The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LN831024	Pseudomonas aeruginosa strain NCTC10332 chromosome 1	6316979	627664	680313	6316979	tail,plate,tRNA	uncultured_Caudovirales_phage(28.0%)	55	NA	NA
WP_009875776.1|627664_628690_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.1	8.3e-109
WP_003085061.1|628768_629338_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_003099587.1|629421_629775_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_003099585.1|629765_630308_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_003099584.1|630280_631513_-	multifunctional CCA addition/repair protein	NA	A0A076G5T8	Escherichia_phage	43.1	2.6e-77
WP_016252919.1|631556_632063_-	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_003099581.1|632156_633710_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_003099579.1|633706_634978_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	37.2	4.2e-09
WP_003085078.1|635078_637001_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_003099577.1|637279_637612_-	thiosulfate sulfurtransferase GlpE	NA	NA	NA	NA	NA
WP_003113213.1|637655_638507_-	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	33.3	1.1e-08
WP_003085085.1|638506_638887_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_003099569.1|638923_639730_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_003117956.1|639845_640832_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_003109024.1|640828_642121_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_016852409.1|642101_644891_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_048520735.1|645017_646034_+	phosphotransferase	NA	NA	NA	NA	NA
WP_016852410.1|646030_646705_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_016852411.1|646706_647465_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_012613533.1|647465_648527_-	alpha/beta hydrolase family protein	NA	NA	NA	NA	NA
WP_009875783.1|648678_651072_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_003085103.1|651117_651750_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_048520737.1|651878_652913_+	polyamine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003085109.1|653146_654256_+	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.4	7.8e-28
WP_003099539.1|654311_655358_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_048520738.1|655472_656720_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003099535.1|656825_657656_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003085122.1|657779_658454_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_003099532.1|658453_659272_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_003085126.1|659344_660823_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_003118905.1|661008_661323_-	pyocin activator PrtN family protein	NA	NA	NA	NA	NA
WP_003113202.1|661422_662193_-	helix-turn-helix transcriptional regulator	NA	A0A1B0Z078	Pseudomonas_phage	59.1	1.4e-71
WP_003085132.1|662650_662851_+	repressor PtrB	NA	W6ATC1	Enterobacter_phage	58.3	3.7e-05
WP_003118907.1|662898_663258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003118908.1|663621_664071_+	hypothetical protein	NA	B5TK61	Pseudomonas_phage	53.3	5.0e-26
WP_003113200.1|664092_664608_+	hypothetical protein	NA	A0A2H4J881	uncultured_Caudovirales_phage	42.9	4.1e-32
WP_003085141.1|664604_665162_+|plate	phage baseplate assembly protein V	plate	A0A2H4JG06	uncultured_Caudovirales_phage	71.1	4.6e-45
WP_003113199.1|665314_665641_+	bacteriophage protein	NA	A0A2H4JA09	uncultured_Caudovirales_phage	60.2	2.4e-30
WP_003085151.1|665637_666525_+	bacteriophage protein	NA	S4TNY7	Salmonella_phage	59.8	5.3e-88
WP_034041833.1|666517_667051_+|tail	phage tail protein I	tail	Q9ZXK7	Pseudomonas_virus	64.6	2.3e-62
WP_003161927.1|667052_669158_+|tail	phage tail protein	tail	Q9ZXK6	Pseudomonas_virus	52.7	3.0e-222
WP_016852415.1|669165_669606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003121848.1|669648_670809_+|tail	phage tail sheath family protein	tail	Q38068	Phage_PS17	83.4	1.2e-188
WP_003085175.1|670821_671325_+|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	73.5	8.0e-65
WP_003085178.1|671339_671684_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_023083951.1|671853_674091_+|tail	phage tail length determinator protein	tail	NA	NA	NA	NA
WP_003085182.1|674100_674973_+|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	51.7	3.9e-75
WP_003101635.1|674947_675154_+|tail	tail protein X	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	64.2	2.3e-18
WP_003113193.1|675211_676201_+	phage late control D family protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	55.8	7.5e-107
WP_003113192.1|676233_676863_+	glycoside hydrolase family 19 protein	NA	A0A125RNP1	Pseudomonas_phage	78.0	1.6e-86
WP_003121852.1|676859_677222_+	hypothetical protein	NA	H2BDA0	Pseudomonas_phage	47.9	4.2e-15
WP_003118919.1|677218_677476_+	hypothetical protein	NA	A0A125RNP3	Pseudomonas_phage	64.6	8.3e-18
WP_003117978.1|677823_678429_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	66.3	2.1e-75
WP_003085203.1|678430_679480_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	57.8	1.8e-111
WP_003085205.1|679476_680313_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	56.9	2.1e-70
>prophage 2
NZ_LN831024	Pseudomonas aeruginosa strain NCTC10332 chromosome 1	6316979	2542181	2549074	6316979	tRNA	uncultured_Caudovirales_phage(83.33%)	9	NA	NA
WP_003097631.1|2542181_2543462_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.4	8.2e-98
WP_031685737.1|2543463_2544861_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_003160438.1|2544865_2545840_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_003160436.1|2545927_2546911_-	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	74.0	1.6e-141
WP_003119979.1|2546907_2547243_-	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	69.4	1.5e-38
WP_003090391.1|2547239_2547545_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_003090389.1|2547544_2547904_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	61.7	1.4e-34
WP_003090387.1|2547900_2548296_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	72.1	2.7e-47
WP_003090386.1|2548405_2549074_-	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	82.1	1.5e-90
>prophage 3
NZ_LN831024	Pseudomonas aeruginosa strain NCTC10332 chromosome 1	6316979	2837937	2876390	6316979	tail,plate	Planktothrix_phage(33.33%)	33	NA	NA
WP_003114503.1|2837937_2839221_-|tail	pyoverdine-tailoring periplasmic protein PvdN	tail	NA	NA	NA	NA
WP_003450962.1|2839243_2840590_-|tail	pyoverdine-tailoring dipeptidase-like protein PvdM	tail	NA	NA	NA	NA
WP_003163333.1|2840803_2842450_+	pyoverdine maturation tyrosinase PvdP	NA	NA	NA	NA	NA
WP_004343750.1|2842498_2843923_-	pyoverdine export/recycling transporter outer membrane subunit OmpQ	NA	NA	NA	NA	NA
WP_003131508.1|2843928_2845920_-	pyoverdine export/recycling transporter ATP-binding/permease subunit PvdT	NA	G9BWD6	Planktothrix_phage	39.3	6.9e-35
WP_003089547.1|2845919_2847095_-	pyoverdine export/recycling transporter periplasmic adaptor subunit PvdR	NA	NA	NA	NA	NA
WP_003144014.1|2847195_2848191_-	FecR family protein	NA	NA	NA	NA	NA
WP_003122684.1|2848351_2848831_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_003089540.1|2848947_2850279_+	SidA/IucD/PvdA family monooxygenase	NA	NA	NA	NA	NA
WP_016561917.1|2850401_2852690_+	acylase	NA	NA	NA	NA	NA
WP_003089535.1|2852870_2853194_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_003114511.1|2853235_2854156_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_048521088.1|2854252_2855404_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_003089526.1|2855470_2855713_-	DUF1654 domain-containing protein	NA	NA	NA	NA	NA
WP_003104944.1|2856007_2856244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003089521.1|2856508_2856979_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_003114512.1|2856975_2859291_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	NA	NA	NA	NA
WP_169787788.1|2859707_2860913_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003110901.1|2861113_2861755_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003089513.1|2862031_2862427_+	DUF4280 domain-containing protein	NA	NA	NA	NA	NA
WP_003104933.1|2862449_2862986_-	toxin-antitoxin system YwqK family antitoxin	NA	NA	NA	NA	NA
WP_003122692.1|2862996_2865003_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	29.3	1.3e-41
WP_003104930.1|2865002_2865191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003122693.1|2865350_2865923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048521090.1|2865944_2868494_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	29.4	1.2e-76
WP_003114517.1|2868495_2869512_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_023096719.1|2869475_2871269_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_031632859.1|2871252_2871678_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_003089495.1|2871690_2872188_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_003089494.1|2872261_2873746_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_003089493.1|2873768_2874314_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_003104701.1|2874522_2874999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003124583.1|2875058_2876390_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 4
NZ_LN831024	Pseudomonas aeruginosa strain NCTC10332 chromosome 1	6316979	4217984	4229039	6316979	capsid,integrase,tRNA	Pseudomonas_phage(75.0%)	14	4216203:4216219	4222810:4222826
4216203:4216219	attL	GCTGGCCTTCTTCGGCG	NA	NA	NA	NA
WP_003082462.1|4217984_4218809_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	73.7	1.4e-106
WP_012614375.1|4218914_4219931_-|integrase	tyrosine-type recombinase/integrase	integrase	Q56VN7	Pseudomonas_phage	99.7	5.0e-191
WP_012614376.1|4219930_4221223_-	hypothetical protein	NA	Q56VN8	Pseudomonas_phage	96.8	3.4e-253
WP_023127904.1|4221451_4222726_-	zonular occludens toxin family protein	NA	Q56VN9	Pseudomonas_phage	88.7	6.1e-202
WP_003114150.1|4222729_4223086_-	DUF2523 domain-containing protein	NA	Q56VP0	Pseudomonas_phage	100.0	7.9e-59
4222810:4222826	attR	CGCCGAAGAAGGCCAGC	NA	NA	NA	NA
WP_048521242.1|4223090_4224365_-	hypothetical protein	NA	Q56VP1	Pseudomonas_phage	57.7	1.9e-54
WP_023127902.1|4224512_4224761_-|capsid	major capsid protein	capsid	Q56VP2	Pseudomonas_phage	91.5	1.3e-31
WP_023127901.1|4224773_4225025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023127899.1|4225146_4225581_-	hypothetical protein	NA	Q56VP5	Pseudomonas_phage	95.8	6.5e-63
WP_033980247.1|4226096_4226384_-	DUF5447 family protein	NA	Q56VP7	Pseudomonas_phage	94.7	2.0e-52
WP_048521249.1|4226382_4226601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022581007.1|4226606_4226822_-	DNA-binding protein	NA	Q56VP9	Pseudomonas_phage	93.0	1.4e-34
WP_078801527.1|4227778_4228768_-	RNA-directed DNA polymerase	NA	E5E3S8	Burkholderia_phage	33.2	1.6e-32
WP_071535631.1|4228712_4229039_-	helix-turn-helix transcriptional regulator	NA	E5E3S9	Burkholderia_phage	43.7	5.3e-17
>prophage 5
NZ_LN831024	Pseudomonas aeruginosa strain NCTC10332 chromosome 1	6316979	4673892	4765316	6316979	protease,capsid,terminase,plate,head,tRNA,holin,tail,integrase	Pseudomonas_virus(64.15%)	110	4756725:4756750	4766479:4766504
WP_003085581.1|4673892_4674297_+|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_003145751.1|4674395_4675148_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003085577.1|4675279_4675852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003123029.1|4675956_4676697_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	A0A1B0XTP2	Freshwater_phage	26.4	6.4e-10
WP_003085573.1|4676693_4677662_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_003101974.1|4677752_4678499_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_003101972.1|4678491_4679193_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_003085566.1|4679253_4680171_-	GTPase Era	NA	NA	NA	NA	NA
WP_003085565.1|4680163_4680853_-	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.4	7.2e-24
WP_003085562.1|4680849_4681227_-	DUF4845 domain-containing protein	NA	NA	NA	NA	NA
WP_003101969.1|4681395_4682250_-	signal peptidase I	NA	NA	NA	NA	NA
WP_003085555.1|4682255_4684055_-	elongation factor 4	NA	A0A2K9L2P9	Tupanvirus	38.5	1.5e-20
WP_003114183.1|4684204_4685629_-|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	32.4	2.6e-28
WP_003110245.1|4685668_4686124_-	SoxR reducing system RseC family protein	NA	NA	NA	NA	NA
WP_003101960.1|4686120_4687071_-	sigma factor AlgU regulatory protein MucB	NA	NA	NA	NA	NA
WP_003101958.1|4687079_4687664_-	sigma-E factor negative regulatory protein	NA	NA	NA	NA	NA
WP_003085543.1|4687695_4688277_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_003101954.1|4688685_4690302_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_003114181.1|4690270_4690723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003145753.1|4690706_4690961_-	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_003101947.1|4691233_4692178_+	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_003085528.1|4692278_4693115_+	HDOD domain-containing protein	NA	A0A1C3NFB0	Phage_NCTB	36.6	2.5e-26
WP_003101943.1|4693122_4694505_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_003085524.1|4694497_4695169_-	response regulator	NA	NA	NA	NA	NA
WP_003116508.1|4695379_4696663_+	OprD family porin	NA	NA	NA	NA	NA
WP_003085519.1|4696692_4697676_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003101933.1|4697724_4698195_+	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
WP_003116509.1|4698205_4699723_+	tripartite tricarboxylate transporter permease	NA	NA	NA	NA	NA
WP_003114172.1|4699715_4700753_+	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_003106436.1|4700879_4701575_-	uracil-DNA glycosylase	NA	A0A0A7D9F8	Equid_alphaherpesvirus	45.2	1.0e-49
WP_003106439.1|4701674_4702496_-	VanW family protein	NA	NA	NA	NA	NA
WP_003106441.1|4702552_4703434_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_003106449.1|4703566_4705075_+	CoA-acylating methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003085499.1|4705086_4706250_+	isobutyryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_003085498.1|4706315_4707134_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_003114169.1|4707192_4708296_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_003454697.1|4708407_4709304_+	3-hydroxyisobutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_003085490.1|4709360_4710005_+	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_023107222.1|4710120_4710762_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003161664.1|4710796_4712773_-	alkyl/aryl-sulfatase	NA	M1I0S7	Paramecium_bursaria_Chlorella_virus	44.8	1.8e-160
WP_048521439.1|4712875_4713790_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_034012783.1|4713793_4713982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003085479.1|4714104_4714350_-	DUF1145 domain-containing protein	NA	NA	NA	NA	NA
WP_003114164.1|4714466_4714922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003098355.1|4715017_4715197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003114162.1|4715429_4716506_+	DUF2157 domain-containing protein	NA	NA	NA	NA	NA
WP_003163339.1|4716502_4717318_+	DUF4824 family protein	NA	NA	NA	NA	NA
WP_012614483.1|4717338_4717611_+	cysteine-rich CWC family protein	NA	NA	NA	NA	NA
WP_003124251.1|4717610_4718303_+	16S rRNA pseudouridine(516) synthase	NA	NA	NA	NA	NA
WP_003098363.1|4718438_4719482_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_003114158.1|4719561_4720299_+	murein L,D-transpeptidase catalytic domain family protein	NA	NA	NA	NA	NA
WP_003123042.1|4720750_4721653_+	(R)-3-hydroxydecanoyl-ACP:CoA transacylase	NA	NA	NA	NA	NA
WP_048521442.1|4722645_4723371_+	zeta toxin family protein	NA	NA	NA	NA	NA
WP_031299630.1|4724662_4726423_-|terminase	terminase ATPase subunit family protein	terminase	Q9ZXM5	Pseudomonas_virus	100.0	0.0e+00
WP_048521449.1|4726578_4727400_+|capsid	GPO family capsid scaffolding protein	capsid	Q9ZXM4	Pseudomonas_virus	99.6	4.4e-129
WP_033973071.1|4727435_4728452_+|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	99.1	2.9e-191
WP_022580432.1|4728457_4729159_+|terminase	terminase endonuclease subunit	terminase	Q9ZXM2	Pseudomonas_virus	98.7	8.1e-124
WP_023876114.1|4729262_4729724_+|head	head completion/stabilization protein	head	Q9ZXM1	Pseudomonas_virus	99.3	3.6e-80
WP_003098378.1|4729723_4729936_+|tail	tail protein X	tail	Q9ZXL9	Pseudomonas_virus	94.1	4.9e-32
WP_003098379.1|4729960_4730314_+	hypothetical protein	NA	Q9ZXL8	Pseudomonas_virus	100.0	6.0e-59
WP_003098380.1|4730315_4730588_+|holin	phage holin family protein	holin	Q9ZXL7	Pseudomonas_virus	97.8	2.6e-38
WP_048521455.1|4730584_4731391_+	N-acetylmuramidase family protein	NA	Q9ZXL6	Pseudomonas_virus	98.9	5.3e-151
WP_023127413.1|4731387_4731849_+	hypothetical protein	NA	Q9ZXL5	Pseudomonas_virus	98.7	4.7e-72
WP_016852031.1|4731929_4732466_+|tail	phage tail protein	tail	Q9ZXL3	Pseudomonas_virus	98.9	7.9e-95
WP_048521459.1|4732458_4732917_+	phage virion morphogenesis protein	NA	Q9ZXL2	Pseudomonas_virus	90.0	3.7e-69
WP_048521462.1|4732926_4733355_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_048521465.1|4733532_4734105_+|plate	phage baseplate assembly protein V	plate	Q9ZXL0	Pseudomonas_virus	98.4	3.0e-92
WP_033942401.1|4734101_4734446_+	GPW/gp25 family protein	NA	Q9ZXK9	Pseudomonas_virus	96.5	2.3e-55
WP_023083454.1|4734442_4735357_+|plate	baseplate assembly protein	plate	Q9ZXK8	Pseudomonas_virus	99.7	5.6e-165
WP_015967199.1|4735356_4735893_+|tail	phage tail protein I	tail	Q9ZXK7	Pseudomonas_virus	100.0	1.4e-99
WP_048521472.1|4735894_4738183_+|tail	phage tail protein	tail	Q9ZXK6	Pseudomonas_virus	98.8	0.0e+00
WP_048654715.1|4738191_4738638_+|tail	phage tail protein	tail	Q9ZXK5	Pseudomonas_virus	98.6	2.2e-82
WP_048521473.1|4738728_4739904_+|tail	phage tail sheath protein	tail	Q9ZXK4	Pseudomonas_virus	99.5	9.2e-221
WP_023083450.1|4739960_4740476_+|tail	phage major tail tube protein	tail	Q9ZXK3	Pseudomonas_virus	94.2	2.1e-89
WP_023083449.1|4740530_4740860_+|tail	phage tail assembly protein	tail	Q9ZXK2	Pseudomonas_virus	96.3	5.3e-49
WP_003098394.1|4740868_4740988_+|tail	GpE family phage tail protein	tail	Q9ZXK1	Pseudomonas_virus	100.0	1.8e-15
WP_015967206.1|4743696_4744137_+|tail	phage tail protein	tail	Q9ZXJ9	Pseudomonas_virus	100.0	6.1e-77
WP_048521483.1|4744133_4745405_+	phage late control D family protein	NA	Q9ZXJ8	Pseudomonas_virus	98.6	8.4e-236
WP_139373600.1|4745486_4746176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048521486.1|4746189_4746540_-	hypothetical protein	NA	Q9ZXJ5	Pseudomonas_virus	94.0	1.2e-56
WP_048521767.1|4746858_4747200_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JFL3	uncultured_Caudovirales_phage	53.3	2.0e-22
WP_023876135.1|4747284_4747497_+	DNA-binding protein	NA	A0A2H4JE67	uncultured_Caudovirales_phage	48.4	1.1e-07
WP_023127024.1|4747526_4747997_+	hypothetical protein	NA	Q9ZXJ2	Pseudomonas_virus	98.1	5.5e-76
WP_003098408.1|4747993_4748287_+	ogr/Delta-like zinc finger family protein	NA	Q9ZXJ1	Pseudomonas_virus	99.0	1.1e-50
WP_023096288.1|4748283_4748634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003098410.1|4748710_4748944_+	hypothetical protein	NA	Q9ZXI9	Pseudomonas_virus	100.0	7.8e-39
WP_048521489.1|4748940_4751661_+	toprim domain-containing protein	NA	Q9ZXI8	Pseudomonas_virus	96.9	0.0e+00
WP_033976929.1|4751705_4752059_+	hypothetical protein	NA	Q9ZXI7	Pseudomonas_virus	94.9	2.1e-59
WP_023127425.1|4752070_4752277_+	TraR/DksA family transcriptional regulator	NA	Q9ZXI6	Pseudomonas_virus	98.5	7.3e-33
WP_033985154.1|4752336_4752777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016852055.1|4752773_4752950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166737200.1|4753051_4753228_+	hypothetical protein	NA	Q38017	Pseudomonas_virus	79.4	6.5e-06
WP_034018193.1|4753224_4753851_+	hypothetical protein	NA	Q5QF31	Pseudomonas_virus	63.4	2.4e-66
WP_023127212.1|4753847_4754705_+	DNA adenine methylase	NA	Q5QF26	Pseudomonas_virus	77.1	5.6e-127
WP_031293860.1|4754698_4754935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048521503.1|4754927_4755131_+	hypothetical protein	NA	A0A2H4J958	uncultured_Caudovirales_phage	50.0	3.3e-09
WP_003098423.1|4755123_4755327_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_023115037.1|4755333_4756536_-|integrase	integrase family protein	integrase	A0A248SL35	Klebsiella_phage	30.9	2.2e-36
4756725:4756750	attL	GTTCGATTCCCTTCGCCCGCTCCAGA	NA	NA	NA	NA
WP_034068863.1|4757085_4758075_-|integrase	tyrosine-type recombinase/integrase	integrase	Q56VN7	Pseudomonas_phage	52.4	3.6e-93
WP_023088869.1|4758074_4759367_-	hypothetical protein	NA	Q56VN8	Pseudomonas_phage	93.8	2.4e-246
WP_048521508.1|4759625_4760888_-	hypothetical protein	NA	Q56VN9	Pseudomonas_phage	53.1	3.2e-110
WP_003159569.1|4760889_4761240_-	DUF2523 domain-containing protein	NA	Q56VP0	Pseudomonas_phage	41.1	5.5e-20
WP_048521518.1|4761249_4761858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048521521.1|4762513_4762732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003124954.1|4762745_4762997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003140508.1|4763117_4763552_-	hypothetical protein	NA	Q56VP5	Pseudomonas_phage	100.0	3.8e-63
WP_079455004.1|4764068_4764359_-	DUF5447 family protein	NA	Q56VP7	Pseudomonas_phage	94.8	3.7e-54
WP_021264265.1|4764362_4764575_-	hypothetical protein	NA	Q56VP8	Pseudomonas_phage	97.1	8.9e-34
WP_003159564.1|4764576_4764792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078801571.1|4764893_4765316_+	Arc family DNA-binding protein	NA	G9L6D6	Escherichia_phage	37.5	2.2e-07
4766479:4766504	attR	GTTCGATTCCCTTCGCCCGCTCCAGA	NA	NA	NA	NA
>prophage 6
NZ_LN831024	Pseudomonas aeruginosa strain NCTC10332 chromosome 1	6316979	5426787	5434139	6316979	integrase	Pseudomonas_phage(100.0%)	9	5424746:5424772	5434167:5434193
5424746:5424772	attL	TGGCGGAAGGCAGTGGGAGTCGAACCC	NA	NA	NA	NA
WP_023088865.1|5426787_5427078_+	DUF5447 family protein	NA	Q56VP7	Pseudomonas_phage	99.0	6.7e-56
WP_003140508.1|5427616_5428051_+	hypothetical protein	NA	Q56VP5	Pseudomonas_phage	100.0	3.8e-63
WP_003124954.1|5428171_5428423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003124953.1|5428436_5428655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003163344.1|5429310_5429919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003159569.1|5429928_5430279_+	DUF2523 domain-containing protein	NA	Q56VP0	Pseudomonas_phage	41.1	5.5e-20
WP_048521700.1|5430280_5431543_+	hypothetical protein	NA	Q56VN9	Pseudomonas_phage	56.7	7.1e-118
WP_048521701.1|5431800_5433099_+	hypothetical protein	NA	Q56VN8	Pseudomonas_phage	99.5	1.1e-259
WP_016264131.1|5433098_5434139_+|integrase	tyrosine-type recombinase/integrase	integrase	Q56VN7	Pseudomonas_phage	56.7	8.1e-104
5434167:5434193	attR	TGGCGGAAGGCAGTGGGAGTCGAACCC	NA	NA	NA	NA
