
WP_022645049.1|310805_315071_+	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_000700202.1|315107_316151_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_072147164.1|316500_316602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053005.1|316598_317054_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	1.6e-59
WP_000224914.1|317053_317224_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774479.1|317216_317507_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	95.8	2.3e-48
WP_001099488.1|317503_317866_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	95.7	1.6e-59
WP_000971096.1|317862_318003_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	68.9	8.5e-09
WP_001097224.1|317999_318689_+	antiterminator Q	NA	I6PDF8	Cronobacter_phage	48.5	4.9e-57
WP_000544528.1|319010_319316_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001180486.1|319302_319779_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	94.9	7.3e-84
WP_001228695.1|319995_320178_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001298464.1|320268_320562_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
WP_000830178.1|321042_321369_+	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_000881610.1|321575_321758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000453620.1|322321_322867_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	6.8e-94
WP_001027261.1|322841_324767_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_000198149.1|324763_324970_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001295977.1|324966_326568_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	1.4e-309
WP_000123268.1|326548_327868_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.7	1.1e-230
WP_001295978.1|327877_328210_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063293.1|328265_329291_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.4	7.8e-192
WP_000158908.1|329332_329731_+	DNA packaging protein from bacteriophage origin	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	1.0e-62
WP_000753018.1|329742_330096_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.2e-61
WP_000683150.1|330681_331077_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	2.9e-70
WP_001295979.1|331084_331825_+|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	98.0	1.6e-130
WP_000479203.1|331840_332263_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	94.3	2.2e-68
WP_000459457.1|332244_332679_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840216.1|332671_335233_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	98.4	0.0e+00
WP_000847375.1|335229_335559_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	2.8e-58
WP_001152626.1|335558_336257_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.6	5.1e-134
WP_023146277.1|336261_337005_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	5.0e-148
WP_023149564.1|336941_337544_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	2.1e-88
WP_001531667.1|337604_341087_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.3	0.0e+00
WP_000290538.1|341145_343167_+	hypothetical protein	NA	A0A0E3M0V5	Enterobacteria_phage	72.3	7.2e-181
WP_000654172.1|343163_343442_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	55.4	9.9e-25
WP_000355360.1|343454_343748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000968127.1|343839_344697_-	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_001101732.1|344693_345551_-	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_000983716.1|345547_346375_-	iron/manganese ABC transporter ATP-binding protein SitB	NA	M1HV27	Acanthocystis_turfacea_Chlorella_virus	29.0	1.9e-07
WP_087762043.1|346374_347265_-	iron/manganese ABC transporter substrate-binding protein SitA	NA	NA	NA	NA	NA
WP_001304451.1|347986_348745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000539892.1|349216_349369_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	1.6e-21
WP_023146274.1|349452_349578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373104.1|349630_350035_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_000332288.1|350255_350987_-	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	51.0	2.1e-53
351236:351251	attR	TAGCTTTGGAAAACAG	NA	NA	NA	NA
>prophage 22
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	365183	366871	5106662		Morganella_phage(50.0%)	2	NA	NA
WP_000897376.1|365183_365603_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	61.3	6.9e-38
WP_000457596.1|365602_366871_+	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	82.5	9.6e-208
>prophage 23
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	382788	383547	5106662		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000173310.1|382788_383547_-	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.5e-14
>prophage 24
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	402163	406822	5106662	integrase	Shigella_phage(33.33%)	8	402124:402137	408867:408880
402124:402137	attL	TCCGTTATTTCAGT	NA	NA	NA	NA
WP_001531625.1|402163_402433_-	transcriptional regulator	NA	A0A0C4UQU0	Shigella_phage	58.7	3.4e-14
WP_006324788.1|402686_403043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063270541.1|403397_403790_+	DUF2787 family protein	NA	NA	NA	NA	NA
WP_000954131.1|403909_404371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000177770.1|404372_404825_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_023141324.1|404871_405801_+|integrase	site-specific integrase	integrase	A0A1B1P7C7	Bacillus_phage	28.5	4.4e-08
WP_000580009.1|405787_406402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001095671.1|406624_406822_+	AlpA family phage regulatory protein	NA	A0A1V0E8E5	Vibrio_phage	43.9	7.3e-06
408867:408880	attR	ACTGAAATAACGGA	NA	NA	NA	NA
>prophage 25
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	417009	424800	5106662	integrase,transposase,tRNA	Shigella_phage(25.0%)	8	410318:410332	429611:429625
410318:410332	attL	ATGTCCGCTTTGAGC	NA	NA	NA	NA
WP_077249438.1|417009_417864_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	56.2	1.6e-81
WP_000537155.1|417860_418145_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_000954595.1|418255_419431_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	39.4	1.7e-73
WP_000505872.1|419645_420737_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_000152940.1|420853_421438_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000823885.1|421715_421994_+	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_001033350.1|422048_423728_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.8	6.0e-24
WP_001298109.1|423852_424800_-	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
429611:429625	attR	ATGTCCGCTTTGAGC	NA	NA	NA	NA
>prophage 26
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	427936	434214	5106662		Pseudomonas_phage(33.33%)	8	NA	NA
WP_000804726.1|427936_429019_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
WP_000456450.1|429018_429852_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000200375.1|429848_430241_+	SirB family protein	NA	NA	NA	NA	NA
WP_001257044.1|430244_431054_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000811065.1|431089_431944_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
WP_001531632.1|432092_432200_-	small toxic polypeptide ldrA/ldrC	NA	NA	NA	NA	NA
WP_000063608.1|432604_433705_-	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_000120702.1|433974_434214_+	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	39.0	2.6e-05
>prophage 27
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	445336	446875	5106662		Escherichia_phage(100.0%)	1	NA	NA
WP_000702647.1|445336_446875_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	41.7	4.8e-20
>prophage 28
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	455528	461891	5106662		Synechococcus_phage(33.33%)	7	NA	NA
WP_000555842.1|455528_456371_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_001311640.1|456420_456879_-	YchJ family protein	NA	NA	NA	NA	NA
WP_001226476.1|456991_457897_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_000193451.1|457988_459002_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_000718995.1|459203_460112_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_001287378.1|460256_460670_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000068069.1|461273_461891_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.1	1.7e-53
>prophage 29
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	471457	473472	5106662		Planktothrix_phage(50.0%)	2	NA	NA
WP_000110940.1|471457_472471_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
WP_000994905.1|472467_473472_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
>prophage 30
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	481403	554380	5106662	portal,integrase,head,transposase,protease,capsid,tail,holin,terminase	Enterobacteria_phage(23.64%)	78	477577:477591	483487:483501
477577:477591	attL	ACTCCTTGTTCGGGA	NA	NA	NA	NA
WP_000113700.1|481403_482534_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|482511_482760_-	excisionase	NA	NA	NA	NA	NA
WP_016230610.1|482824_485296_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.0	5.7e-55
483487:483501	attR	ACTCCTTGTTCGGGA	NA	NA	NA	NA
WP_001090200.1|485388_485580_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449179.1|485576_485765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001171951.1|486330_486549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379589.1|486708_486864_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_000103687.1|487136_487853_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	42.0	1.7e-52
WP_000471549.1|487902_488118_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000693845.1|488114_488540_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095675.1|488562_489525_+	DNA-binding protein	NA	S5FM81	Shigella_phage	56.4	1.4e-70
WP_000788950.1|489531_490278_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.8	4.0e-113
WP_000450998.1|490299_491070_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	1.6e-80
WP_001151161.1|491085_491511_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	94.0	2.2e-63
WP_000150294.1|491685_492351_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_000018429.1|492531_492744_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	5.2e-26
WP_001329966.1|492911_493184_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	5.5e-12
WP_001265085.1|493185_494241_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.4	4.0e-90
WP_000140014.1|494241_494622_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.5	2.9e-35
WP_001513213.1|494618_495440_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	1.7e-80
WP_000917751.1|495666_495864_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	6.1e-29
WP_000024331.1|496015_497065_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.4	4.4e-198
WP_023142244.1|497866_497998_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	1.1e-05
WP_000871291.1|498278_498614_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_016230612.1|498874_500728_+	SASA family carbohydrate esterase	NA	Q08JA2	Stx2-converting_phage	90.3	0.0e+00
WP_000284510.1|500878_501094_+|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000193278.1|501098_501443_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.8e-37
WP_000369850.1|501408_501681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992071.1|501786_502320_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	4.8e-100
WP_032140280.1|502874_502961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012578895.1|503182_503368_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.4	2.7e-18
WP_000736382.1|503453_503669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000095741.1|503867_504068_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	98.5	4.3e-30
WP_000829185.1|504109_504475_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	93.4	2.5e-60
WP_001296023.1|505324_506986_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.7	0.0e+00
WP_000173031.1|507049_508987_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	100.0	0.0e+00
WP_001063099.1|509031_509253_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000267294.1|509198_511784_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	100.0	0.0e+00
WP_000125990.1|511780_512107_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_001007905.1|512116_512467_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|512463_512910_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|512906_513251_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275441.1|513317_514034_+|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	99.6	3.6e-127
WP_000710949.1|514048_514423_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_001513217.1|514518_514728_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_000212991.1|514775_518018_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	91.6	0.0e+00
WP_000807937.1|518010_518352_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	95.6	9.0e-60
WP_001296027.1|518351_519050_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	97.4	5.8e-130
WP_000194730.1|519060_519804_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	4.3e-147
WP_061089814.1|519749_520382_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.6	3.0e-101
WP_000514710.1|520724_524198_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.7	0.0e+00
WP_001298859.1|524838_526380_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_001016257.1|526394_527141_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_071550361.1|527602_530509_+	hypothetical protein	NA	A0A0F7LDR4	Escherichia_phage	45.9	1.1e-118
WP_001164137.1|530524_531052_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	77.7	8.4e-73
WP_000972097.1|531082_531616_-|tail	tail fiber assembly protein	tail	A0A077SL44	Escherichia_phage	70.1	1.8e-67
WP_022645053.1|531617_532403_-	hypothetical protein	NA	Q858V4	Yersinia_virus	77.8	1.3e-109
WP_001421220.1|532630_532813_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	95.0	1.4e-24
WP_000240999.1|533011_533680_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937495.1|533736_534006_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
WP_001348267.1|534417_534975_-	Rha family transcriptional regulator	NA	Q8H9L9	Vibrio_phage	63.8	4.2e-30
WP_001296031.1|534971_535247_-	hypothetical protein	NA	S5MQL6	Escherichia_phage	52.9	1.1e-10
WP_000443082.1|535622_536429_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209513.1|536428_537622_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000763535.1|538994_540590_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001194644.1|540589_542152_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|542243_542288_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285702.1|542425_543307_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|543303_543924_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001296033.1|543951_545847_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291206.1|546059_546935_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_023141019.1|547140_548127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001000715.1|548136_548445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001278898.1|548501_549092_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559273.1|549088_549847_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	4.4e-06
WP_000422062.1|550066_551116_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_001031530.1|551151_551403_-	YciN family protein	NA	NA	NA	NA	NA
WP_001304419.1|551782_554380_+	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.5	7.0e-88
>prophage 31
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	559290	559881	5106662		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176294.1|559290_559881_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 32
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	567693	569628	5106662		Lactococcus_phage(100.0%)	1	NA	NA
WP_000485012.1|567693_569628_-	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	28.1	2.8e-33
>prophage 33
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	578562	580580	5106662		Salmonella_phage(50.0%)	2	NA	NA
WP_000135013.1|578562_579726_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	27.2	5.6e-29
WP_000573407.1|579773_580580_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
>prophage 34
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	599921	601004	5106662		Planktothrix_phage(100.0%)	1	NA	NA
WP_000068009.1|599921_601004_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.2	1.6e-22
>prophage 35
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	618228	618744	5106662		Streptococcus_phage(100.0%)	1	NA	NA
WP_000945011.1|618228_618744_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.1e-24
>prophage 36
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	623516	632935	5106662	tRNA	Bacillus_phage(20.0%)	6	NA	NA
WP_001296045.1|623516_624749_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|625003_625987_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123789.1|626464_627838_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	1.5e-52
WP_001157412.1|627965_628901_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.4	2.2e-145
WP_001295593.1|631226_631661_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_000837933.1|631801_632935_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	54.1	1.5e-103
>prophage 37
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	637894	638884	5106662		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762229.1|637894_638884_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
>prophage 38
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	653771	657674	5106662		Klosneuvirus(100.0%)	1	NA	NA
WP_000139528.1|653771_657674_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	1.7e-53
>prophage 39
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	661627	662576	5106662		Escherichia_phage(50.0%)	2	NA	NA
WP_001531678.1|661627_662158_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_000731859.1|662402_662576_+	hypothetical protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
>prophage 40
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	674426	676388	5106662		Phage_TP(100.0%)	1	NA	NA
WP_012896797.1|674426_676388_+	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	28.6	3.5e-23
>prophage 41
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	680017	681031	5106662		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000220422.1|680017_681031_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.4	4.6e-27
>prophage 42
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	686528	688631	5106662		Salmonella_phage(100.0%)	1	NA	NA
WP_000689332.1|686528_688631_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	66.8	1.9e-136
>prophage 43
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	697594	699139	5106662		Escherichia_phage(100.0%)	1	NA	NA
WP_000702528.1|697594_699139_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 44
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	710384	712142	5106662		Escherichia_phage(50.0%)	2	NA	NA
WP_000781370.1|710384_710669_-	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
WP_000642417.1|711131_712142_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.6	3.3e-25
>prophage 45
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	715546	717946	5106662		Klosneuvirus(100.0%)	1	NA	NA
WP_001296069.1|715546_717946_-	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	21.5	3.5e-09
>prophage 46
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	744249	745668	5106662		Bacillus_phage(100.0%)	1	NA	NA
WP_000558459.1|744249_745668_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.4e-18
>prophage 47
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	752411	752795	5106662		Streptococcus_phage(100.0%)	1	NA	NA
WP_000091198.1|752411_752795_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
>prophage 48
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	755797	756688	5106662		Bacillus_phage(100.0%)	1	NA	NA
WP_000592832.1|755797_756688_-	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	38.3	2.1e-20
>prophage 49
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	761074	775658	5106662		Escherichia_phage(37.5%)	14	NA	NA
WP_000214712.1|761074_761278_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000526709.1|761313_762774_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.8	1.3e-43
WP_000151247.1|762862_764230_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000836081.1|764287_765307_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.3	3.7e-16
WP_001296083.1|765318_766533_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.2	8.2e-47
WP_000598292.1|766738_767065_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705204.1|767199_767541_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138584.1|767575_768136_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001296084.1|768138_768849_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001296085.1|768956_769262_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041660.1|769460_771887_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	1.7e-213
WP_000213028.1|773527_774145_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_000526467.1|774146_775001_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148693.1|775043_775658_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
>prophage 50
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	793421	794723	5106662		Bacillus_phage(100.0%)	1	NA	NA
WP_000732519.1|793421_794723_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.6	2.5e-17
>prophage 51
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	804618	806430	5106662		Vaccinia_virus(100.0%)	1	NA	NA
WP_000945867.1|804618_806430_-	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	99.5	0.0e+00
>prophage 52
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	826511	827786	5106662	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_001295400.1|826511_827786_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 53
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	834697	836196	5106662		Salmonella_phage(50.0%)	2	NA	NA
WP_001296099.1|834697_835219_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	1.7e-46
WP_000250634.1|835299_836196_-	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	2.1e-07
>prophage 54
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	840611	849415	5106662		Streptomyces_phage(20.0%)	9	NA	NA
WP_000101207.1|840611_841439_+	peptidoglycan DD-endopeptidase MepH	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
WP_000007273.1|841566_842148_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	44.8	3.1e-44
WP_000701057.1|842293_843463_-	MFS transporter	NA	NA	NA	NA	NA
WP_000102278.1|843628_843718_-	stress response protein YnhF	NA	NA	NA	NA	NA
WP_000190985.1|844016_845042_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	2.8e-32
WP_000269498.1|845038_845971_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001182336.1|846083_847295_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000098896.1|847585_848734_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	9.3e-85
WP_000493947.1|848773_849415_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
>prophage 55
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	854920	857187	5106662		Edwardsiella_phage(50.0%)	3	NA	NA
WP_000587585.1|854920_855733_-	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	5.0e-08
WP_001070015.1|855736_856522_-	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_001296101.1|856518_857187_-	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.2	1.7e-22
>prophage 56
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	865475	870559	5106662		environmental_halophage(33.33%)	5	NA	NA
WP_000144583.1|865475_866696_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.7	4.4e-93
WP_000907957.1|866692_867964_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000948882.1|867938_868685_-	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	24.0	5.1e-07
WP_001296103.1|868694_870182_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000367158.1|870190_870559_-	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	38.5	5.6e-15
>prophage 57
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	888978	908573	5106662	tRNA	Tupanvirus(22.22%)	19	NA	NA
WP_000553669.1|888978_890679_+	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.7	1.8e-31
WP_000069403.1|890735_893114_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	5.5e-172
WP_000368046.1|893446_894280_+	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_001082226.1|894436_895483_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
WP_001270810.1|895614_895806_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_000175632.1|895809_897246_-	YdiU family protein	NA	NA	NA	NA	NA
WP_001296111.1|897308_898022_-	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_001209785.1|898269_898734_-	endopeptidase	NA	S5MM68	Bacillus_phage	36.9	2.1e-11
WP_000029460.1|898811_899561_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001154187.1|899560_900112_-	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000956533.1|900174_901155_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001229265.1|901255_901555_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000672320.1|901559_903947_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018588.1|903961_904945_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_001386830.1|905228_905273_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|905395_905752_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|905804_906002_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|906098_906641_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144199.1|906644_908573_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.1	1.6e-129
>prophage 58
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	917943	920205	5106662		Tupanvirus(100.0%)	1	NA	NA
WP_000077883.1|917943_920205_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	5.1e-143
>prophage 59
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	926330	927158	5106662		Bacillus_virus(100.0%)	1	NA	NA
WP_000175016.1|926330_927158_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.2	3.5e-73
>prophage 60
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	934634	935855	5106662		Klosneuvirus(100.0%)	1	NA	NA
WP_000082031.1|934634_935855_-	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.6	3.2e-27
>prophage 61
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	942618	943272	5106662		Bacillus_phage(100.0%)	1	NA	NA
WP_001296116.1|942618_943272_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.0	8.7e-11
>prophage 62
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	947662	949618	5106662		Streptococcus_phage(100.0%)	1	NA	NA
WP_001235830.1|947662_949618_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	3.1e-40
>prophage 63
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	955349	959420	5106662		Tupanvirus(50.0%)	4	NA	NA
WP_060667423.1|955349_955976_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	35.1	1.4e-18
WP_001524794.1|956068_957427_-	MFS transporter	NA	NA	NA	NA	NA
WP_000719098.1|957544_958303_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000723696.1|958439_959420_-	NADH-dependent methylglyoxal reductase	NA	A0A2H4PQR8	Staphylococcus_phage	22.0	3.0e-07
>prophage 64
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	968233	969088	5106662		Indivirus(100.0%)	1	NA	NA
WP_001296125.1|968233_969088_-	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	24.6	1.5e-10
>prophage 65
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	972406	976983	5106662		Bacillus_phage(100.0%)	3	NA	NA
WP_000219684.1|972406_973690_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
WP_000621382.1|973836_975312_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_001296127.1|975492_976983_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	6.4e-09
>prophage 66
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	985950	994056	5106662	tRNA	Staphylococcus_phage(33.33%)	8	NA	NA
WP_000758422.1|985950_987636_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
WP_000290577.1|987840_988422_-	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_001220974.1|988461_989157_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000128874.1|989214_991125_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.2	1.7e-91
WP_001295493.1|991256_991601_+	RidA family protein	NA	NA	NA	NA	NA
WP_071525875.1|991962_992322_+	DUF1889 family protein	NA	NA	NA	NA	NA
WP_000457334.1|992441_992621_-	YoaH family protein	NA	NA	NA	NA	NA
WP_000854961.1|992694_994056_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	1.7e-40
>prophage 67
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	997918	999475	5106662		Moraxella_phage(100.0%)	1	NA	NA
WP_000394983.1|997918_999475_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 68
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	1005116	1005326	5106662		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|1005116_1005326_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 69
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	1010658	1012707	5106662		Moraxella_phage(100.0%)	1	NA	NA
WP_001055794.1|1010658_1012707_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
>prophage 70
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	1020202	1024671	5106662		Escherichia_phage(33.33%)	7	NA	NA
WP_000812745.1|1020202_1020859_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	2.3e-56
WP_000976472.1|1021253_1021595_-	YebY family protein	NA	NA	NA	NA	NA
WP_000879317.1|1021607_1022480_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168747.1|1022483_1022858_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|1022996_1023227_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000011664.1|1023328_1023985_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944256.1|1024008_1024671_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
>prophage 71
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	1032727	1034203	5106662		Cyanophage(100.0%)	1	NA	NA
WP_000301727.1|1032727_1034203_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
>prophage 72
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	1038201	1130527	5106662	portal,integrase,transposase,tRNA,plate,capsid,tail,holin,terminase	Escherichia_phage(21.74%)	107	1087978:1088037	1130589:1130713
WP_001184045.1|1038201_1039524_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_001347089.1|1039539_1040472_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202996.1|1040550_1041306_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_000571478.1|1041302_1042088_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_099156422.1|1042281_1043630_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	8.7e-74
WP_000568520.1|1043739_1044750_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580323.1|1044758_1045370_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_072093883.1|1045508_1045574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024911.1|1045644_1046247_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|1046248_1046770_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_000907234.1|1046804_1047545_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_077249130.1|1047573_1048026_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001258676.1|1048018_1049791_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000891625.1|1050100_1050667_+	hydrolase	NA	NA	NA	NA	NA
WP_000639277.1|1050663_1051482_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
WP_000252980.1|1051534_1051930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019588.1|1051970_1052714_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000564759.1|1052710_1053682_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000176764.1|1053717_1056147_-	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_001214293.1|1056171_1057272_-	cytochrome c	NA	NA	NA	NA	NA
WP_001185734.1|1057659_1058406_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001490174.1|1058419_1058986_-	VOC family protein	NA	NA	NA	NA	NA
WP_001025326.1|1059201_1060935_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
WP_001202076.1|1060987_1061380_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_000066973.1|1061379_1063458_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001278946.1|1063450_1064599_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000983600.1|1064787_1065432_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763867.1|1065442_1065832_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036371.1|1065846_1066896_-	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204320.1|1066898_1067759_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_001296146.1|1068049_1069711_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_000147302.1|1069855_1070359_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001531763.1|1070379_1072344_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795641.1|1072348_1073275_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000906342.1|1073271_1074159_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|1074285_1074864_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001295647.1|1074866_1075217_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122413.1|1075996_1076425_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001296148.1|1076431_1077856_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001296149.1|1077830_1078631_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_000987895.1|1078797_1079787_-	arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001187827.1|1079798_1081313_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.7	1.3e-12
WP_000548680.1|1081382_1082372_-	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_000179469.1|1083166_1083670_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000082127.1|1083747_1083999_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|1084113_1084200_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_001237881.1|1084463_1084787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917208.1|1084958_1085456_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377224.1|1085493_1085733_-	YecH family protein	NA	NA	NA	NA	NA
WP_000797555.1|1085923_1087135_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847882.1|1087185_1087851_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
1087978:1088037	attL	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTA	NA	NA	NA	NA
WP_001296152.1|1088322_1088742_-	hypothetical protein	NA	G8C7Q7	Escherichia_phage	68.8	1.8e-49
WP_001531767.1|1089956_1090181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001531768.1|1090342_1090732_-|tail	phage tail protein	tail	E5FFG4	Burkholderia_phage	37.9	1.0e-14
WP_001018353.1|1090767_1092408_-	hypothetical protein	NA	A0A2I7R3J9	Vibrio_phage	29.3	1.2e-19
WP_000444667.1|1092516_1092798_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000785563.1|1092810_1093323_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_000117510.1|1093340_1094843_-|tail	tail sheath protein	tail	R9TMQ0	Vibrio_phage	33.5	5.5e-69
WP_000626358.1|1094839_1095229_-	hypothetical protein	NA	A0A2H4EXG4	Aeromonas_phage	30.8	9.4e-05
WP_000829621.1|1095228_1096413_-|tail	phage tail protein	tail	J9QDX3	Clostridium_phage	35.2	2.5e-16
WP_000203868.1|1096405_1097032_-|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	38.8	2.0e-25
WP_000633314.1|1097034_1097955_-|plate	baseplate assembly protein	plate	D5LGZ3	Escherichia_phage	47.8	6.4e-68
WP_000901289.1|1097951_1098293_-|plate	phage baseplate assembly protein	plate	D4HTV2	Vibrio_phage	51.6	1.1e-20
WP_000079174.1|1098295_1099198_-|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_000015612.1|1099178_1099715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774516.1|1099711_1100392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001531773.1|1100423_1100804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000105179.1|1100800_1101220_-	DNA-packaging protein	NA	NA	NA	NA	NA
WP_001283997.1|1101254_1102289_-|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	56.5	6.6e-106
WP_000206292.1|1102347_1102677_-	hypothetical protein	NA	A0A2R9YJN3	Escherichia_phage	39.5	2.0e-08
WP_001145892.1|1102676_1103984_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	4.9e-106
WP_000126513.1|1103983_1105558_-|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	64.0	8.6e-190
WP_000203897.1|1105554_1105788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000148195.1|1105787_1107650_-|terminase	phage terminase large subunit family protein	terminase	A0A1I9KF19	Aeromonas_phage	53.2	1.1e-191
WP_000168117.1|1107636_1108203_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	46.2	2.9e-31
WP_001531775.1|1108571_1108817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000734931.1|1108876_1109071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000131873.1|1109078_1109558_-	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	68.8	4.6e-62
WP_000172496.1|1109557_1109830_-|holin	phage holin family protein	holin	A0A0A0YPY6	Escherichia_phage	42.9	9.8e-09
WP_001294589.1|1109829_1110213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000064384.1|1110325_1110997_-	antitermination protein	NA	Q7Y3X2	Yersinia_phage	33.5	1.9e-16
WP_000717783.1|1110996_1111290_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	70.5	3.3e-34
WP_000057010.1|1111286_1111883_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	64.1	1.5e-70
WP_001025459.1|1111960_1112140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000847617.1|1112291_1112933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000536919.1|1113176_1113410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000224749.1|1113808_1114297_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A142KB62	Gordonia_phage	42.7	6.4e-27
WP_001138663.1|1114306_1114912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000536231.1|1115374_1116073_-	hypothetical protein	NA	Q858R8	Enterobacteria_phage	91.4	1.5e-117
WP_001237642.1|1117260_1118184_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_001531776.1|1118358_1119147_-	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	69.8	1.1e-39
WP_000661082.1|1119828_1120053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000875806.1|1120049_1120361_-	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	65.7	1.2e-34
WP_000918616.1|1120357_1120594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000214056.1|1120595_1121006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000609322.1|1121044_1122460_-	AAA family ATPase	NA	H9C165	Pectobacterium_phage	66.7	6.6e-173
WP_001023813.1|1122449_1123205_-	hypothetical protein	NA	H9C164	Pectobacterium_phage	68.5	2.4e-41
WP_000943914.1|1123201_1123426_-	hypothetical protein	NA	H9C163	Pectobacterium_phage	54.1	6.1e-17
WP_000431205.1|1123465_1123942_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	48.6	1.9e-23
WP_000360804.1|1124000_1124231_-	transcriptional regulator	NA	H6WRX5	Salmonella_phage	63.2	1.5e-21
WP_001296165.1|1124329_1124743_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	49.1	8.7e-09
WP_000388260.1|1125753_1126074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000151806.1|1126104_1128321_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	35.6	4.7e-101
WP_000100753.1|1128317_1128887_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	49.2	6.1e-37
WP_000916334.1|1128886_1129069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000833838.1|1129278_1129542_+	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	38.0	1.2e-06
WP_001531780.1|1129510_1130527_+|integrase	tyrosine-type recombinase/integrase	integrase	H9C152	Pectobacterium_phage	63.6	1.1e-126
1130589:1130713	attR	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTATCTTTCCCATGGTACCCGGAGCGGGACTTGAACCCGCACAGCGCGAACGCCGAGGGATTTTAAAT	NA	NA	NA	NA
>prophage 73
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	1135903	1136656	5106662		Bacillus_virus(100.0%)	1	NA	NA
WP_001273000.1|1135903_1136656_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	2.9e-26
>prophage 74
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	1148040	1250297	5106662	portal,integrase,transposase,head,protease,capsid,tail,holin,terminase	Escherichia_phage(36.07%)	104	1183547:1183562	1249906:1249921
WP_000334561.1|1148040_1148538_+	hypothetical protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	65.2	7.7e-52
WP_023142167.1|1148419_1148749_-	helix-turn-helix domain-containing protein	NA	A0A1B0VCD8	Salmonella_phage	85.6	4.0e-41
WP_001347174.1|1148771_1149296_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.0	2.2e-33
WP_000879824.1|1149452_1150250_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001310919.1|1150259_1150811_-	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_001070440.1|1150979_1151312_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001274299.1|1151655_1151970_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_000994425.1|1152184_1153843_+	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_000067950.1|1153835_1154831_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_001282677.1|1154823_1155510_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000213308.1|1155509_1156883_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_000807584.1|1156901_1157345_+	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000620069.1|1157341_1158469_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000133106.1|1158573_1159038_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_001295641.1|1159042_1160047_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_001282103.1|1160043_1160457_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_001313947.1|1160459_1160825_+	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001253318.1|1160824_1161562_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_000187358.1|1161571_1161841_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_000983988.1|1161849_1162635_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000103992.1|1162924_1163548_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_071524607.1|1163591_1163834_-	protein DsrB	NA	NA	NA	NA	NA
WP_000844800.1|1163942_1164170_+	peroxide/acid resistance protein YodD	NA	NA	NA	NA	NA
WP_000491527.1|1164465_1165281_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_001531784.1|1165277_1166972_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
WP_000009307.1|1167142_1167325_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_000922683.1|1167403_1168321_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212226.1|1168493_1169414_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000228686.1|1169402_1169873_-	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	48.3	5.2e-34
WP_001157265.1|1169853_1171272_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.1	1.0e-101
WP_001296176.1|1171338_1172034_-	phosphohydrolase	NA	S4W232	Pandoravirus	28.7	1.6e-07
WP_001330593.1|1172073_1172439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824383.1|1173004_1174120_+	outer membrane protein F	NA	Q1MVN1	Enterobacteria_phage	47.4	2.9e-91
WP_000218217.1|1174712_1175564_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000826711.1|1175671_1177030_-	two-component system sensor histidine kinase HprS	NA	NA	NA	NA	NA
WP_001347103.1|1177029_1177701_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_000920127.1|1177833_1178247_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_000740067.1|1178355_1179360_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_001240063.1|1179360_1179996_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_099156434.1|1180079_1181428_-|transposase	IS3-like element IS1397 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.3e-74
WP_001007778.1|1181688_1182339_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_000355363.1|1183422_1183710_-	hypothetical protein	NA	NA	NA	NA	NA
1183547:1183562	attL	TGCCCGAACATTTCGA	NA	NA	NA	NA
WP_000235978.1|1183720_1184425_-|tail	tail fiber domain-containing protein	tail	A0A1X7QGH6	Escherichia_phage	61.7	4.6e-58
WP_000654141.1|1184434_1184716_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	47.8	1.6e-17
WP_001554173.1|1184715_1187094_-|tail	phage tail fiber protein	tail	A0A1X7QGG5	Escherichia_phage	76.1	1.9e-185
WP_000526135.1|1187214_1187673_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	2.9e-13
WP_001228252.1|1187869_1188469_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	92.5	3.4e-102
WP_001554175.1|1188536_1191932_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	88.6	0.0e+00
WP_000741570.1|1191992_1192640_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.2	6.6e-112
WP_000140743.1|1192537_1193281_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	4.1e-150
WP_001152448.1|1193286_1193985_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	94.8	3.8e-129
WP_001330090.1|1193984_1194341_-|tail	tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
WP_000224009.1|1194318_1197546_-|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.7	0.0e+00
WP_071590020.1|1197592_1197853_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	97.7	1.6e-40
WP_001324129.1|1197894_1198281_-|tail	tail assembly protein	tail	A0A1B5FP91	Escherichia_phage	100.0	8.9e-64
WP_000097526.1|1198280_1198985_-	immunoglobulin domain-containing protein	NA	A0A1B5FP82	Escherichia_phage	94.4	3.7e-116
WP_001206306.1|1199045_1199390_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	97.4	1.4e-55
WP_014639219.1|1199386_1199836_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	80.5	1.0e-63
WP_001147814.1|1199832_1200171_-|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	90.2	7.5e-51
WP_000719066.1|1200179_1200497_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	50.5	6.2e-23
WP_000766111.1|1200573_1201791_-|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.6	4.5e-162
WP_000999828.1|1201805_1202405_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	81.0	1.9e-89
WP_000923132.1|1202397_1203624_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	82.6	1.5e-202
WP_001140907.1|1203771_1205529_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	98.9	0.0e+00
WP_001554177.1|1205528_1206011_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	96.9	7.4e-84
WP_001135103.1|1206158_1206509_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	97.4	4.7e-64
WP_000738421.1|1207034_1207328_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_075202333.1|1207418_1207601_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	77.0	2.2e-17
WP_000992101.1|1207817_1208351_-	lysozyme	NA	Q08J98	Stx2-converting_phage	93.8	1.1e-99
WP_000193269.1|1208414_1208765_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.9e-36
WP_000372595.1|1208769_1208985_-|holin	holin	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
WP_000874243.1|1209292_1209481_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	95.2	7.2e-27
WP_023281677.1|1209740_1210076_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_000562553.1|1210356_1210488_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	3.7e-06
WP_021538919.1|1211383_1212205_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.2	1.5e-76
WP_000139998.1|1212219_1212582_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	9.6e-36
WP_001296186.1|1212582_1213641_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.7	7.5e-89
WP_023141427.1|1213642_1213915_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.8	4.2e-12
WP_000813254.1|1214082_1214238_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_011076332.1|1214496_1214715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001224667.1|1215328_1215511_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	96.7	2.0e-26
WP_000761442.1|1215604_1216018_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	4.6e-58
WP_001151210.1|1216018_1216441_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	1.3e-63
WP_000095675.1|1216481_1217444_-	DNA-binding protein	NA	S5FM81	Shigella_phage	56.4	1.4e-70
WP_000693943.1|1217466_1217892_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000391951.1|1217875_1218157_-	hypothetical protein	NA	K7PHA1	Enterobacteria_phage	72.6	6.5e-24
WP_000362153.1|1218257_1218677_+	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_000379575.1|1218942_1219098_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001171947.1|1219257_1219476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296188.1|1219479_1219644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854558.1|1220043_1220232_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001070254.1|1220228_1220420_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_023363203.1|1220512_1222984_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.9	3.8e-59
WP_000096342.1|1223042_1223246_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533615.1|1223245_1224271_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.9	3.4e-102
WP_001311896.1|1224506_1225304_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000060157.1|1225641_1226904_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	38.5	2.6e-72
WP_000703040.1|1227097_1228402_-	yersiniabactin biosynthesis salicylate synthase YbtS	NA	NA	NA	NA	NA
WP_001286284.1|1228429_1229710_-	yersiniabactin-associated zinc MFS transporter YbtX	NA	NA	NA	NA	NA
WP_000654452.1|1229702_1231505_-	yersiniabactin ABC transporter ATP-binding/permease protein YbtQ	NA	W8CYL7	Bacillus_phage	26.5	6.1e-22
WP_001296192.1|1231491_1233204_-	yersiniabactin ABC transporter ATP-binding/permease protein YbtP	NA	W8CYL7	Bacillus_phage	27.0	1.0e-31
WP_000140402.1|1233460_1234420_+	yersiniabactin transcriptional regulator YbtA	NA	NA	NA	NA	NA
WP_000623045.1|1234610_1240718_+	yersiniabactin non-ribosomal peptide synthetase HMWP2	NA	A0A2K9L3I8	Tupanvirus	27.3	1.8e-33
WP_060667424.1|1240805_1250297_+	yersiniabactin polyketide synthase HMWP1	NA	D0R7J2	Paenibacillus_phage	36.8	1.6e-49
1249906:1249921	attR	TGCCCGAACATTTCGA	NA	NA	NA	NA
>prophage 75
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	1277223	1279076	5106662		uncultured_marine_virus(50.0%)	2	NA	NA
WP_000502870.1|1277223_1277868_-	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	50.5	8.2e-54
WP_001542270.1|1277852_1279076_-	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	33.5	2.0e-61
>prophage 76
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	1297112	1298827	5106662	transposase	Escherichia_phage(100.0%)	2	NA	NA
WP_000970353.1|1297112_1297805_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	88.4	1.7e-118
WP_000255956.1|1297804_1298827_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
>prophage 77
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	1302337	1303105	5106662		Bacillus_virus(100.0%)	1	NA	NA
WP_000016207.1|1302337_1303105_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.9	7.5e-14
>prophage 78
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	1310598	1322434	5106662	transposase	Enterobacteria_phage(22.22%)	15	NA	NA
WP_000422741.1|1310598_1311024_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|1311020_1311371_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080200.1|1311401_1313015_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	1.8e-182
WP_000203551.1|1313346_1314252_+	chemotaxis protein	NA	NA	NA	NA	NA
WP_000102633.1|1314248_1315319_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_001542273.1|1315454_1315868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001298859.1|1315982_1317524_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_001016257.1|1317538_1318285_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_000846703.1|1318733_1319144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001542275.1|1319364_1320183_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.6	8.8e-45
WP_001164966.1|1320182_1320428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001542276.1|1320521_1320995_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.1	4.3e-12
WP_001186200.1|1321010_1321487_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692345.1|1321549_1321771_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_000086752.1|1321789_1322434_+	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	32.9	1.8e-24
>prophage 79
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	1326718	1330090	5106662	transposase	Stx2-converting_phage(50.0%)	3	NA	NA
WP_001296209.1|1326718_1327885_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.5	5.9e-228
WP_000980556.1|1328093_1329521_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_001531805.1|1329631_1330090_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.2e-11
>prophage 80
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	1334794	1335694	5106662		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000131782.1|1334794_1335694_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 81
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	1343136	1345956	5106662		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_000704867.1|1343136_1344303_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	52.2	2.2e-110
WP_000043486.1|1344549_1345956_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	2.3e-37
>prophage 82
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	1353237	1359540	5106662		Enterobacteria_phage(66.67%)	6	NA	NA
WP_001100793.1|1353237_1353780_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	61.8	6.0e-50
WP_000857525.1|1353784_1354663_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	6.6e-107
WP_001023641.1|1354720_1355620_-	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	34.8	1.7e-28
WP_000699407.1|1355619_1356705_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	8.8e-101
WP_000183040.1|1357077_1357971_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	3.0e-46
WP_001116066.1|1358145_1359540_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.0	6.3e-19
>prophage 83
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	1365446	1372151	5106662		Bacillus_phage(33.33%)	5	NA	NA
WP_001296216.1|1365446_1366817_-	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.7	1.7e-32
WP_000079263.1|1366921_1368358_-	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.2	1.3e-46
WP_000699670.1|1368360_1369584_-	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_000479831.1|1369580_1370060_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_000048190.1|1371029_1372151_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.5e-132
>prophage 84
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	1376468	1387074	5106662		Catovirus(40.0%)	8	NA	NA
WP_000654487.1|1376468_1377308_-	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A1V0S9B9	Catovirus	28.3	4.1e-05
WP_000137092.1|1377436_1379599_-	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	1.9e-17
WP_000482899.1|1379601_1380045_-	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_000978080.1|1380050_1381190_-	polysaccharide export protein Wza	NA	NA	NA	NA	NA
WP_001296218.1|1381849_1383433_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
WP_001252365.1|1383884_1385738_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_001234767.1|1385759_1386341_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.3e-31
WP_001295424.1|1386432_1387074_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
>prophage 85
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	1391797	1393150	5106662		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_000469704.1|1391797_1393150_+	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	20.9	1.2e-06
>prophage 86
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	1406257	1412531	5106662	tRNA	Bacillus_phage(50.0%)	6	NA	NA
WP_000675176.1|1406257_1407661_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.8	7.0e-34
WP_000137877.1|1407657_1408380_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_000929408.1|1408559_1408892_+	YegP family protein	NA	NA	NA	NA	NA
WP_000476014.1|1409038_1410400_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
WP_001531820.1|1410899_1411217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807341.1|1411631_1412531_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.5	5.7e-13
>prophage 87
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	1421669	1425226	5106662		Serratia_phage(50.0%)	4	NA	NA
WP_000846228.1|1421669_1422674_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
WP_000011972.1|1422670_1423636_+	sugar kinase	NA	NA	NA	NA	NA
WP_000434047.1|1423609_1424356_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001296225.1|1424407_1425226_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.0	2.5e-23
>prophage 88
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	1436652	1438686	5106662	tRNA	Indivirus(100.0%)	1	NA	NA
WP_001296226.1|1436652_1438686_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.4	2.3e-54
>prophage 89
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	1454491	1463936	5106662		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292786.1|1454491_1455628_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	96.7	6.1e-161
WP_001296230.1|1455624_1457628_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001296231.1|1457752_1458214_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001295430.1|1458254_1458725_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|1458771_1459491_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|1459487_1461173_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240408.1|1461394_1462126_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.5	6.3e-111
WP_001216963.1|1462185_1462293_+	protein YohO	NA	NA	NA	NA	NA
WP_000783109.1|1462273_1463005_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569347.1|1463009_1463936_-	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	2.6e-08
>prophage 90
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	1484296	1485817	5106662		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000255034.1|1484296_1485817_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 91
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	1489511	1493297	5106662		Cellulophaga_phage(50.0%)	3	NA	NA
WP_001139613.1|1489511_1490180_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
WP_000425450.1|1490437_1491274_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000489277.1|1491305_1493297_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	2.6e-13
>prophage 92
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	1497365	1498223	5106662		Catovirus(100.0%)	1	NA	NA
WP_000873880.1|1497365_1498223_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	35.0	3.1e-24
>prophage 93
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	1511611	1515912	5106662		Ostreococcus_tauri_virus(50.0%)	4	NA	NA
WP_001296238.1|1511611_1513078_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	30.0	2.3e-43
WP_000198798.1|1513195_1514182_+	zinc-binding GTPase YeiR	NA	NA	NA	NA	NA
WP_001296239.1|1514220_1514934_+	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_000241011.1|1515345_1515912_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
>prophage 94
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	1521666	1529316	5106662		Vibrio_phage(50.0%)	7	NA	NA
WP_000194884.1|1521666_1523256_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	33.6	2.5e-19
WP_000202798.1|1523259_1523604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213379.1|1523937_1525128_-	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	3.8e-20
WP_001234850.1|1525155_1525851_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578064.1|1526000_1527761_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	42.0	4.9e-101
WP_000494186.1|1527885_1528170_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000050789.1|1528308_1529316_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	1.5e-83
>prophage 95
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	1548759	1554555	5106662		Bacillus_phage(25.0%)	5	NA	NA
WP_000422200.1|1548759_1550403_-	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	1.6e-13
WP_000884927.1|1550478_1551129_-	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.4	1.1e-05
WP_000872491.1|1551128_1552193_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	49.5	3.1e-18
WP_000406076.1|1552266_1553322_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000865587.1|1553433_1554555_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	58.8	2.0e-116
>prophage 96
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	1558832	1563675	5106662		Hokovirus(50.0%)	2	NA	NA
WP_000876055.1|1558832_1561682_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.1e-41
WP_001296244.1|1561848_1563675_+	two-component system sensor histidine kinase AtoS	NA	W8CYF6	Bacillus_phage	26.5	2.9e-19
>prophage 97
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	1578598	1592416	5106662		Pseudomonas_phage(33.33%)	8	NA	NA
WP_001281226.1|1578598_1581226_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
WP_000990769.1|1581372_1582095_+	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_012896818.1|1582234_1585993_-	AIDA-I family autotransporter adhesin YfaL/EhaC	NA	A0A2L1IV18	Escherichia_phage	26.6	1.3e-21
WP_001075170.1|1586674_1588960_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.9e-283
WP_000332036.1|1589048_1590179_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	2.5e-175
WP_000135040.1|1590178_1590433_+	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_000301031.1|1590486_1591137_-	lipopolysaccharide kinase InaA	NA	NA	NA	NA	NA
WP_000779086.1|1591339_1592416_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
>prophage 98
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	1598308	1602951	5106662	transposase	Sodalis_phage(50.0%)	5	NA	NA
WP_000140602.1|1598308_1599304_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	56.1	1.8e-68
WP_000150331.1|1599316_1599538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000992982.1|1599578_1600382_-	2-keto-3-deoxy-L-rhamnonate aldolase	NA	NA	NA	NA	NA
WP_001296249.1|1600399_1601689_-	MFS transporter	NA	NA	NA	NA	NA
WP_001296250.1|1601745_1602951_-	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.3	2.7e-26
>prophage 99
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	1606554	1611558	5106662		Tupanvirus(50.0%)	4	NA	NA
WP_000879110.1|1606554_1607157_-	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	41.7	7.5e-09
WP_000012638.1|1607464_1608604_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L0G1	Tupanvirus	29.8	4.2e-29
WP_000461638.1|1608607_1609576_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.5	1.5e-35
WP_000860311.1|1609575_1611558_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	3.1e-19
>prophage 100
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	1646519	1649747	5106662		Salmonella_phage(50.0%)	3	NA	NA
WP_000813854.1|1646519_1647119_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
WP_001012895.1|1647177_1649010_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_001203415.1|1649096_1649747_-	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	27.5	3.6e-09
>prophage 101
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	1660417	1661191	5106662		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_001293592.1|1660417_1661191_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
>prophage 102
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	1665402	1666920	5106662		Mollivirus(100.0%)	1	NA	NA
WP_000334229.1|1665402_1666920_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.2	1.6e-87
>prophage 103
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	1673578	1674715	5106662		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000699128.1|1673578_1674715_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.3	8.5e-22
>prophage 104
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	1700454	1712071	5106662	integrase	Enterobacteria_phage(42.86%)	12	1701519:1701538	1712533:1712552
WP_000368123.1|1700454_1701387_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.7	1.6e-167
1701519:1701538	attL	ATTCCTGCAGGGGACACCAT	NA	NA	NA	NA
WP_000926944.1|1701697_1702873_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	63.0	2.8e-145
WP_000287253.1|1702852_1703803_-	sce7725 family protein	NA	NA	NA	NA	NA
WP_000019149.1|1703824_1704706_-	sce7726 family protein	NA	NA	NA	NA	NA
WP_000783295.1|1705385_1705658_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	50.0	3.2e-20
WP_000856856.1|1705940_1708628_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	35.0	4.2e-112
WP_001063904.1|1708624_1709035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000839713.1|1709027_1709264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001111085.1|1709260_1709851_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	49.2	4.4e-22
WP_000270796.1|1709938_1710943_-	oxidoreductase	NA	F1BUM2	Cronobacter_phage	48.3	1.1e-81
WP_000228221.1|1710965_1711826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000055089.1|1711843_1712071_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	56.1	2.3e-11
1712533:1712552	attR	ATTCCTGCAGGGGACACCAT	NA	NA	NA	NA
>prophage 105
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	1720330	1727907	5106662		Bacillus_phage(50.0%)	4	NA	NA
WP_001531852.1|1720330_1723924_+	acid-sensing system histidine kinase EvgS	NA	W8CYM9	Bacillus_phage	40.0	6.2e-10
WP_001296273.1|1723979_1725125_-	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_000955028.1|1725198_1726143_-	transporter YfdV	NA	NA	NA	NA	NA
WP_001283510.1|1726212_1727907_-	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	1.0e-23
>prophage 106
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	1731596	1732517	5106662		Morganella_phage(100.0%)	1	NA	NA
WP_000484018.1|1731596_1732517_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	55.2	2.2e-76
>prophage 107
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	1736336	1737071	5106662		Clostridioides_phage(100.0%)	1	NA	NA
WP_001296275.1|1736336_1737071_+	two-component system response regulator YpdB	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	2.7e-13
>prophage 108
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	1762609	1784337	5106662		Streptococcus_phage(25.0%)	22	NA	NA
WP_000443709.1|1762609_1764625_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.4	5.0e-150
WP_001296279.1|1764695_1765694_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000254839.1|1765923_1766685_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_000034402.1|1766869_1767841_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000487600.1|1768224_1768482_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000623108.1|1768526_1770254_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
WP_000522247.1|1770294_1770804_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000096640.1|1770846_1771698_-	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_000719965.1|1771802_1772171_+	YfeK family protein	NA	NA	NA	NA	NA
WP_000105467.1|1772173_1773085_-	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.9	1.6e-58
WP_000021034.1|1773219_1774317_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G9BWD6	Planktothrix_phage	39.4	2.8e-30
WP_000852686.1|1774306_1775182_-	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_000458408.1|1775181_1776015_-	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_000290263.1|1776014_1777031_-	thiosulfate/sulfate ABC transporter substrate-binding protein CysP	NA	NA	NA	NA	NA
WP_000517443.1|1777188_1777980_-	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.0	6.8e-18
WP_001175628.1|1778259_1779156_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_001040496.1|1779159_1780584_+	PTS N-acetylmuramic acid transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000084590.1|1780761_1781661_-	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
WP_000838953.1|1781756_1782332_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_001296281.1|1782392_1782842_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000406012.1|1782828_1783254_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_000102910.1|1783467_1784337_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	3.2e-13
>prophage 109
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	1802991	1803942	5106662		Cyanophage(100.0%)	1	NA	NA
WP_001003709.1|1802991_1803942_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 110
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	1821182	1821896	5106662		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|1821182_1821896_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 111
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	1829374	1833376	5106662		Enterobacteria_phage(33.33%)	4	NA	NA
WP_000198327.1|1829374_1830664_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.1	8.6e-63
WP_001295473.1|1830749_1831376_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001296287.1|1831700_1832738_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.8e-71
WP_001028626.1|1832737_1833376_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	2.4e-29
>prophage 112
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	1839623	1846094	5106662		Escherichia_phage(66.67%)	7	NA	NA
WP_000017548.1|1839623_1839776_-	hypothetical protein	NA	G9L6F3	Escherichia_phage	90.0	7.1e-17
WP_000076001.1|1839793_1839985_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
WP_001311989.1|1840286_1840805_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	2.9e-62
WP_000755178.1|1840820_1841360_+	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	98.9	1.4e-43
WP_000138282.1|1841452_1843030_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_001296289.1|1843098_1844565_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.9	8.8e-88
WP_000937876.1|1844726_1846094_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	41.2	2.3e-45
>prophage 113
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	1866586	1867018	5106662		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000963841.1|1866586_1867018_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	4.8e-18
>prophage 114
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	1876903	1883241	5106662		Mycoplasma_phage(20.0%)	8	NA	NA
WP_000133610.1|1876903_1878187_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	2.9e-34
WP_000523612.1|1878245_1878446_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_001124471.1|1878457_1878793_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_001196613.1|1878794_1880645_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
WP_000384413.1|1880661_1881177_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_000028953.1|1881272_1881596_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000331707.1|1881612_1881999_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_001295373.1|1882026_1883241_-	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
>prophage 115
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	1893226	1894756	5106662		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000493440.1|1893226_1894756_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	22.6	7.0e-11
>prophage 116
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	1900514	1911823	5106662		Bacillus_phage(50.0%)	7	NA	NA
WP_000919159.1|1900514_1901768_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
WP_000883165.1|1902096_1903287_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000717694.1|1903331_1903670_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_001296298.1|1903730_1905065_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_001215903.1|1905054_1905768_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001296299.1|1905932_1907360_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	3.9e-16
WP_001531893.1|1907935_1911823_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	58.9	1.1e-129
>prophage 117
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	1915942	1916203	5106662		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001196297.1|1915942_1916203_+	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	3.8e-18
>prophage 118
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	1919662	1923404	5106662		Tetraselmis_virus(50.0%)	3	NA	NA
WP_001068343.1|1919662_1920343_-	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
WP_000002542.1|1920614_1921589_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790159.1|1921604_1923404_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.6	3.2e-23
>prophage 119
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	1929175	1935258	5106662	tRNA	Cafeteria_roenbergensis_virus(25.0%)	7	NA	NA
WP_000219193.1|1929175_1930510_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001296304.1|1930542_1931424_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189207.1|1931526_1932114_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627804.1|1932169_1932553_-	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	70.9	4.7e-33
WP_001262723.1|1932857_1933547_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	2.1e-55
WP_000997384.1|1933594_1934632_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|1934838_1935258_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
>prophage 120
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	1940551	1941850	5106662		Burkholderia_virus(100.0%)	1	NA	NA
WP_000852119.1|1940551_1941850_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	31.5	2.4e-44
>prophage 121
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	1947635	1950209	5106662		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001235102.1|1947635_1950209_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
>prophage 122
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	1956114	1957185	5106662		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001168045.1|1956114_1957185_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
>prophage 123
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	1970815	1971298	5106662		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000162574.1|1970815_1971298_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
>prophage 124
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	1976308	1980359	5106662		Klosneuvirus(50.0%)	4	NA	NA
WP_000625041.1|1976308_1977589_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.3	3.8e-34
WP_001296312.1|1977825_1979226_+	GABA permease	NA	NA	NA	NA	NA
WP_000156817.1|1979246_1979909_+	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_000522415.1|1979909_1980359_-	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
>prophage 125
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	1984293	1989590	5106662		Oenococcus_phage(20.0%)	5	NA	NA
WP_001223227.1|1984293_1984539_+	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
WP_000080961.1|1984535_1984946_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	43.5	3.9e-17
WP_000246582.1|1984918_1987063_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.5	2.9e-196
WP_000777934.1|1987072_1988032_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	72.4	1.4e-134
WP_000985509.1|1988387_1989590_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
>prophage 126
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	2004331	2009718	5106662	tRNA	Vibrio_phage(25.0%)	5	NA	NA
WP_000906486.1|2004331_2004517_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000047157.1|2004751_2007382_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.4	9.3e-80
WP_000140501.1|2007510_2008011_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000963143.1|2008079_2009141_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_000140273.1|2009220_2009718_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.7	9.8e-31
>prophage 127
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	2015501	2016467	5106662		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001287403.1|2015501_2016467_+	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	34.6	2.7e-37
>prophage 128
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	2040471	2047611	5106662		Escherichia_phage(83.33%)	6	NA	NA
WP_000103863.1|2040471_2043033_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	1.6e-31
WP_001141293.1|2043138_2043795_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.1	3.3e-50
WP_001272542.1|2043845_2044643_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.0	2.2e-69
WP_000847996.1|2044808_2045717_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.2	1.9e-117
WP_000590411.1|2045713_2046976_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_001279004.1|2046972_2047611_+	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.4e-82
>prophage 129
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	2051977	2055692	5106662		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000081550.1|2051977_2052970_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272593.1|2053032_2054172_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|2054310_2054937_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|2054930_2055692_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 130
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	2058802	2060835	5106662		Tupanvirus(50.0%)	2	NA	NA
WP_001173651.1|2058802_2059408_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	1.9e-28
WP_001090370.1|2059407_2060835_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	31.4	9.7e-31
>prophage 131
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	2075486	2076272	5106662		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_000021342.1|2075486_2076272_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	6.5e-21
>prophage 132
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	2083572	2091020	5106662		Bacillus_phage(25.0%)	6	NA	NA
WP_012896831.1|2083572_2084982_+	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	22.9	1.9e-15
WP_001232702.1|2085007_2086015_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001199974.1|2086099_2086771_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	3.0e-14
WP_001268442.1|2087064_2087937_+	YgcG family protein	NA	NA	NA	NA	NA
WP_000036723.1|2087996_2089295_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
WP_000210878.1|2089382_2091020_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
>prophage 133
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	2094416	2098531	5106662		Erysipelothrix_phage(50.0%)	2	NA	NA
WP_000046817.1|2094416_2095718_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	29.8	2.0e-38
WP_060667426.1|2095774_2098531_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.4	4.1e-54
>prophage 134
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	2106063	2106912	5106662		Vibrio_phage(100.0%)	1	NA	NA
WP_000100405.1|2106063_2106912_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	6.1e-41
>prophage 135
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	2111680	2112526	5106662		Bacillus_phage(100.0%)	1	NA	NA
WP_001214578.1|2111680_2112526_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	1.2e-09
>prophage 136
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	2124102	2126608	5106662	tRNA	environmental_halophage(50.0%)	3	NA	NA
WP_001296332.1|2124102_2125308_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	37.2	4.6e-74
WP_000184272.1|2125307_2125751_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_000117716.1|2125801_2126608_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	2.9e-16
>prophage 137
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	2135441	2146485	5106662		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_000147344.1|2135441_2138078_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.4	3.2e-96
WP_001576295.1|2138089_2140414_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.0	1.9e-15
WP_000587242.1|2140425_2142789_+	hypothetical protein	NA	A7IYC3	Corynebacterium_phage	27.3	8.8e-05
WP_001531916.1|2142785_2143643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021543768.1|2144106_2146485_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.0	1.9e-15
>prophage 138
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	2149850	2152364	5106662		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000354273.1|2149850_2152364_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	45.3	4.1e-08
>prophage 139
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	2156651	2158954	5106662	transposase	Acidithiobacillus_phage(50.0%)	2	NA	NA
WP_001298859.1|2156651_2158193_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_001016257.1|2158207_2158954_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
>prophage 140
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	2170235	2171851	5106662		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_001296341.1|2170235_2171183_-	phosphoglycerate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	25.2	5.8e-16
WP_001066226.1|2171254_2171851_-	SIS domain-containing protein	NA	A0A2P0VNK5	Tetraselmis_virus	33.5	1.8e-23
>prophage 141
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	2175722	2186870	5106662		Bacillus_phage(25.0%)	5	NA	NA
WP_000016907.1|2175722_2176976_-	N-acetylmuramoyl-L-alanine amidase AmiC	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_000237953.1|2177207_2178539_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_000775933.1|2178620_2180447_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.6	3.0e-24
WP_001296343.1|2180446_2183989_-	exodeoxyribonuclease V subunit beta	NA	G3MA40	Bacillus_virus	21.6	5.2e-09
WP_001138102.1|2183981_2186870_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.5	1.2e-67
>prophage 142
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	2192347	2199120	5106662		Geobacillus_virus(33.33%)	6	NA	NA
WP_000816232.1|2192347_2193142_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
WP_000204658.1|2193148_2194024_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000957911.1|2194174_2196421_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000564489.1|2196433_2196964_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000082183.1|2197648_2198338_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000895624.1|2198406_2199120_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
>prophage 143
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	2208751	2211246	5106662		Aichi_virus(50.0%)	2	NA	NA
WP_000256426.1|2208751_2210170_-	arabinose-proton symporter AraE	NA	O13311	Aichi_virus	26.9	1.8e-24
WP_000603518.1|2210484_2211246_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	7.7e-19
>prophage 144
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	2215532	2216288	5106662		Clostridium_phage(100.0%)	1	NA	NA
WP_001272558.1|2215532_2216288_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
>prophage 145
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	2240566	2255958	5106662	tRNA	environmental_Halophage(14.29%)	14	NA	NA
WP_001280189.1|2240566_2241967_+	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
WP_001296347.1|2241984_2243301_+	guanine deaminase	NA	NA	NA	NA	NA
WP_000012167.1|2243336_2244704_+	guanine/hypoxanthine transporter GhxQ	NA	A0A0R6PHV4	Moraxella_phage	73.1	9.5e-161
WP_000838415.1|2244739_2245228_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_001363023.1|2245227_2247147_-	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_001296348.1|2247582_2249031_+	urate/proton symporter UacT	NA	Q9KX94	Enterobacteria_phage	26.8	2.1e-25
WP_001050745.1|2249032_2249158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795390.1|2249154_2249226_-	protein YqfH	NA	NA	NA	NA	NA
WP_001192798.1|2249280_2249829_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_000003071.1|2249871_2251389_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
WP_096489949.1|2251398_2252497_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000813195.1|2252587_2254321_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.5	4.1e-60
WP_000715230.1|2254326_2255037_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000806638.1|2255061_2255958_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
>prophage 146
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	2259763	2264236	5106662		Pandoravirus(50.0%)	2	NA	NA
WP_001296350.1|2259763_2261197_+	6-phospho-beta-glucosidase BglA	NA	A0A0B5JD41	Pandoravirus	26.3	1.1e-31
WP_000195012.1|2261362_2264236_-	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.1	3.7e-263
>prophage 147
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	2272372	2273605	5106662		Catovirus(100.0%)	1	NA	NA
WP_001151604.1|2272372_2273605_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 148
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	2287112	2287790	5106662		Bacillus_virus(100.0%)	1	NA	NA
WP_000956881.1|2287112_2287790_+	sulfate/molybdate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.2	4.9e-09
>prophage 149
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	2293492	2362408	5106662	protease,integrase,transposase,tRNA	Enterobacteria_phage(20.0%)	58	2298085:2298102	2360902:2360919
WP_000646924.1|2293492_2294401_+	prohibitin family protein	NA	A0A2C9D0H9	Yersinia_phage	55.7	4.4e-53
WP_000098615.1|2294607_2296599_-	transketolase	NA	NA	NA	NA	NA
WP_001296354.1|2296876_2297635_+|protease	metalloprotease LoiP	protease	NA	NA	NA	NA
WP_000105562.1|2298064_2298985_-	agmatinase	NA	NA	NA	NA	NA
2298085:2298102	attL	CCTGAATATACAGCATCT	NA	NA	NA	NA
WP_000758881.1|2299120_2299852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295380.1|2299997_2301974_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_001297406.1|2301982_2302114_-	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_001331575.1|2302249_2302465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001062128.1|2302768_2303923_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
WP_001112301.1|2304358_2305753_+	galactose/proton symporter	NA	NA	NA	NA	NA
WP_001296359.1|2305829_2306327_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_000286500.1|2306421_2307129_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001222509.1|2307208_2307940_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000593274.1|2307952_2308903_+	glutathione synthase	NA	NA	NA	NA	NA
WP_000126441.1|2308939_2309575_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000017111.1|2309574_2309991_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001296360.1|2310105_2311086_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000997795.1|2311103_2311808_+	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001094831.1|2311825_2312392_+	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_001277229.1|2312388_2312679_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174754.1|2312686_2313280_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_000239963.1|2313272_2314409_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_000783999.1|2314723_2315710_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000577034.1|2315754_2316258_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_000378955.1|2316257_2317559_+	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_000745240.1|2317614_2318622_-	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000394132.1|2318738_2319785_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000984796.1|2319960_2320680_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_001296361.1|2320700_2320841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001107566.1|2320863_2321190_-	YggL family protein	NA	NA	NA	NA	NA
WP_000786911.1|2321189_2321909_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001296362.1|2322069_2323122_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000091700.1|2323149_2323425_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_000760323.1|2323489_2324569_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_001296363.1|2324770_2326027_+	nucleoside permease NupG	NA	NA	NA	NA	NA
WP_000839781.1|2326075_2328211_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_000234526.1|2328603_2329311_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_001218869.1|2329689_2330955_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.1	2.1e-77
WP_000147017.1|2331210_2332254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001774069.1|2333947_2334499_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000006213.1|2336990_2337224_+	Major pilus subunit operon regulatory protein	NA	NA	NA	NA	NA
WP_023146305.1|2337690_2337906_+	hypothetical protein	NA	A0A0N7C1Y0	Escherichia_phage	85.2	1.7e-27
WP_099156432.1|2337874_2339001_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	96.6	2.5e-146
WP_001513409.1|2339091_2339205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001110186.1|2341038_2341299_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000109147.1|2341340_2341901_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001296373.1|2341940_2342369_+	DUF417 family protein	NA	NA	NA	NA	NA
WP_000074472.1|2343086_2344280_-	MFS transporter	NA	NA	NA	NA	NA
WP_001296374.1|2344415_2346140_+	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_001287500.1|2346140_2347088_+	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_001015715.1|2347087_2348830_+	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_000750130.1|2348826_2350104_+	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_000973516.1|2350185_2352387_+	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_060667427.1|2353330_2357218_+|protease	serine protease autotransporter toxin Sat	protease	Q9LA58	Enterobacterial_phage	38.9	2.0e-227
WP_000080195.1|2358252_2359866_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_000624722.1|2359896_2360247_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422741.1|2360243_2360669_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_032212789.1|2361553_2362408_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.4	1.2e-68
2360902:2360919	attR	CCTGAATATACAGCATCT	NA	NA	NA	NA
>prophage 150
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	2368258	2373215	5106662	transposase	Acinetobacter_phage(33.33%)	3	NA	NA
WP_001223344.1|2368258_2370349_-	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
WP_096928816.1|2370848_2372077_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	94.4	7.2e-168
WP_000274668.1|2372228_2373215_-	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	57.7	4.0e-108
>prophage 151
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	2377780	2385228	5106662	transposase	Stx2-converting_phage(50.0%)	6	NA	NA
WP_000376547.1|2377780_2379253_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	22.7	2.2e-06
WP_001149834.1|2380211_2381129_-	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_085949591.1|2381280_2381418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000435655.1|2381789_2382215_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	74.2	3.6e-34
WP_000624646.1|2382211_2382562_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	62.1	5.4e-36
WP_000997995.1|2383689_2385228_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	93.9	1.2e-281
>prophage 152
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	2400115	2402913	5106662		Pseudomonas_phage(50.0%)	5	NA	NA
WP_001234620.1|2400115_2400934_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.2	2.0e-44
WP_000849566.1|2400988_2401474_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.8	7.6e-12
WP_001186726.1|2401489_2401966_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692329.1|2402028_2402250_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_000094916.1|2402268_2402913_+	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	32.6	1.2e-25
>prophage 153
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	2410642	2411626	5106662		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001296394.1|2410642_2411626_+	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	31.7	6.2e-37
>prophage 154
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	2458404	2459577	5106662		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000524942.1|2458404_2459577_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	31.0	7.2e-40
>prophage 155
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	2481752	2482637	5106662		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000018758.1|2481752_2482637_+	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.7e-65
>prophage 156
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	2488480	2495799	5106662		Staphylococcus_phage(33.33%)	6	NA	NA
WP_000013152.1|2488480_2489308_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	1.6e-62
WP_000691604.1|2489507_2490434_+	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_000848528.1|2490484_2490742_+	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_000095204.1|2490783_2493003_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
WP_000438655.1|2493254_2494004_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001296416.1|2494326_2495799_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	32.7	4.5e-47
>prophage 157
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	2503257	2508297	5106662		Bacillus_virus(50.0%)	4	NA	NA
WP_001281848.1|2503257_2505516_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	34.9	3.1e-84
WP_001296417.1|2505653_2507261_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000183485.1|2507369_2507852_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000712658.1|2507904_2508297_-	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
>prophage 158
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	2517119	2517929	5106662		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_000940874.1|2517119_2517929_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.4	2.7e-14
>prophage 159
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	2524283	2528584	5106662		Vibrio_phage(33.33%)	4	NA	NA
WP_000917117.1|2524283_2524913_-	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	9.2e-18
WP_000735289.1|2525117_2526599_+	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000831543.1|2526746_2527418_+	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_000442882.1|2527423_2528584_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	42.9	7.7e-87
>prophage 160
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	2539823	2540477	5106662		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001076989.1|2539823_2540477_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	8.3e-46
>prophage 161
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	2544390	2545824	5106662		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000869177.1|2544390_2545824_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	3.0e-40
>prophage 162
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	2550961	2552200	5106662	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_000708473.1|2550961_2552200_+|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.0	3.8e-92
>prophage 163
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	2558500	2574648	5106662	tRNA	Moraxella_phage(16.67%)	12	NA	NA
WP_001264377.1|2558500_2559514_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	9.7e-110
WP_001144069.1|2559751_2559967_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918810.1|2560077_2561823_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.9e-76
WP_000437380.1|2562017_2563859_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000228937.1|2563936_2564443_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001066500.1|2564696_2565461_-	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_000017999.1|2565748_2566372_+	DNA-binding transcriptional regulator NfeR	NA	NA	NA	NA	NA
WP_000094714.1|2566478_2567999_-	aerotaxis sensor receptor Aer	NA	A0A1B0V854	Salmonella_phage	51.5	4.0e-35
WP_000633381.1|2568305_2569796_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	4.8e-33
WP_000450588.1|2569837_2570170_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_000212450.1|2570388_2571372_+	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_001082927.1|2571555_2574648_+	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.4	2.6e-158
>prophage 164
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	2587303	2588269	5106662		Escherichia_phage(100.0%)	1	NA	NA
WP_001098827.1|2587303_2588269_+	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 165
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	2605582	2611627	5106662	transposase	Shigella_phage(50.0%)	4	NA	NA
WP_085949154.1|2605582_2606729_+|transposase	IS3-like element ISEc52 family transposase	transposase	Q716C2	Shigella_phage	96.3	2.4e-173
WP_000622122.1|2607493_2608858_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_000719990.1|2608929_2609319_-	enamine/imine deaminase	NA	NA	NA	NA	NA
WP_000861714.1|2609332_2611627_-	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	41.1	2.0e-158
>prophage 166
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	2617781	2618927	5106662		Streptococcus_phage(100.0%)	1	NA	NA
WP_001296434.1|2617781_2618927_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.6	9.7e-50
>prophage 167
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	2636547	2644343	5106662		Streptococcus_phage(25.0%)	10	NA	NA
WP_000809258.1|2636547_2637411_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	9.6e-50
WP_000249175.1|2637475_2639512_+	penicillin-binding protein activator LpoA	NA	NA	NA	NA	NA
WP_000246833.1|2639469_2639865_+	YraN family protein	NA	NA	NA	NA	NA
WP_001158035.1|2639884_2640475_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_000646033.1|2640484_2641060_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_000147602.1|2641172_2642213_-	permease	NA	NA	NA	NA	NA
WP_001296438.1|2642285_2642921_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_001296439.1|2643048_2643567_+	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.6	4.4e-10
WP_000449450.1|2643546_2643990_-	YhbP family protein	NA	NA	NA	NA	NA
WP_000189328.1|2644040_2644343_+	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	52.5	3.9e-14
>prophage 168
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	2650045	2651935	5106662		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001295553.1|2650045_2651935_-	ATP-dependent RNA helicase DeaD	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 169
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	2657415	2664054	5106662		Cafeteria_roenbergensis_virus(50.0%)	4	NA	NA
WP_000133040.1|2657415_2660088_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	3.3e-24
WP_001031057.1|2660112_2661600_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_001300397.1|2661627_2662080_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_000207680.1|2662710_2664054_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
>prophage 170
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	2668134	2671007	5106662	protease	Pandoravirus(50.0%)	2	NA	NA
WP_000764749.1|2668134_2668983_-	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.6	7.5e-23
WP_001107467.1|2669072_2671007_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
>prophage 171
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	2677636	2679119	5106662		Indivirus(50.0%)	2	NA	NA
WP_001047336.1|2677636_2678608_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
WP_000445413.1|2678840_2679119_+	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	2.6e-17
>prophage 172
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	2683187	2697981	5106662		Staphylococcus_phage(25.0%)	17	NA	NA
WP_000438245.1|2683187_2683997_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
WP_000922880.1|2684206_2685184_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_001295557.1|2685197_2686184_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_000030016.1|2686204_2686771_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
WP_000030537.1|2686767_2687343_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000669785.1|2687311_2687869_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000224099.1|2687875_2688601_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000809051.1|2688648_2690082_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_001176599.1|2690104_2690392_+	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_000183674.1|2690509_2691001_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_000243741.1|2691046_2691901_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000216791.1|2691897_2692170_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000620405.1|2692382_2693015_+	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000047069.1|2693011_2693740_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_000719791.1|2693736_2694390_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000809780.1|2694619_2696956_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_001296449.1|2697051_2697981_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
>prophage 173
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	2706684	2710695	5106662	protease	Burkholderia_virus(50.0%)	4	NA	NA
WP_000108477.1|2706684_2708175_-	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.9	4.9e-09
WP_000224714.1|2708283_2709177_-	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_000074796.1|2709298_2710090_-	transcriptional regulator NanR	NA	NA	NA	NA	NA
WP_000366127.1|2710197_2710695_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	2.5e-26
>prophage 174
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	2714662	2716030	5106662	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001296452.1|2714662_2716030_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	26.0	1.7e-21
>prophage 175
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	2733675	2734719	5106662		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|2733675_2734719_-	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 176
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	2744004	2748516	5106662		Organic_Lake_phycodnavirus(50.0%)	4	NA	NA
WP_000132912.1|2744004_2745504_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.8	1.4e-11
WP_001296455.1|2745564_2746455_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000275542.1|2746490_2747345_-	tagatose bisphosphate family class II aldolase	NA	NA	NA	NA	NA
WP_000843962.1|2747685_2748516_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.0	1.2e-09
>prophage 177
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	2753852	2754737	5106662		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001258951.1|2753852_2754737_+	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.2	9.2e-24
>prophage 178
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	2761241	2765395	5106662		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000738587.1|2761241_2762267_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	1.8e-71
WP_001120549.1|2762334_2763516_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_001296459.1|2763525_2764629_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000078344.1|2764636_2765395_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.2e-19
>prophage 179
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	2775735	2777207	5106662	tRNA	Synechococcus_phage(50.0%)	2	NA	NA
WP_000114984.1|2775735_2776245_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.9e-19
WP_000004421.1|2776259_2777207_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
>prophage 180
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	2798431	2800384	5106662		Vibrio_phage(100.0%)	1	NA	NA
WP_001525807.1|2798431_2800384_+	type II secretion system secretin GspD	NA	R9TEZ5	Vibrio_phage	30.9	1.2e-31
>prophage 181
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	2809209	2817776	5106662		uncultured_Caudovirales_phage(40.0%)	8	NA	NA
WP_000773180.1|2809209_2811912_-	bifunctional chitinase/lysozyme	NA	M1HC48	Acanthocystis_turfacea_Chlorella_virus	35.7	2.0e-40
WP_000031783.1|2812203_2813388_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_060667429.1|2813458_2815573_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	1.2e-56
WP_001138043.1|2815669_2816140_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000246815.1|2816236_2816611_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_000903381.1|2816736_2817024_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000820731.1|2817030_2817390_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	31.0	1.4e-10
WP_001209693.1|2817389_2817776_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.8	2.5e-18
>prophage 182
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	2823346	2832887	5106662		Tupanvirus(25.0%)	9	NA	NA
WP_000634830.1|2823346_2825260_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	4.3e-74
WP_000057364.1|2825259_2826282_+	hydrolase	NA	NA	NA	NA	NA
WP_000907085.1|2826275_2826494_+	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
WP_001274684.1|2826547_2827417_+	phosphoribulokinase	NA	NA	NA	NA	NA
WP_001148908.1|2827471_2827876_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000242755.1|2828177_2828810_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_001296470.1|2828860_2830951_+	membrane protein	NA	H9YQA8	environmental_Halophage	99.3	2.9e-76
WP_000963794.1|2831017_2832238_-	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_000601853.1|2832323_2832887_-	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	56.3	7.1e-62
>prophage 183
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	2851801	2852638	5106662		Vibrio_phage(100.0%)	1	NA	NA
WP_000742141.1|2851801_2852638_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	2.9e-67
>prophage 184
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	2867499	2874880	5106662	transposase	Bacillus_phage(50.0%)	5	NA	NA
WP_000826444.1|2867499_2868708_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.8	4.9e-209
WP_000370859.1|2869010_2870735_-	DUF4153 domain-containing protein	NA	NA	NA	NA	NA
WP_001265681.1|2871112_2872735_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.5	5.3e-142
WP_001253709.1|2872811_2874164_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
WP_001157751.1|2874160_2874880_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
>prophage 185
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	2881470	2881881	5106662	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_023908544.1|2881470_2881881_+|transposase	transposase	transposase	Q2A0A7	Sodalis_phage	42.5	9.3e-11
>prophage 186
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	2887918	2890312	5106662		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_000081885.1|2887918_2890312_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	41.4	7.3e-15
>prophage 187
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	2901286	2903734	5106662		Dickeya_phage(100.0%)	1	NA	NA
WP_000993445.1|2901286_2903734_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 188
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	2914063	2916160	5106662		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_001296481.1|2914063_2916160_-	RecQ family ATP-dependent DNA helicase	NA	F2NZ48	Diadromus_pulchellus_ascovirus	34.7	6.1e-42
>prophage 189
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	2924416	2926227	5106662		Enterococcus_phage(50.0%)	2	NA	NA
WP_000073605.1|2924416_2925160_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	24.8	1.1e-09
WP_000907823.1|2925156_2926227_-	sn-glycerol 3-phosphate ABC transporter ATP binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
>prophage 190
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	2929768	2931251	5106662		Planktothrix_phage(50.0%)	2	NA	NA
WP_000416895.1|2929768_2930482_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	9.1e-14
WP_000082099.1|2930483_2931251_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
>prophage 191
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	2937730	2940549	5106662		Salicola_phage(50.0%)	3	NA	NA
WP_000130217.1|2937730_2938585_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
WP_001042013.1|2938829_2939888_-	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000617723.1|2939880_2940549_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
>prophage 192
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	2943555	2947676	5106662		Dickeya_phage(50.0%)	4	NA	NA
WP_000964718.1|2943555_2944182_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
WP_000106599.1|2944255_2946454_+	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.1	1.9e-118
WP_000130621.1|2946555_2946801_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_001100463.1|2947010_2947676_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.6	7.4e-58
>prophage 193
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	2955569	2956376	5106662		Bacillus_virus(100.0%)	1	NA	NA
WP_000173684.1|2955569_2956376_+	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	28.7	7.6e-17
>prophage 194
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	2963814	2966550	5106662		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000972087.1|2963814_2966550_-	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	4.1e-22
>prophage 195
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	2976237	2981646	5106662		Indivirus(50.0%)	5	NA	NA
WP_001296496.1|2976237_2978280_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.2	4.0e-46
WP_001296497.1|2978482_2979325_+	23S rRNA (adenine(2030)-N(6))-methyltransferase	NA	NA	NA	NA	NA
WP_000160794.1|2979396_2980749_+	glutathione-disulfide reductase	NA	NA	NA	NA	NA
WP_023363328.1|2980802_2980886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000065754.1|2981220_2981646_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	69.3	1.4e-49
>prophage 196
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	2992317	2993787	5106662		Pithovirus(50.0%)	2	NA	NA
WP_000622316.1|2992317_2993088_+	heme ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	29.6	2.3e-18
WP_000123131.1|2993139_2993787_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	40.0	8.0e-17
>prophage 197
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	3040690	3042675	5106662		Bacillus_virus(50.0%)	2	NA	NA
WP_000103571.1|3040690_3041695_-	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	8.6e-18
WP_001196477.1|3041691_3042675_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	6.7e-15
>prophage 198
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	3052719	3055053	5106662		Escherichia_phage(100.0%)	1	NA	NA
WP_000013977.1|3052719_3055053_-	biotin sulfoxide reductase	NA	A0A077SK27	Escherichia_phage	29.5	2.4e-71
>prophage 199
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	3058707	3058920	5106662		Morganella_phage(100.0%)	1	NA	NA
WP_000014594.1|3058707_3058920_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 200
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	3063140	3064136	5106662		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001182627.1|3063140_3064136_+	O-acetyltransferase WecH	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	27.4	5.4e-12
>prophage 201
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	3069453	3070995	5106662		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001146503.1|3069453_3070995_+	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	1.1e-16
>prophage 202
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	3095043	3099655	5106662		Clostridioides_phage(50.0%)	3	NA	NA
WP_000985737.1|3095043_3096339_-	Fic family protein	NA	A0A1V0E025	Clostridioides_phage	30.9	2.8e-21
WP_000741500.1|3096468_3097620_-	L-threonine dehydrogenase	NA	NA	NA	NA	NA
WP_000587626.1|3097810_3099655_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	27.2	4.3e-15
>prophage 203
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	3121363	3130868	5106662		Rhizobium_phage(16.67%)	9	NA	NA
WP_000024392.1|3121363_3121615_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
WP_001156181.1|3121755_3122187_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_001296527.1|3122430_3123975_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001214150.1|3123984_3125268_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_000483825.1|3125271_3126231_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000982097.1|3126217_3127252_-	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	5.8e-09
WP_000646014.1|3127490_3128516_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_001213854.1|3128525_3129722_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.0	1.4e-35
WP_000587750.1|3129935_3130868_+	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	8.5e-36
>prophage 204
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	3145768	3150331	5106662		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_001171854.1|3145768_3146248_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.6	6.3e-27
WP_001114533.1|3146286_3147096_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.2	2.6e-25
WP_001051798.1|3147193_3147361_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000091955.1|3147381_3147618_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001296533.1|3147834_3148503_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_000050112.1|3148674_3149895_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.9	3.2e-43
WP_000976070.1|3149872_3150331_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	9.6e-49
>prophage 205
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	3154349	3159370	5106662		Vibrio_phage(33.33%)	4	NA	NA
WP_001296534.1|3154349_3156032_-	NAD-dependent DNA ligase LigB	NA	A0A1Q2U2Q6	Vibrio_phage	23.0	5.7e-22
WP_001295237.1|3156289_3156913_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_000135058.1|3156967_3157243_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000280473.1|3157261_3159370_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
>prophage 206
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	3163671	3165063	5106662		environmental_Halophage(100.0%)	1	NA	NA
WP_001295238.1|3163671_3165063_+	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 207
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	3178571	3179756	5106662	integrase	Enterobacteria_phage(100.0%)	1	3173362:3173378	3186579:3186595
3173362:3173378	attL	AATGCCGTTAATCAGTA	NA	NA	NA	NA
WP_001218910.1|3178571_3179756_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	69.9	2.6e-162
WP_001218910.1|3178571_3179756_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	69.9	2.6e-162
3186579:3186595	attR	TACTGATTAACGGCATT	NA	NA	NA	NA
>prophage 208
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	3203812	3205321	5106662		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001189111.1|3203812_3205321_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
>prophage 209
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	3218335	3224291	5106662	transposase	Stx2-converting_phage(60.0%)	6	NA	NA
WP_001339397.1|3218335_3219013_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|3219012_3219360_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|3219379_3220951_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_001296549.1|3221365_3221593_+	F1845 fimbrial adhesin operon transcriptional regulator DaaF	NA	NA	NA	NA	NA
WP_000544836.1|3222321_3223119_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	98.9	3.6e-144
WP_000952373.1|3223118_3224291_-|transposase	IS21-like element IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	99.7	8.3e-230
>prophage 210
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	3240326	3242500	5106662		Yersinia_phage(33.33%)	4	NA	NA
WP_001234753.1|3240326_3241145_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.9	2.2e-48
WP_000214415.1|3241236_3241722_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.0	5.3e-13
WP_001186709.1|3241733_3242210_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692346.1|3242278_3242500_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
>prophage 211
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	3251301	3252636	5106662		Moraxella_phage(100.0%)	1	NA	NA
WP_001527950.1|3251301_3252636_-	adenine permease AdeQ	NA	A0A0R6PHV4	Moraxella_phage	36.9	1.1e-65
>prophage 212
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	3261277	3273157	5106662		Micromonas_sp._RCC1109_virus(20.0%)	11	NA	NA
WP_000168502.1|3261277_3262966_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.6	1.6e-56
WP_001312198.1|3263071_3263170_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_001296567.1|3263570_3264755_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	1.2e-13
WP_000148034.1|3264762_3265260_-	radical SAM protein	NA	NA	NA	NA	NA
WP_001113432.1|3265256_3265619_-	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_001296568.1|3265608_3265956_-	YidH family protein	NA	NA	NA	NA	NA
WP_001087174.1|3267506_3269222_-	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.2	1.2e-40
WP_001296571.1|3269388_3270255_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001279774.1|3270344_3272006_-	putative transporter	NA	NA	NA	NA	NA
WP_001243431.1|3272203_3272632_-	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
WP_001243437.1|3272743_3273157_-	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
>prophage 213
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	3277586	3278735	5106662		Oenococcus_phage(100.0%)	1	NA	NA
WP_000705012.1|3277586_3278735_-	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	2.7e-52
>prophage 214
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	3283343	3290712	5106662		Bacillus_virus(33.33%)	8	NA	NA
WP_000072072.1|3283343_3285758_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	3.7e-115
WP_000060112.1|3285786_3286860_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000673464.1|3286859_3287960_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_000059111.1|3287964_3289368_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_122984430.1|3289664_3289745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000831330.1|3289974_3290115_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_000239730.1|3290131_3290491_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_001307474.1|3290454_3290712_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
>prophage 215
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	3300909	3302247	5106662		Moraxella_phage(100.0%)	1	NA	NA
WP_001296582.1|3300909_3302247_-	adenine permease AdeP	NA	A0A0R6PHV4	Moraxella_phage	35.9	1.2e-62
>prophage 216
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	3313226	3320741	5106662		Bacillus_phage(25.0%)	6	NA	NA
WP_000063125.1|3313226_3314000_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
WP_001251986.1|3314090_3314981_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000741620.1|3314980_3315940_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_000867146.1|3316025_3317066_-	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
WP_000334086.1|3317379_3319209_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.2	5.6e-132
WP_000933735.1|3319370_3320741_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	3.1e-34
>prophage 217
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	3332696	3333689	5106662		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845115.1|3332696_3333689_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	2.2e-50
>prophage 218
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	3336857	3342710	5106662		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
WP_000102319.1|3336857_3338726_+	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	6.0e-65
WP_001296586.1|3338892_3339312_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_000387762.1|3339319_3340825_+	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	6.0e-15
WP_000211858.1|3340829_3341795_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_001056273.1|3341819_3342710_+	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
>prophage 219
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	3356109	3357756	5106662		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001012588.1|3356109_3357756_+	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.8	5.7e-67
>prophage 220
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	3365352	3370766	5106662		Bacillus_phage(33.33%)	4	NA	NA
WP_001238869.1|3365352_3367374_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	2.9e-113
WP_001296590.1|3367420_3368905_-	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000047499.1|3369040_3370306_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.1e-41
WP_001280776.1|3370436_3370766_+	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
>prophage 221
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	3374808	3380952	5106662		Enterobacteria_phage(40.0%)	6	NA	NA
WP_000866670.1|3374808_3375939_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	32.8	3.0e-27
WP_000006608.1|3375935_3377198_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	5.9e-24
WP_001226629.1|3377197_3378265_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.4	1.3e-101
WP_000676056.1|3378283_3379165_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	8.7e-107
WP_001145166.1|3379142_3379817_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_000612067.1|3379821_3380952_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	40.9	7.4e-18
>prophage 222
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	3388959	3390615	5106662		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000395838.1|3388959_3390615_-	arylsulfatase AslA	NA	A0A2P0VMN7	Tetraselmis_virus	29.7	1.0e-44
>prophage 223
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	3401510	3405369	5106662		Bacillus_phage(100.0%)	3	NA	NA
WP_000130676.1|3401510_3402407_+	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	3.8e-25
WP_001213584.1|3402406_3403123_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000383407.1|3403206_3405369_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	4.6e-117
>prophage 224
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	3411973	3415386	5106662	transposase	Catovirus(50.0%)	3	NA	NA
WP_001442069.1|3411973_3413803_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	1.3e-83
WP_000928838.1|3413867_3414488_+	threonine export protein RhtC	NA	NA	NA	NA	NA
WP_000133649.1|3414525_3415386_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.2	1.2e-65
>prophage 225
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	3423238	3424747	5106662		Vibrio_phage(100.0%)	1	NA	NA
WP_000037971.1|3423238_3424747_+	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	50.7	6.2e-12
>prophage 226
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	3446741	3450028	5106662		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_000187545.1|3446741_3448382_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	4.8e-42
WP_001295260.1|3448460_3448730_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000459601.1|3448733_3449249_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_000109949.1|3449251_3450028_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
>prophage 227
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	3458807	3459422	5106662		Streptococcus_phage(100.0%)	1	NA	NA
WP_001295262.1|3458807_3459422_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	1.6e-19
>prophage 228
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	3473019	3475806	5106662		uncultured_virus(100.0%)	1	NA	NA
WP_000249989.1|3473019_3475806_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.1	1.7e-71
>prophage 229
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	3479927	3482398	5106662		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
WP_001315107.1|3479927_3481337_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
WP_000190574.1|3481348_3482398_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.6	5.0e-08
>prophage 230
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	3486284	3491015	5106662		Escherichia_phage(33.33%)	5	NA	NA
WP_000022287.1|3486284_3487073_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.8	1.3e-21
WP_000196715.1|3487112_3488009_-	sugar kinase	NA	NA	NA	NA	NA
WP_000190782.1|3488181_3489060_+	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	73.6	2.0e-47
WP_000094544.1|3489084_3489972_+	aldolase	NA	NA	NA	NA	NA
WP_000357981.1|3490004_3491015_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A0K0KVL7	Prochlorococcus_phage	22.2	1.3e-05
>prophage 231
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	3505908	3508959	5106662		Escherichia_phage(100.0%)	1	NA	NA
WP_077633686.1|3505908_3508959_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
>prophage 232
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	3519918	3524844	5106662		Bacillus_thuringiensis_phage(33.33%)	5	NA	NA
WP_001296619.1|3519918_3520539_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	5.4e-63
WP_001166063.1|3520798_3521782_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001270242.1|3521930_3522605_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000580417.1|3522775_3524149_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001033720.1|3524145_3524844_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
>prophage 233
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	3536454	3540957	5106662		Paramecium_bursaria_Chlorella_virus(50.0%)	5	NA	NA
WP_000084268.1|3536454_3537300_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|3537724_3537970_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872908.1|3538054_3538540_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001305044.1|3538632_3539559_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293344.1|3539625_3540957_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
>prophage 234
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	3552579	3554133	5106662		Pandoravirus(100.0%)	1	NA	NA
WP_000694068.1|3552579_3554133_+	bifunctional metallophosphatase/5'-nucleotidase	NA	A0A0B5J7T1	Pandoravirus	24.5	3.5e-10
>prophage 235
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	3560946	3568193	5106662		Synechococcus_phage(33.33%)	5	NA	NA
WP_000424857.1|3560946_3561609_-	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.1	1.6e-28
WP_001185130.1|3561620_3564122_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
WP_001004469.1|3564430_3565510_+	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000161265.1|3565524_3565845_+	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_000184861.1|3565895_3568193_+	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
>prophage 236
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	3583945	3589728	5106662	tRNA	Burkholderia_virus(50.0%)	5	NA	NA
WP_000125467.1|3583945_3585262_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	35.2	2.0e-59
WP_001309117.1|3585365_3586016_+	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_000806409.1|3586015_3586375_+	YijD family membrane protein	NA	NA	NA	NA	NA
WP_000186998.1|3586414_3587515_-|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_001296629.1|3587883_3589728_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.0	9.3e-10
>prophage 237
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	3598162	3601215	5106662		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000023081.1|3598162_3599113_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
WP_060667431.1|3600030_3601215_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
>prophage 238
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	3605210	3613539	5106662		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_000263098.1|3605210_3609239_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
WP_000653952.1|3609315_3613539_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.3	5.5e-66
>prophage 239
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	3621835	3623599	5106662		Klosneuvirus(50.0%)	3	NA	NA
WP_000362389.1|3621835_3622507_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	3.6e-20
WP_000940085.1|3622549_3623140_+	YjaG family protein	NA	NA	NA	NA	NA
WP_001044513.1|3623326_3623599_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
>prophage 240
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	3628961	3630551	5106662		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001187526.1|3628961_3630551_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	1.0e-68
>prophage 241
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	3644332	3648016	5106662		Dickeya_phage(100.0%)	1	NA	NA
WP_000095941.1|3644332_3648016_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	88.5	2.9e-26
>prophage 242
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	3672353	3673469	5106662		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179165.1|3672353_3673469_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 243
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	3680821	3681430	5106662		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|3680821_3681430_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 244
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	3693550	3697679	5106662		Escherichia_phage(25.0%)	4	NA	NA
WP_001296639.1|3693550_3694966_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	3.7e-200
WP_001147314.1|3695018_3696098_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.6	3.4e-28
WP_000122237.1|3696120_3696678_+	nicotinamide mononucleotide transporter	NA	I6W764	Vibriophage	28.8	2.2e-15
WP_001523669.1|3696674_3697679_+	AAA family ATPase	NA	K4F711	Cronobacter_phage	30.2	1.3e-26
>prophage 245
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	3703137	3704496	5106662		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_074170155.1|3703137_3704496_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.9	8.6e-37
>prophage 246
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	3714439	3718053	5106662		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000357755.1|3714439_3717262_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.2	0.0e+00
WP_000168305.1|3717516_3718053_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
>prophage 247
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	3721870	3723220	5106662		Moraxella_phage(100.0%)	1	NA	NA
WP_000106892.1|3721870_3723220_+	guanine/hypoxanthine transporter GhxP	NA	A0A0R6PHV4	Moraxella_phage	71.4	3.0e-159
>prophage 248
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	3729344	3731303	5106662		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078193.1|3729344_3731303_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.4	1.9e-90
>prophage 249
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	3741014	3742542	5106662		Planktothrix_phage(100.0%)	2	NA	NA
WP_000156927.1|3741014_3741719_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.5	2.6e-21
WP_000132446.1|3741705_3742542_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.5	8.8e-16
>prophage 250
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	3746459	3748607	5106662		Escherichia_phage(100.0%)	1	NA	NA
WP_011076734.1|3746459_3748607_-	formate dehydrogenase H subunit alpha, selenocysteine-containing	NA	A0A077SK27	Escherichia_phage	23.9	5.3e-33
>prophage 251
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	3753852	3760221	5106662		Tetraselmis_virus(50.0%)	5	NA	NA
WP_001296653.1|3753852_3755838_-	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	44.6	1.9e-149
WP_001171678.1|3756110_3757040_-	allose kinase	NA	NA	NA	NA	NA
WP_001296654.1|3757023_3757719_-	D-allulose-6-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_000507111.1|3757729_3758710_-	D-allose ABC transporter permease	NA	NA	NA	NA	NA
WP_000235245.1|3758688_3760221_-	D-allose ABC transporter ATP-binding protein AlsA	NA	G3M9Y6	Bacillus_virus	27.4	7.5e-13
>prophage 252
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	3766364	3767914	5106662		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_000611411.1|3766364_3767045_-	phosphonate C-P lyase system protein PhnL	NA	F2Y1V6	Organic_Lake_phycodnavirus	25.0	1.1e-05
WP_001075531.1|3767155_3767914_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	28.3	1.6e-16
>prophage 253
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	3773517	3774306	5106662		Pithovirus(100.0%)	1	NA	NA
WP_001193415.1|3773517_3774306_-	phosphonate ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	28.2	2.5e-12
>prophage 254
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	3779146	3780649	5106662		Burkholderia_virus(100.0%)	1	NA	NA
WP_001296659.1|3779146_3780649_+	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.2	1.4e-56
>prophage 255
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	3803702	3818896	5106662	tRNA	Enterobacteria_phage(50.0%)	8	NA	NA
WP_001528154.1|3803702_3807542_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA54	Enterobacteria_phage	45.2	0.0e+00
WP_001088099.1|3808439_3809270_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001080129.1|3810425_3814355_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA54	Enterobacteria_phage	37.3	4.9e-218
WP_000405647.1|3814568_3814841_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_001312331.1|3815068_3815365_+	type V toxin-antitoxin system endoribonuclease antitoxin GhoS	NA	NA	NA	NA	NA
WP_001173343.1|3815392_3815566_+	type V toxin-antitoxin system toxin GhoT	NA	NA	NA	NA	NA
WP_000003806.1|3815684_3817202_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
WP_000856826.1|3817438_3818896_-	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.6	3.1e-48
>prophage 256
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	3833173	3835157	5106662		Cronobacter_phage(50.0%)	2	NA	NA
WP_001026276.1|3833173_3833467_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000729117.1|3833510_3835157_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
>prophage 257
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	3839361	3839895	5106662		Morganella_phage(100.0%)	1	NA	NA
WP_001238369.1|3839361_3839895_-	lipocalin Blc	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
>prophage 258
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	3844815	3845793	5106662		Tupanvirus(100.0%)	1	NA	NA
WP_000004771.1|3844815_3845793_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
>prophage 259
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	3853513	3854059	5106662		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001295188.1|3853513_3854059_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
>prophage 260
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	3857974	3870999	5106662	protease,tRNA	Vibrio_phage(20.0%)	11	NA	NA
WP_000990282.1|3857974_3859306_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	30.1	7.4e-17
WP_001296676.1|3859315_3861163_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	7.5e-60
WP_001280359.1|3861155_3862106_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051883.1|3862191_3862500_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000460357.1|3862575_3863856_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000312479.1|3863941_3865201_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|3865203_3866208_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|3866289_3866487_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527954.1|3866590_3867889_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.4	1.7e-66
WP_001177639.1|3868093_3868519_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076322.1|3868557_3870999_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	4.9e-67
>prophage 261
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	3874841	3876005	5106662		Ralstonia_phage(100.0%)	1	NA	NA
WP_000944012.1|3874841_3876005_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.2	1.8e-80
>prophage 262
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	3918745	3925233	5106662		uncultured_Caudovirales_phage(33.33%)	6	NA	NA
WP_000055075.1|3918745_3919276_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000265933.1|3919585_3920542_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000205813.1|3920681_3922184_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.4e-11
WP_001296689.1|3922197_3923220_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000596015.1|3923206_3924202_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853753.1|3924234_3925233_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
>prophage 263
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	3929543	3932305	5106662		Cronobacter_phage(50.0%)	2	NA	NA
WP_001106238.1|3929543_3930008_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.1	1.1e-52
WP_000187791.1|3930166_3932305_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.6	9.1e-267
>prophage 264
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	3935943	3942040	5106662		Paramecium_bursaria_Chlorella_virus(66.67%)	6	NA	NA
WP_001181324.1|3935943_3936891_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
WP_001387276.1|3937075_3937129_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_000471866.1|3937269_3939966_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_000047539.1|3940171_3940558_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148581.1|3940630_3941092_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013046.1|3941104_3942040_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
>prophage 265
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	3950308	3960735	5106662	tRNA	Klosneuvirus(25.0%)	7	NA	NA
WP_000416407.1|3950308_3953164_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
WP_000786399.1|3953163_3953607_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|3953962_3955474_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000584114.1|3955740_3956841_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001296697.1|3956840_3957923_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_001296698.1|3958083_3959586_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.6	4.6e-84
WP_001296699.1|3959715_3960735_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	1.9e-44
>prophage 266
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	3971753	3974744	5106662	transposase	Enterobacteria_phage(50.0%)	4	NA	NA
WP_000239754.1|3971753_3971990_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	66.7	9.0e-19
WP_000422741.1|3972327_3972753_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|3972749_3973100_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080195.1|3973130_3974744_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
>prophage 267
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	3983149	3989930	5106662	transposase	Vibrio_phage(25.0%)	6	NA	NA
WP_001545177.1|3983149_3985147_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	4.4e-21
WP_000336726.1|3985301_3986120_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.2e-65
WP_000088391.1|3986155_3986458_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000177057.1|3987391_3987649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175457.1|3988205_3988973_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000684856.1|3988973_3989930_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
>prophage 268
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	3998909	4001069	5106662	transposase	Stx2-converting_phage(100.0%)	3	NA	NA
WP_000998019.1|3998909_4000295_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	3.4e-259
WP_000612591.1|4000344_4000692_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171523.1|4000688_4001069_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
>prophage 269
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4012310	4017196	5106662	transposase	Yersinia_phage(20.0%)	6	NA	NA
WP_001234738.1|4012310_4013129_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.7	9.4e-47
WP_001350782.1|4013470_4013944_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.3	8.7e-13
WP_001186775.1|4013959_4014436_+	RadC family protein	NA	NA	NA	NA	NA
WP_023281719.1|4014498_4014753_+	DUF987 domain-containing protein	NA	A0A0S2MXL3	Klebsiella_phage	42.7	6.3e-10
WP_001298859.1|4014893_4016435_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_001016257.1|4016449_4017196_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
>prophage 270
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4022185	4023376	5106662		Bacillus_phage(100.0%)	1	NA	NA
WP_001295727.1|4022185_4023376_+	DNA cytosine methyltransferase	NA	Q02778	Bacillus_phage	31.0	7.3e-16
>prophage 271
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4026516	4028592	5106662		Acidithiobacillus_phage(100.0%)	1	NA	NA
WP_000366620.1|4026516_4028592_-	AAA domain-containing protein	NA	K4I1H4	Acidithiobacillus_phage	33.8	7.7e-37
>prophage 272
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4050246	4054126	5106662	transposase	Shigella_phage(50.0%)	3	NA	NA
WP_085949154.1|4050246_4051394_-|transposase	IS3-like element ISEc52 family transposase	transposase	Q716C2	Shigella_phage	96.3	2.4e-173
WP_001363826.1|4051519_4052563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000991462.1|4053145_4054126_-	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	H6WZJ9	Escherichia_phage	57.2	4.7e-101
>prophage 273
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4060455	4061052	5106662		Escherichia_phage(100.0%)	1	NA	NA
WP_000044711.1|4060455_4061052_+	type 1 fimbria regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
>prophage 274
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4071247	4072708	5106662		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000208194.1|4071247_4072708_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	9.5e-50
>prophage 275
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4079231	4079786	5106662		Clostridioides_phage(100.0%)	1	NA	NA
WP_001151866.1|4079231_4079786_+	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	2.7e-37
>prophage 276
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4087287	4097107	5106662	transposase	Sodalis_phage(25.0%)	7	NA	NA
WP_000181180.1|4087287_4088244_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.2	1.0e-60
WP_000199304.1|4088486_4089899_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_000397910.1|4090075_4090240_+	DUF1127 domain-containing protein	NA	NA	NA	NA	NA
WP_000132599.1|4090282_4090621_-	endoribonuclease SymE	NA	NA	NA	NA	NA
WP_000058884.1|4090835_4094099_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	25.4	2.8e-49
WP_000535012.1|4094193_4095498_-	restriction endonuclease subunit S	NA	B3GAM1	uncultured_virus	24.7	8.3e-05
WP_001029745.1|4095487_4097107_-	type I restriction-modification system subunit M	NA	A0A2H4UVW8	Bodo_saltans_virus	21.8	1.1e-06
>prophage 277
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4102890	4108257	5106662		uncultured_Caudovirales_phage(50.0%)	4	NA	NA
WP_000919544.1|4102890_4104555_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
WP_000410144.1|4104603_4105965_-	MFS transporter	NA	NA	NA	NA	NA
WP_000091573.1|4106181_4107096_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000106049.1|4107234_4108257_+	L-galactonate oxidoreductase	NA	A0A2K9L7I1	Tupanvirus	27.1	2.1e-11
>prophage 278
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4111484	4112764	5106662		Shigella_phage(50.0%)	2	NA	NA
WP_000799911.1|4111484_4112222_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
WP_000098818.1|4112224_4112764_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.9e-28
>prophage 279
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4120592	4123468	5106662		Streptococcus_phage(50.0%)	3	NA	NA
WP_000175943.1|4120592_4122182_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
WP_001295748.1|4122574_4123180_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|4123306_4123468_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
>prophage 280
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4129457	4130780	5106662		Geobacillus_virus(100.0%)	1	NA	NA
WP_000477800.1|4129457_4130780_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.5	1.5e-78
>prophage 281
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4138543	4143708	5106662		Enterococcus_phage(33.33%)	3	NA	NA
WP_000093834.1|4138543_4139776_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	2.1e-82
WP_000046754.1|4139896_4141564_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	27.7	1.0e-39
WP_000409419.1|4141770_4143708_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
>prophage 282
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4146991	4149105	5106662		Bacillus_phage(50.0%)	2	NA	NA
WP_001188689.1|4146991_4147681_+	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
WP_001219582.1|4147680_4149105_+	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.9	3.2e-10
>prophage 283
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4160760	4173749	5106662		Cyanophage(16.67%)	12	NA	NA
WP_000130187.1|4160760_4161714_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.5	1.7e-10
WP_001094685.1|4161828_4162416_+	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000528533.1|4162450_4163017_-	acetate uptake transporter	NA	NA	NA	NA	NA
WP_001102393.1|4163165_4163879_-	acidic protein MsyB	NA	NA	NA	NA	NA
WP_000843689.1|4163904_4164309_-	DUF2541 family protein	NA	NA	NA	NA	NA
WP_000516135.1|4164679_4166596_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_001118464.1|4166684_4167815_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
WP_001181672.1|4167918_4168128_-	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	72.5	5.2e-18
WP_001274833.1|4168684_4169446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001173016.1|4169466_4170960_+	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	27.8	8.0e-28
WP_000494928.1|4171088_4172348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000681384.1|4172582_4173749_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	50.3	9.8e-90
>prophage 284
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4180176	4182993	5106662	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001286823.1|4180176_4182993_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.3	2.1e-77
>prophage 285
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4187801	4188950	5106662		Halovirus(100.0%)	1	NA	NA
WP_001295757.1|4187801_4188950_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	9.8e-50
>prophage 286
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4194453	4200113	5106662		Staphylococcus_phage(50.0%)	4	NA	NA
WP_001295759.1|4194453_4196007_-	crotonobetaine/carnitine-CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	26.0	2.0e-34
WP_000349970.1|4196079_4197297_-	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_000347117.1|4197425_4198568_-	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000787105.1|4198598_4200113_-	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
>prophage 287
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4208007	4209968	5106662		Bacillus_phage(50.0%)	4	NA	NA
WP_000624375.1|4208007_4208487_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
WP_000125566.1|4208572_4208806_+	antitoxin	NA	NA	NA	NA	NA
WP_001160964.1|4208808_4209093_+	CcdB family protein	NA	NA	NA	NA	NA
WP_000257181.1|4209119_4209968_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.1e-08
>prophage 288
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4217745	4223168	5106662		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001117001.1|4217745_4220652_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
WP_000035602.1|4220816_4223168_-	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.2	2.3e-37
>prophage 289
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4234907	4235606	5106662		Planktothrix_phage(100.0%)	1	NA	NA
WP_000916271.1|4234907_4235606_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	36.2	5.2e-22
>prophage 290
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4247083	4248808	5106662		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_000425639.1|4247083_4248808_+	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	1.9e-36
>prophage 291
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4274777	4275821	5106662		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217320.1|4274777_4275821_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
>prophage 292
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4280067	4280619	5106662		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923703.1|4280067_4280619_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	31.6	1.5e-11
>prophage 293
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4293732	4295157	5106662		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000102485.1|4293732_4295157_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 294
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4302812	4309280	5106662		Mamastrovirus(33.33%)	5	NA	NA
WP_001189632.1|4302812_4304363_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	3.5e-18
WP_001295777.1|4304409_4306800_-	quinoprotein glucose dehydrogenase	NA	NA	NA	NA	NA
WP_000683335.1|4307005_4307542_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_000651599.1|4307582_4308245_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000150638.1|4308353_4309280_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
>prophage 295
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4312542	4313463	5106662	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000339933.1|4312542_4313463_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	48.8	4.9e-60
>prophage 296
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4323594	4330400	5106662	tRNA	unidentified_phage(50.0%)	6	NA	NA
WP_000174644.1|4323594_4325013_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
WP_000937399.1|4325051_4325978_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_001155227.1|4326014_4326470_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_000396050.1|4326647_4327352_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001294702.1|4327366_4327897_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_001295782.1|4327970_4330400_+	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.6	6.0e-41
>prophage 297
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4340784	4341582	5106662		Planktothrix_phage(100.0%)	1	NA	NA
WP_001295786.1|4340784_4341582_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	27.4	4.6e-14
>prophage 298
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4347493	4347838	5106662		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|4347493_4347838_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 299
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4351767	4353192	5106662	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000753937.1|4351767_4353192_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	2.5e-26
>prophage 300
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4364771	4365530	5106662		Flavobacterium_phage(100.0%)	1	NA	NA
WP_001295562.1|4364771_4365530_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
>prophage 301
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4374358	4378474	5106662		Emiliania_huxleyi_virus(50.0%)	2	NA	NA
WP_000569423.1|4374358_4374955_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	2.3e-26
WP_001294788.1|4374991_4378474_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.8	2.8e-209
>prophage 302
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4391432	4392464	5106662		Planktothrix_phage(100.0%)	1	NA	NA
WP_000593994.1|4391432_4392464_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
>prophage 303
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4402643	4406845	5106662		uncultured_Caudovirales_phage(33.33%)	5	NA	NA
WP_000644685.1|4402643_4404002_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052747.1|4404073_4404829_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001295200.1|4404862_4405585_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917890.1|4405581_4406049_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001385210.1|4406113_4406845_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	7.6e-40
>prophage 304
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4411276	4414599	5106662		Caulobacter_phage(50.0%)	4	NA	NA
WP_000284050.1|4411276_4411855_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000333380.1|4412059_4412827_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|4412797_4413538_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000093933.1|4413849_4414599_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
>prophage 305
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4428575	4434320	5106662		Hokovirus(50.0%)	5	NA	NA
WP_000859530.1|4428575_4428971_+	adenylyltransferase/cytidyltransferase family protein	NA	A0A1V0SGE7	Hokovirus	50.0	1.0e-30
WP_000758621.1|4428990_4429338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001531417.1|4429425_4429974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001531418.1|4430998_4431400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001194008.1|4431881_4434320_-	glycosyltransferase	NA	A0A1V0SAN7	Catovirus	43.4	2.7e-33
>prophage 306
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4457851	4459003	5106662		Mycobacterium_phage(100.0%)	1	NA	NA
WP_001311432.1|4457851_4459003_+	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	31.1	6.6e-30
>prophage 307
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4463679	4471633	5106662		Streptococcus_phage(50.0%)	5	NA	NA
WP_000749899.1|4463679_4464735_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.6	3.5e-118
WP_001285288.1|4465023_4466127_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893315.1|4466138_4467392_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	2.0e-96
WP_000671528.1|4468758_4470006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000229741.1|4469995_4471633_-	SAM-dependent DNA methyltransferase	NA	A0A2H4PQP4	Staphylococcus_phage	28.7	1.0e-23
>prophage 308
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4495190	4496042	5106662		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001174452.1|4495190_4496042_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.7	1.2e-47
>prophage 309
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4502084	4505389	5106662		Staphylococcus_phage(50.0%)	4	NA	NA
WP_001295799.1|4502084_4502954_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.5	1.1e-53
WP_001295800.1|4503113_4503707_-	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000474088.1|4503718_4503955_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001046304.1|4504063_4505389_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	1.1e-113
>prophage 310
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4515306	4522874	5106662	holin,integrase	Escherichia_phage(33.33%)	5	4514268:4514281	4529350:4529363
4514268:4514281	attL	TTCACCAACGGCAA	NA	NA	NA	NA
WP_001295805.1|4515306_4515870_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	53.3	6.0e-53
WP_001159129.1|4516954_4518625_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	30.9	8.9e-60
WP_001295806.1|4518638_4520111_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001295807.1|4520124_4520712_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000131040.1|4520840_4522874_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
4529350:4529363	attR	TTCACCAACGGCAA	NA	NA	NA	NA
>prophage 311
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4533995	4535045	5106662		Tupanvirus(100.0%)	1	NA	NA
WP_000692730.1|4533995_4535045_+	NADPH-dependent aldehyde reductase YahK	NA	A0A2K9L339	Tupanvirus	45.0	1.4e-71
>prophage 312
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4542691	4544578	5106662		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000010274.1|4542691_4544578_+	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	2.4e-53
>prophage 313
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4549537	4553817	5106662		Herpes_simplex_virus(50.0%)	2	NA	NA
WP_000177883.1|4549537_4552612_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	97.3	0.0e+00
WP_000805862.1|4552734_4553817_-	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	98.9	7.0e-191
>prophage 314
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4559227	4561188	5106662		Ostreococcus_lucimarinus_virus(50.0%)	2	NA	NA
WP_000044319.1|4559227_4560178_+	acetaldehyde dehydrogenase	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	4.3e-35
WP_001013504.1|4560174_4561188_+	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.4	1.4e-44
>prophage 315
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4564266	4567734	5106662		Prochlorococcus_phage(50.0%)	4	NA	NA
WP_000842109.1|4564266_4565376_-	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.9	4.0e-32
WP_001141271.1|4565410_4565686_-	formaldehyde-responsive transcriptional repressor FrmR	NA	NA	NA	NA	NA
WP_001018403.1|4565991_4566954_+	taurine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000939359.1|4566966_4567734_+	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	39.8	4.3e-25
>prophage 316
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4574642	4575800	5106662		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000830769.1|4574642_4575800_-	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	3.9e-06
>prophage 317
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4583215	4584331	5106662		Bacillus_phage(100.0%)	1	NA	NA
WP_000484048.1|4583215_4584331_+	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.1e-18
>prophage 318
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4588620	4598718	5106662		Bacillus_phage(60.0%)	7	NA	NA
WP_012896740.1|4588620_4589532_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	6.0e-103
WP_001219313.1|4589656_4590565_+	fructokinase	NA	NA	NA	NA	NA
WP_012896741.1|4590833_4592018_-	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_000698843.1|4592143_4595287_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	7.6e-12
WP_001221274.1|4595283_4596486_-	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	32.4	2.4e-06
WP_000113933.1|4596675_4597365_+	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
WP_000893576.1|4597422_4598718_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	1.3e-26
>prophage 319
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4605669	4614512	5106662	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
WP_000667319.1|4605669_4606797_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
WP_000007629.1|4606819_4607152_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000934823.1|4607179_4609027_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000046637.1|4609037_4610009_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_000974813.1|4610138_4610486_+	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_001295827.1|4610523_4611408_-	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_001295828.1|4611706_4612246_-	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_000543535.1|4612396_4612846_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_001150440.1|4612849_4613953_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	36.1	1.3e-54
WP_001021161.1|4614041_4614512_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
>prophage 320
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4635945	4640992	5106662	protease	Agrobacterium_phage(25.0%)	4	NA	NA
WP_000122253.1|4635945_4636569_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
WP_000130299.1|4636694_4637969_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	1.9e-131
WP_001295325.1|4638156_4640511_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
WP_001043542.1|4640719_4640992_+	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
>prophage 321
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4644144	4644840	5106662		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817227.1|4644144_4644840_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	1.9e-88
>prophage 322
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4648163	4651710	5106662		Bacillus_phage(100.0%)	2	NA	NA
WP_001235630.1|4648163_4649936_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.5	2.3e-50
WP_001256214.1|4649928_4651710_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.9	3.4e-41
>prophage 323
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4660548	4663698	5106662		Leptospira_phage(100.0%)	1	NA	NA
WP_001132478.1|4660548_4663698_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	4.7e-54
>prophage 324
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4670536	4678994	5106662		Klosneuvirus(25.0%)	8	NA	NA
WP_000127356.1|4670536_4671088_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
WP_000122044.1|4671216_4673148_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	3.9e-43
WP_000467098.1|4673200_4673530_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_001195025.1|4673529_4674135_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_000678189.1|4674244_4676119_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.8	1.0e-117
WP_001220233.1|4676299_4676944_+	adenylate kinase	NA	NA	NA	NA	NA
WP_001250114.1|4677075_4678038_+	ferrochelatase	NA	NA	NA	NA	NA
WP_000801794.1|4678034_4678994_-	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	25.0	2.9e-15
>prophage 325
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4688556	4691798	5106662		Escherichia_phage(66.67%)	3	NA	NA
WP_000057523.1|4688556_4688859_+	hypothetical protein	NA	A0A222YWE2	Escherichia_phage	80.0	1.3e-41
WP_000806442.1|4688894_4689236_+	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	75.5	3.2e-41
WP_000083947.1|4689293_4691798_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.4	1.0e-115
>prophage 326
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4697165	4697843	5106662		Bacillus_virus(100.0%)	1	NA	NA
WP_001157551.1|4697165_4697843_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	2.4e-27
>prophage 327
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4701099	4701786	5106662		Planktothrix_phage(100.0%)	1	NA	NA
WP_001110573.1|4701099_4701786_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
>prophage 328
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4712215	4713997	5106662		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_001295838.1|4712215_4713997_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.2	7.8e-38
>prophage 329
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4720187	4721333	5106662		Streptococcus_phage(100.0%)	1	NA	NA
WP_001295840.1|4720187_4721333_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	43.0	9.7e-50
>prophage 330
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4733568	4738044	5106662	integrase,tRNA,tail	Moumouvirus(20.0%)	7	4727511:4727524	4741085:4741098
4727511:4727524	attL	GCCTGGCGTAACGC	NA	NA	NA	NA
WP_000912352.1|4733568_4734954_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143517.1|4734989_4735511_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190282.1|4735618_4735831_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729155.1|4735832_4736699_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_001331488.1|4737053_4737362_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A088CD23	Shigella_phage	81.8	7.4e-37
WP_001295845.1|4737381_4737681_-|integrase	tyrosine-type recombinase/integrase	integrase	B9UDL9	Salmonella_phage	81.2	5.0e-30
WP_023363122.1|4737738_4738044_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	63.6	4.0e-43
4741085:4741098	attR	GCGTTACGCCAGGC	NA	NA	NA	NA
>prophage 331
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4746836	4748952	5106662		Hokovirus(50.0%)	2	NA	NA
WP_000253846.1|4746836_4748279_-	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.1	2.3e-11
WP_000770953.1|4748268_4748952_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
>prophage 332
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4752097	4755241	5106662		Leptospira_phage(100.0%)	1	NA	NA
WP_000574008.1|4752097_4755241_+	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.4	2.2e-59
>prophage 333
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4764810	4766355	5106662		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_000937457.1|4764810_4766355_-	sugar ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.0	1.8e-14
>prophage 334
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4777743	4783817	5106662		Tupanvirus(50.0%)	3	NA	NA
WP_000077758.1|4777743_4781625_+	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.4	1.7e-61
WP_000096765.1|4781871_4783005_+	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_000140634.1|4783001_4783817_-	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.5	4.3e-07
>prophage 335
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4798108	4799931	5106662		uncultured_marine_virus(50.0%)	2	NA	NA
WP_000502950.1|4798108_4798738_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	53.3	1.3e-56
WP_000029772.1|4798710_4799931_-	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	32.5	6.1e-58
>prophage 336
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4803036	4805151	5106662		Bacillus_virus(50.0%)	2	NA	NA
WP_000887629.1|4803036_4804602_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
WP_001295855.1|4804722_4805151_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	38.5	4.3e-19
>prophage 337
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4819240	4819887	5106662		Morganella_phage(50.0%)	2	NA	NA
WP_000034825.1|4819240_4819450_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
WP_000939738.1|4819503_4819887_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
>prophage 338
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4824304	4826744	5106662		Stx2-converting_phage(50.0%)	2	NA	NA
WP_001092082.1|4824304_4825516_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
WP_001231421.1|4825655_4826744_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
>prophage 339
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4833754	4836337	5106662	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001157896.1|4833754_4836337_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.2	1.2e-183
>prophage 340
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4840469	4844002	5106662		Bathycoccus_sp._RCC1105_virus(50.0%)	3	NA	NA
WP_000367903.1|4840469_4842140_-	molecular chaperone HscC	NA	E5ESM6	Bathycoccus_sp._RCC1105_virus	32.9	7.2e-78
WP_001207535.1|4842223_4843159_-	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_000631387.1|4843276_4844002_-	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.1	9.9e-32
>prophage 341
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4851946	4853026	5106662		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000490838.1|4851946_4853026_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.3e-47
>prophage 342
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4857557	4859222	5106662		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337077.1|4857557_4859222_-	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.5	6.1e-85
>prophage 343
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4863847	4865794	5106662		Vibrio_phage(100.0%)	1	NA	NA
WP_001023114.1|4863847_4865794_+	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.2e-07
>prophage 344
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4868848	4869607	5106662		Moraxella_phage(100.0%)	1	NA	NA
WP_000480543.1|4868848_4869607_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	48.2	4.8e-45
>prophage 345
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4874100	4876746	5106662	tRNA	Escherichia_phage(100.0%)	2	NA	NA
WP_000679501.1|4874100_4874862_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	35.7	7.4e-30
WP_001287134.1|4875081_4876746_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	98.7	0.0e+00
>prophage 346
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4880891	4881656	5106662		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000773282.1|4880891_4881656_-	esterase	NA	A0A1J0GNR5	Mycobacterium_phage	31.5	2.9e-05
>prophage 347
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4888311	4900144	5106662		Hokovirus(40.0%)	10	NA	NA
WP_000186068.1|4888311_4888989_-	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	30.6	2.6e-26
WP_001295875.1|4888985_4891670_-	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.8	6.5e-12
WP_001295876.1|4891662_4892235_-	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_000088001.1|4892243_4894292_-	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	22.8	4.2e-27
WP_000741157.1|4894314_4895988_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_001272653.1|4895987_4896077_-	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_000424788.1|4896389_4896596_+	YbfA family protein	NA	NA	NA	NA	NA
WP_001075784.1|4896696_4897206_+	YbgA family protein	NA	NA	NA	NA	NA
WP_000207133.1|4897202_4898621_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.4	2.8e-62
WP_001032722.1|4898662_4900144_-	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.2	4.2e-45
>prophage 348
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4903522	4904314	5106662		Kaumoebavirus(100.0%)	1	NA	NA
WP_001114009.1|4903522_4904314_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	25.8	5.8e-09
>prophage 349
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4908237	4908993	5106662		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000991076.1|4908237_4908993_+	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	27.9	2.9e-10
>prophage 350
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4944831	4948351	5106662		Vibrio_phage(33.33%)	4	NA	NA
WP_000345405.1|4944831_4945551_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.9	2.4e-22
WP_000951272.1|4945547_4946489_-	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.2	1.3e-23
WP_000784348.1|4946602_4946983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001109194.1|4947298_4948351_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.1	7.5e-81
>prophage 351
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4952714	4959290	5106662		Tupanvirus(33.33%)	7	NA	NA
WP_001265440.1|4952714_4953731_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	1.0e-79
WP_000096849.1|4953993_4955466_-	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	28.8	1.9e-13
WP_001147439.1|4955533_4956322_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000891515.1|4956450_4956600_+	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
WP_000113014.1|4956766_4957540_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000604037.1|4957539_4958229_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000891663.1|4958231_4959290_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.4	7.4e-20
>prophage 352
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4969552	4970842	5106662		Klosneuvirus(100.0%)	1	NA	NA
WP_001295886.1|4969552_4970842_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	1.3e-18
>prophage 353
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4977169	4978078	5106662		Streptococcus_phage(100.0%)	1	NA	NA
WP_001295887.1|4977169_4978078_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	4.9e-28
>prophage 354
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	4988676	5000247	5106662		Anomala_cuprea_entomopoxvirus(20.0%)	10	NA	NA
WP_000996111.1|4988676_4990413_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
WP_000976400.1|4990405_4991404_-	secretion protein HlyD	NA	NA	NA	NA	NA
WP_001295890.1|4991403_4992075_-	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_000007091.1|4992303_4993665_+	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	32.6	1.5e-52
WP_001218657.1|4994201_4996352_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	1.8e-41
WP_000386550.1|4996379_4997342_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_000443542.1|4997481_4998567_+	hydroxycarboxylate dehydrogenase HcXB	NA	NA	NA	NA	NA
WP_000849301.1|4998704_4998965_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000146357.1|4999229_4999496_-	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	3.1e-07
WP_000990158.1|4999569_5000247_-	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	29.7	5.2e-19
>prophage 355
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	5006636	5011862	5106662		Planktothrix_phage(33.33%)	7	NA	NA
WP_000569080.1|5006636_5007359_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
WP_001159065.1|5007355_5008015_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000843866.1|5008153_5008900_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_000100800.1|5009303_5009807_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_001295297.1|5010106_5010994_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_120795379.1|5011228_5011294_+	protein YliM	NA	NA	NA	NA	NA
WP_001295296.1|5011346_5011862_+	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
>prophage 356
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	5016858	5023742	5106662		Tupanvirus(33.33%)	5	NA	NA
WP_000961458.1|5016858_5018451_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
WP_000114256.1|5018650_5019466_-	sugar-phosphatase YbiV	NA	NA	NA	NA	NA
WP_000209354.1|5019611_5022044_-	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
WP_001295894.1|5022049_5022949_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_001295895.1|5023079_5023742_+	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	33.6	9.7e-26
>prophage 357
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	5026957	5028829	5106662		Planktothrix_phage(100.0%)	1	NA	NA
WP_001295896.1|5026957_5028829_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	8.8e-16
>prophage 358
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	5040163	5041366	5106662		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000195961.1|5040163_5041366_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
>prophage 359
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	5049932	5059072	5106662		Vibrio_phage(25.0%)	11	NA	NA
WP_001195231.1|5049932_5050190_-	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	63.1	7.8e-24
WP_001201575.1|5050349_5050637_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_000189165.1|5050620_5051343_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_000684321.1|5051403_5052306_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000203025.1|5052393_5052870_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_001295904.1|5053219_5054332_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000996007.1|5054426_5055560_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000105413.1|5055569_5056514_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061639.1|5056510_5057356_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389260.1|5057415_5057904_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001149713.1|5057944_5059072_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	3.5e-28
>prophage 360
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	5062197	5064935	5106662		Planktothrix_phage(50.0%)	4	NA	NA
WP_000027205.1|5062197_5062926_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_001295906.1|5063143_5063659_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160737.1|5063784_5064108_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001255186.1|5064104_5064935_+	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
>prophage 361
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	5068522	5070241	5106662		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_000815373.1|5068522_5070241_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	5.2e-31
>prophage 362
NZ_CP013658	Escherichia coli strain uk_P46212 chromosome, complete genome	5106662	5079457	5104443	5106662	protease,tRNA,tail	Enterobacteria_phage(37.5%)	21	NA	NA
WP_000188152.1|5079457_5081404_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.4	8.5e-38
WP_000410785.1|5081476_5081701_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|5082023_5082344_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|5082374_5084651_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_001040187.1|5085335_5085554_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241674.1|5085838_5086543_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202204.1|5086584_5088306_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	30.8	1.2e-14
WP_001043561.1|5088306_5090073_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_001385255.1|5090195_5091161_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.9e-62
WP_000228473.1|5091704_5092199_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000077041.1|5092333_5096440_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|5096598_5097210_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067797.1|5097220_5098564_+	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_000886683.1|5098654_5099947_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000078916.1|5100252_5100393_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_000488106.1|5100584_5100845_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000132830.1|5100885_5101995_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.9	1.3e-195
WP_000005447.1|5102152_5103337_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	97.5	8.4e-222
WP_000290462.1|5103336_5103849_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
WP_000651577.1|5103904_5104279_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	71.5	9.9e-36
WP_000333503.1|5104287_5104443_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
>prophage 1
NZ_CP013657	Escherichia coli strain uk_P46212 plasmid unnamed, complete sequence	143748	83518	142900	143748	transposase,protease,integrase	Escherichia_phage(27.78%)	56	130707:130743	141676:141712
WP_001067855.1|83518_84223_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000608644.1|84466_85729_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_060667421.1|86292_86850_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	99.5	4.5e-93
WP_000027057.1|87032_87893_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001067858.1|90653_91358_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000224416.1|91473_91779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080256.1|91787_92426_+	type-F conjugative transfer system pilin assembly protein TrbC	NA	NA	NA	NA	NA
WP_000821856.1|92422_94273_+	type-F conjugative transfer system mating-pair stabilization protein TraN	NA	NA	NA	NA	NA
WP_000864353.1|94299_94557_+	conjugal transfer protein TrbE	NA	NA	NA	NA	NA
WP_001030371.1|94549_95293_+	type-F conjugative transfer system pilin assembly protein TraF	NA	NA	NA	NA	NA
WP_000556796.1|95306_95651_+	conjugal transfer protein TrbA	NA	NA	NA	NA	NA
WP_000624194.1|95769_96054_+	type-F conjugative transfer system pilin chaperone TraQ	NA	NA	NA	NA	NA
WP_000059831.1|96040_96586_+	type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB	NA	NA	NA	NA	NA
WP_001309242.1|96515_96863_+	P-type conjugative transfer protein TrbJ	NA	NA	NA	NA	NA
WP_001444237.1|96810_97236_+	F-type conjugal transfer protein TrbF	NA	NA	NA	NA	NA
WP_000944331.1|97222_98596_+	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_001007039.1|98592_101415_+	conjugal transfer mating pair stabilization protein TraG	NA	NA	NA	NA	NA
WP_001405921.1|101436_101916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000782451.1|101964_102696_+	complement resistance protein TraT	NA	NA	NA	NA	NA
WP_000199905.1|102898_103636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000009332.1|103686_105885_+	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_000948354.1|105884_111155_+	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_000205725.1|111174_111921_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.8	2.4e-09
WP_000704523.1|111979_112840_+	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.5	1.9e-10
WP_000139321.1|112942_113503_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_001309245.1|113631_113844_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001233838.1|114865_115327_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	37.1	4.2e-20
WP_001298565.1|115372_115582_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_000766807.1|115619_116210_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_000083830.1|116449_116704_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001365705.1|116941_117016_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000130646.1|117008_117866_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_000616807.1|118804_119458_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000557619.1|119550_119808_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_001398199.1|119740_120142_+	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_001553819.1|120278_123176_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
WP_000509965.1|123270_123876_+	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	9.4e-20
WP_001351729.1|124652_125045_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_000058717.1|125182_126067_+	EamA family transporter	NA	NA	NA	NA	NA
WP_000804064.1|126098_127298_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000164043.1|127403_128054_+	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_032140899.1|128085_128328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|129949_130654_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
130707:130743	attL	TTTAAGCGTGCATAATAAGCCCTACACAAATTGGGAG	NA	NA	NA	NA
WP_063840321.1|130797_131352_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001334766.1|131482_132313_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_001067855.1|132944_133649_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001393253.1|135957_136290_+	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_000239590.1|136336_137212_-	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_001067855.1|137347_138052_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001553864.1|137942_138272_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	55.6	6.9e-09
WP_000454193.1|138397_138748_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845048.1|138950_139964_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001389366.1|140121_140595_+	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
WP_000503573.1|140725_141514_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_000679427.1|141719_142067_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
141676:141712	attR	TTTAAGCGTGCATAATAAGCCCTACACAAATTGGGAG	NA	NA	NA	NA
WP_000259031.1|142060_142900_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
