The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010051	Xylella fastidiosa strain Fb7 chromosome, complete genome	2659912	495016	503387	2659912	terminase	Xylella_phage(16.67%)	9	NA	NA
WP_109161028.1|495016_495757_-	helix-turn-helix transcriptional regulator	NA	C8CLH0	Xylella_phage	36.6	1.4e-33
WP_088372250.1|496103_496343_+	helix-turn-helix domain-containing protein	NA	D0UIL8	Aggregatibacter_phage	49.2	3.1e-06
WP_088371816.1|496737_497361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162597441.1|497424_497646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162597442.1|497642_497870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088371446.1|497862_498918_+	DNA primase	NA	A0A1S5RF89	Helicobacter_phage	40.5	1.3e-11
WP_109160966.1|498914_500381_+	virulence factor	NA	A0A2D1GN57	Marinobacter_phage	32.5	4.3e-58
WP_088371448.1|500775_501384_+	hypothetical protein	NA	A0A2I7S8M0	Vibrio_phage	40.7	6.6e-05
WP_109160967.1|501380_503387_+|terminase	phage terminase large subunit family protein	terminase	A0A1B2LRQ2	Wolbachia_phage	30.2	5.5e-72
>prophage 2
NZ_CP010051	Xylella fastidiosa strain Fb7 chromosome, complete genome	2659912	820009	832569	2659912	integrase,tRNA	Xylella_phage(33.33%)	13	816708:816721	835454:835467
816708:816721	attL	ATGGCGGCTGGTTT	NA	NA	NA	NA
WP_060870295.1|820009_820711_-	site-specific DNA-methyltransferase	NA	A0A097EWK8	Mycobacterium_phage	52.2	1.2e-58
WP_023906287.1|820825_821041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088371691.1|821091_822504_-	DEAD/DEAH box helicase	NA	C8CLF7	Xylella_phage	92.9	2.5e-220
WP_023907477.1|822567_822873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023906708.1|822874_823153_-	VRR-NUC domain-containing protein	NA	C8CLF9	Xylella_phage	96.7	2.5e-44
WP_088372230.1|824771_825086_+	hypothetical protein	NA	C8CLF7	Xylella_phage	89.2	8.3e-28
WP_010894737.1|825082_825379_+	DUF4224 domain-containing protein	NA	A0A2H4JF29	uncultured_Caudovirales_phage	48.1	4.5e-07
WP_010894736.1|825390_826452_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JDJ8	uncultured_Caudovirales_phage	53.5	4.4e-97
WP_010894735.1|826687_827383_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_010894734.1|827504_828785_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.2	6.5e-95
WP_010894731.1|829590_830544_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_010894730.1|830842_831637_+	ParA family protein	NA	A0A0K2FLP4	Brevibacillus_phage	29.7	8.0e-19
WP_010894729.1|831636_832569_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	36.6	3.7e-15
835454:835467	attR	ATGGCGGCTGGTTT	NA	NA	NA	NA
>prophage 3
NZ_CP010051	Xylella fastidiosa strain Fb7 chromosome, complete genome	2659912	923169	938809	2659912		Haemophilus_phage(35.71%)	24	NA	NA
WP_109160982.1|923169_924153_+	DUF2184 domain-containing protein	NA	A0A2R3UA82	Siphoviridae_environmental_samples	39.7	7.6e-51
WP_162597431.1|924923_925355_+	hypothetical protein	NA	M4SN98	Psychrobacter_phage	28.5	1.6e-05
WP_088371577.1|925335_925716_+	hypothetical protein	NA	Q776V7	Haemophilus_phage	39.1	1.0e-16
WP_088371575.1|925702_926173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088371573.1|926173_927670_+	DUF3383 domain-containing protein	NA	Q7Y5T5	Haemophilus_phage	47.4	3.1e-120
WP_023907683.1|927679_928117_+	DUF3277 family protein	NA	Q7Y5T4	Haemophilus_phage	62.4	1.8e-44
WP_162597432.1|928456_928630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162597446.1|928778_929075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109161035.1|929176_930571_+	hypothetical protein	NA	D0UII2	Aggregatibacter_phage	33.5	1.7e-16
WP_088371569.1|930899_931076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088371567.1|931109_931298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088372206.1|931302_931473_-	antitoxin	NA	NA	NA	NA	NA
WP_060871810.1|931525_931801_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5SB46	Streptococcus_phage	43.9	3.5e-14
WP_031336679.1|931784_932012_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_088371565.1|932120_932891_+	hypothetical protein	NA	Q7Y5T0	Haemophilus_phage	33.3	2.0e-27
WP_010894089.1|932890_933208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088371563.1|933204_934035_+	hypothetical protein	NA	D0UIH8	Aggregatibacter_phage	52.6	1.4e-77
WP_088371561.1|934031_934673_+	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	38.4	3.5e-33
WP_088372030.1|934669_935023_+	hypothetical protein	NA	Q7Y5S5	Haemophilus_phage	47.0	1.4e-23
WP_004085592.1|935078_935372_-	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	37.9	6.2e-09
WP_010894094.1|935374_935671_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	53.7	3.4e-23
WP_031336674.1|936271_936718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023906642.1|936959_937937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023906641.1|937933_938809_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.2	8.3e-09
>prophage 4
NZ_CP010051	Xylella fastidiosa strain Fb7 chromosome, complete genome	2659912	1104161	1110695	2659912	integrase	Xylella_phage(50.0%)	10	1102589:1102601	1111510:1111522
1102589:1102601	attL	GCTCTATCCACAG	NA	NA	NA	NA
WP_109160986.1|1104161_1105181_-|integrase	tyrosine-type recombinase/integrase	integrase	C8CLF4	Xylella_phage	87.3	8.7e-167
WP_088371973.1|1105180_1105429_-	DUF4224 domain-containing protein	NA	C8CLF5	Xylella_phage	81.7	1.0e-33
WP_069107098.1|1105447_1105903_-	single-stranded DNA-binding protein	NA	L7TJL2	Pseudomonas_virus	50.3	4.7e-32
WP_088372258.1|1105972_1106773_-	hypothetical protein	NA	Q7Y5V4	Haemophilus_phage	63.8	1.2e-35
WP_162597449.1|1106866_1107187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088371971.1|1107123_1108767_-	hypothetical protein	NA	U6C712	Ralstonia_phage	39.6	2.1e-101
WP_088371969.1|1108763_1109690_-	phage recombination protein Bet	NA	U6C6J0	Ralstonia_phage	48.9	2.1e-58
WP_088371617.1|1109884_1110076_-	hypothetical protein	NA	C8CLG6	Xylella_phage	70.3	3.4e-16
WP_010894147.1|1110099_1110291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088371615.1|1110287_1110695_-	hypothetical protein	NA	C8CLG7	Xylella_phage	73.3	1.0e-46
1111510:1111522	attR	CTGTGGATAGAGC	NA	NA	NA	NA
>prophage 5
NZ_CP010051	Xylella fastidiosa strain Fb7 chromosome, complete genome	2659912	1116526	1148044	2659912	terminase,capsid,tail	Haemophilus_phage(20.69%)	44	NA	NA
WP_088371603.1|1116526_1117639_+	hypothetical protein	NA	C8CLG1	Xylella_phage	57.0	5.6e-111
WP_031336699.1|1117635_1117944_+	DUF1376 domain-containing protein	NA	A0A0R6PIU3	Moraxella_phage	45.6	1.4e-14
WP_088371599.1|1118771_1119461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088372210.1|1119508_1119898_+	hypothetical protein	NA	A0A088F6Y8	Sulfitobacter_phage	44.7	7.4e-10
WP_088371597.1|1119894_1120593_+	hypothetical protein	NA	C8CLH7	Xylella_phage	84.3	1.0e-102
WP_088371595.1|1120931_1121162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088371594.1|1121203_1121944_+	hypothetical protein	NA	A0A0K1LTX3	Mycobacterium_phage	36.4	4.7e-13
WP_088371592.1|1122135_1122636_+	lysozyme	NA	I2GUG4	Acinetobacter_phage	50.7	3.3e-26
WP_088371590.1|1122628_1122958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023906542.1|1122947_1123409_+	hypothetical protein	NA	A0A0S0N8C8	Pseudomonas_phage	33.6	2.1e-11
WP_042463172.1|1123410_1123623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023907697.1|1123712_1124111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088371588.1|1124061_1125612_+|terminase	phage terminase large subunit	terminase	H9C0C7	Vibrio_phage	45.1	4.2e-112
WP_162597433.1|1126033_1127038_+	DUF1073 domain-containing protein	NA	L7TRA1	Rhizobium_phage	35.1	1.0e-42
WP_088371586.1|1126949_1127795_+|capsid	minor capsid protein	capsid	Q7Y5U5	Haemophilus_phage	31.5	2.9e-27
WP_088371585.1|1127794_1128985_+	DUF2213 domain-containing protein	NA	H9C194	Pectobacterium_phage	41.3	5.6e-40
WP_109160982.1|1129503_1130487_+	DUF2184 domain-containing protein	NA	A0A2R3UA82	Siphoviridae_environmental_samples	39.7	7.6e-51
WP_088371579.1|1130934_1131690_+	DUF4054 domain-containing protein	NA	M4SN98	Psychrobacter_phage	26.0	6.7e-07
WP_088371577.1|1131670_1132051_+	hypothetical protein	NA	Q776V7	Haemophilus_phage	39.1	1.0e-16
WP_088371575.1|1132037_1132508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088371573.1|1132508_1134005_+	DUF3383 domain-containing protein	NA	Q7Y5T5	Haemophilus_phage	47.4	3.1e-120
WP_023907683.1|1134014_1134452_+	DUF3277 family protein	NA	Q7Y5T4	Haemophilus_phage	62.4	1.8e-44
WP_162597432.1|1134791_1134965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088371571.1|1135017_1136907_+	hypothetical protein	NA	A0A2I7RBK9	Vibrio_phage	33.6	2.0e-31
WP_088371569.1|1137235_1137412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088371567.1|1137445_1137634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088372206.1|1137638_1137809_-	antitoxin	NA	NA	NA	NA	NA
WP_060871810.1|1137861_1138137_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5SB46	Streptococcus_phage	43.9	3.5e-14
WP_031336679.1|1138120_1138348_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_088371565.1|1138456_1139227_+	hypothetical protein	NA	Q7Y5T0	Haemophilus_phage	33.3	2.0e-27
WP_010894089.1|1139226_1139544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088371563.1|1139540_1140371_+	hypothetical protein	NA	D0UIH8	Aggregatibacter_phage	52.6	1.4e-77
WP_088371561.1|1140367_1141009_+	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	38.4	3.5e-33
WP_060872218.1|1141005_1141359_+	hypothetical protein	NA	Q7Y5S5	Haemophilus_phage	47.8	3.7e-24
WP_060872107.1|1141369_1141675_-	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	43.6	1.1e-11
WP_060872108.1|1141671_1141974_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	58.1	3.4e-26
WP_088371557.1|1143213_1143774_+	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	26.1	1.4e-06
WP_060872110.1|1143777_1144941_+|tail	tail fiber protein	tail	A4PE46	Ralstonia_virus	32.7	1.9e-08
WP_088371555.1|1144937_1145171_-	hypothetical protein	NA	C8CLJ6	Xylella_phage	58.0	2.7e-15
WP_088371553.1|1145170_1145737_-	SocA family protein	NA	I6R0L8	Salmonella_phage	32.5	1.8e-17
WP_088372204.1|1145708_1145981_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_081089730.1|1146004_1146358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060870179.1|1146365_1147382_-	peptidase M4 family protein	NA	NA	NA	NA	NA
WP_010894181.1|1147711_1148044_+	DNA-binding transcriptional regulator	NA	A0A0P0IRJ4	Acinetobacter_phage	40.7	7.0e-17
>prophage 6
NZ_CP010051	Xylella fastidiosa strain Fb7 chromosome, complete genome	2659912	1175505	1186140	2659912		Xanthomonas_phage(50.0%)	18	NA	NA
WP_088371543.1|1175505_1176579_+	Zonular occludens toxin	NA	Q6UAZ2	Ralstonia_phage	29.3	4.3e-23
WP_010894337.1|1176755_1177004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109160989.1|1177066_1177354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088371541.1|1177575_1177926_+	hypothetical protein	NA	Q38057	Xanthomonas_phage	53.1	2.4e-07
WP_058570074.1|1177988_1178267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088371531.1|1178499_1179651_-	hypothetical protein	NA	S0F3F8	Stenotrophomonas_phage	59.2	2.8e-113
WP_088371529.1|1179655_1180027_-	DUF2523 domain-containing protein	NA	A0A1D6ZIU0	Xanthomonas_phage	46.8	3.1e-21
WP_109160990.1|1180032_1181517_-	hypothetical protein	NA	A0A1W6DXV5	Xanthomonas_phage	45.3	5.5e-37
WP_038227439.1|1181619_1181865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031336583.1|1181861_1182065_-	hypothetical protein	NA	S0F2M5	Stenotrophomonas_phage	60.0	2.8e-16
WP_088371527.1|1182076_1182391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088371525.1|1182431_1183607_-	Replication initiation factor	NA	S0F3F7	Stenotrophomonas_phage	46.1	5.6e-77
WP_109160991.1|1184218_1184401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162597451.1|1184413_1184617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088371539.1|1184620_1184887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109160992.1|1184879_1185200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162597452.1|1185357_1185750_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_109160994.1|1185792_1186140_+	hypothetical protein	NA	Q38057	Xanthomonas_phage	47.5	1.1e-07
>prophage 7
NZ_CP010051	Xylella fastidiosa strain Fb7 chromosome, complete genome	2659912	1464880	1474805	2659912	integrase,terminase	Vibrio_phage(16.67%)	16	1459289:1459305	1474231:1474247
1459289:1459305	attL	GGTCGCGGCGGCGGCAA	NA	NA	NA	NA
WP_088371941.1|1464880_1466092_-|integrase	tyrosine-type recombinase/integrase	integrase	T1S9J3	Salmonella_phage	39.0	1.4e-67
WP_088371943.1|1466233_1466509_-	hypothetical protein	NA	A0A2R3UAA5	Siphoviridae_environmental_samples	49.1	2.3e-05
WP_088371944.1|1466505_1468056_-|terminase	phage terminase large subunit	terminase	H9C0C7	Vibrio_phage	44.9	1.6e-111
WP_060872197.1|1468006_1468405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023907984.1|1468710_1469172_-	hypothetical protein	NA	A0A0S0N8C8	Pseudomonas_phage	32.8	1.0e-10
WP_088371946.1|1469161_1469491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088371947.1|1469483_1469984_-	lysozyme	NA	A0A2I7RLY1	Vibrio_phage	51.7	5.0e-27
WP_004085696.1|1470188_1470527_-	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	54.9	1.0e-07
WP_010894061.1|1470513_1470780_-	hypothetical protein	NA	K4NX81	Burkholderia_phage	40.7	8.1e-08
WP_088372256.1|1471661_1472051_-	hypothetical protein	NA	A0A088F6Y8	Sulfitobacter_phage	44.7	7.4e-10
WP_088371599.1|1472098_1472788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109161007.1|1472768_1473620_-	YdaU family protein	NA	A0A142K7R2	Mycobacterium_phage	60.6	4.0e-16
WP_031336699.1|1473616_1473925_-	DUF1376 domain-containing protein	NA	A0A0R6PIU3	Moraxella_phage	45.6	1.4e-14
WP_109161008.1|1473921_1474269_-	hypothetical protein	NA	C8CLG1	Xylella_phage	85.0	2.9e-50
1474231:1474247	attR	GGTCGCGGCGGCGGCAA	NA	NA	NA	NA
WP_010894057.1|1474298_1474538_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_109161009.1|1474556_1474805_+	DUF4224 domain-containing protein	NA	C8CLF5	Xylella_phage	81.7	2.3e-33
>prophage 8
NZ_CP010051	Xylella fastidiosa strain Fb7 chromosome, complete genome	2659912	1802915	1810097	2659912	integrase	Stenotrophomonas_phage(50.0%)	11	1800917:1800968	1810114:1810165
1800917:1800968	attL	CGGACTTTTAATCCGCTGGTCGCTGGTTCGATTCCAGCACGGCCCACCAGCT	NA	NA	NA	NA
WP_088371312.1|1802915_1804091_+	Replication initiation factor	NA	S0F3F7	Stenotrophomonas_phage	45.5	4.3e-77
WP_088371310.1|1804131_1804443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088372171.1|1804549_1804831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088371308.1|1804830_1805040_+	hypothetical protein	NA	S0F2M5	Stenotrophomonas_phage	65.0	1.3e-16
WP_081089812.1|1805105_1805273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162597456.1|1805351_1806806_+	hypothetical protein	NA	A0A1D6ZIU5	Xanthomonas_phage	49.2	7.2e-58
WP_060872048.1|1806809_1807151_+	DUF2523 domain-containing protein	NA	A0A1D6ZIU0	Xanthomonas_phage	47.7	6.3e-21
WP_088371305.1|1807150_1808284_+	hypothetical protein	NA	S0F3F8	Stenotrophomonas_phage	58.6	4.5e-124
WP_088371303.1|1808338_1808746_+	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
WP_058569894.1|1808771_1809005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088371301.1|1809266_1810097_+|integrase	site-specific integrase	integrase	Q7Y5X7	Haemophilus_phage	45.4	2.3e-61
1810114:1810165	attR	CGGACTTTTAATCCGCTGGTCGCTGGTTCGATTCCAGCACGGCCCACCAGCT	NA	NA	NA	NA
>prophage 9
NZ_CP010051	Xylella fastidiosa strain Fb7 chromosome, complete genome	2659912	2071733	2104554	2659912	terminase,tail	Haemophilus_phage(20.0%)	40	NA	NA
WP_023907957.1|2071733_2073371_+	response regulator	NA	A0A2K9L5I4	Tupanvirus	24.2	2.3e-12
WP_010893491.1|2073407_2074040_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_010893489.1|2074359_2074590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162597434.1|2074615_2074786_+	hypothetical protein	NA	C8CLF4	Xylella_phage	74.3	5.1e-08
WP_088578620.1|2074860_2075184_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_023907958.1|2076190_2076523_-	DNA-binding transcriptional regulator	NA	A0A0P0IRJ4	Acinetobacter_phage	40.7	1.4e-17
WP_023907959.1|2076927_2077476_+	SocA family protein	NA	I6R0L8	Salmonella_phage	39.4	9.5e-19
WP_088371902.1|2077435_2077762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088371904.1|2077761_2078031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088371906.1|2078044_2078296_+	hypothetical protein	NA	C8CLJ6	Xylella_phage	63.2	2.6e-16
WP_060872110.1|2078273_2079437_-|tail	tail fiber protein	tail	A4PE46	Ralstonia_virus	32.7	1.9e-08
WP_023906519.1|2081233_2081587_-	hypothetical protein	NA	Q7Y5S5	Haemophilus_phage	47.0	9.1e-23
WP_088371912.1|2081583_2082225_-	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	37.3	8.7e-32
WP_088371916.1|2083047_2083365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060870489.1|2084191_2084518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060870488.1|2084514_2084796_+	XRE family transcriptional regulator	NA	A0A2D1GR59	Pseudomonas_phage	51.4	8.8e-13
WP_088371920.1|2084854_2086744_-	hypothetical protein	NA	A0A2I7RBK9	Vibrio_phage	33.1	1.3e-30
WP_088371922.1|2086891_2087314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088371924.1|2087310_2087748_-	DUF3277 family protein	NA	Q7Y5T4	Haemophilus_phage	61.7	8.8e-44
WP_088371925.1|2087757_2089254_-	DUF3383 domain-containing protein	NA	Q7Y5T5	Haemophilus_phage	47.8	3.3e-122
WP_038227621.1|2089254_2089725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088371927.1|2089711_2090080_-	hypothetical protein	NA	Q776V7	Haemophilus_phage	37.7	1.0e-16
WP_088371929.1|2090066_2090546_-	hypothetical protein	NA	M4SN98	Psychrobacter_phage	26.7	1.9e-07
WP_023907976.1|2090542_2090911_-	DUF4054 domain-containing protein	NA	Q7Y5T9	Haemophilus_phage	37.4	1.5e-12
WP_023907977.1|2090913_2091213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023907978.1|2091278_2092262_-	DUF2184 domain-containing protein	NA	A0A2R3UA82	Siphoviridae_environmental_samples	39.3	9.9e-51
WP_023907979.1|2092271_2092754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088372157.1|2092781_2093972_-	DUF2213 domain-containing protein	NA	H9C194	Pectobacterium_phage	41.3	5.6e-40
WP_088372208.1|2094727_2096074_-	DUF1073 domain-containing protein	NA	H9C106	Vibrio_phage	39.2	1.8e-66
WP_109161017.1|2096154_2097705_-|terminase	phage terminase large subunit	terminase	H9C0C7	Vibrio_phage	45.1	9.3e-112
WP_060872197.1|2097655_2098054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023907984.1|2098359_2098821_-	hypothetical protein	NA	A0A0S0N8C8	Pseudomonas_phage	32.8	1.0e-10
WP_088371946.1|2098810_2099140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088371947.1|2099132_2099633_-	lysozyme	NA	A0A2I7RLY1	Vibrio_phage	51.7	5.0e-27
WP_088578171.1|2099815_2100097_+	excinuclease ABC subunit A	NA	NA	NA	NA	NA
WP_004089519.1|2100106_2100406_+	HigA family addiction module antidote protein	NA	M9MUN2	Rhodococcus_phage	45.9	1.1e-13
WP_088372256.1|2101182_2101572_-	hypothetical protein	NA	A0A088F6Y8	Sulfitobacter_phage	44.7	7.4e-10
WP_088371599.1|2101619_2102309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031336699.1|2103136_2103445_-	DUF1376 domain-containing protein	NA	A0A0R6PIU3	Moraxella_phage	45.6	1.4e-14
WP_088371603.1|2103441_2104554_-	hypothetical protein	NA	C8CLG1	Xylella_phage	57.0	5.6e-111
>prophage 10
NZ_CP010051	Xylella fastidiosa strain Fb7 chromosome, complete genome	2659912	2111709	2120395	2659912		Xylella_phage(18.18%)	12	NA	NA
WP_060870469.1|2111709_2112111_+	hypothetical protein	NA	C8CLG7	Xylella_phage	85.0	2.6e-58
WP_010894147.1|2112107_2112299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060870470.1|2112322_2112514_+	hypothetical protein	NA	C8CLG6	Xylella_phage	67.2	4.1e-14
WP_060870471.1|2112534_2112879_+	hypothetical protein	NA	U5P4J6	Shigella_phage	46.5	1.4e-15
WP_088371967.1|2112918_2113740_+	YfdQ family protein	NA	K7ZMK3	Xanthomonas_citri_phage	43.3	3.0e-53
WP_023908009.1|2113755_2114682_+	phage recombination protein Bet	NA	U6C6J0	Ralstonia_phage	48.6	1.0e-57
WP_088371619.1|2114678_2116322_+	hypothetical protein	NA	U6C712	Ralstonia_phage	38.2	1.1e-99
WP_088372212.1|2116669_2117467_+	hypothetical protein	NA	A0A077KC96	Edwardsiella_phage	65.7	3.1e-34
WP_088372214.1|2117475_2118009_+	hypothetical protein	NA	Q5QF30	Pseudomonas_virus	36.3	5.0e-25
WP_088371621.1|2118356_2119184_+	hypothetical protein	NA	A4PE61	Ralstonia_virus	44.4	1.3e-19
WP_088371623.1|2119180_2119894_+	DNA-binding protein	NA	G0ZND1	Cronobacter_phage	58.9	2.5e-43
WP_088371625.1|2119951_2120395_+	single-stranded DNA-binding protein	NA	L7TJL2	Pseudomonas_virus	53.2	2.9e-34
>prophage 11
NZ_CP010051	Xylella fastidiosa strain Fb7 chromosome, complete genome	2659912	2305041	2392704	2659912	plate,integrase,tail,terminase,capsid,tRNA	Xylella_phage(40.0%)	93	2350191:2350207	2392795:2392811
WP_010893307.1|2305041_2305776_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_162597462.1|2305772_2306600_-	thiazole synthase	NA	NA	NA	NA	NA
WP_031338046.1|2306615_2306816_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_010893304.1|2306957_2308751_+	autotransporter domain-containing esterase	NA	NA	NA	NA	NA
WP_162597463.1|2309517_2310192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031338047.1|2310198_2312292_+	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	37.2	1.0e-92
WP_031338048.1|2312652_2313087_-	phosphotransferase	NA	NA	NA	NA	NA
WP_023906986.1|2313064_2315431_-	MMPL family transporter	NA	NA	NA	NA	NA
WP_010893299.1|2315423_2315648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088372136.1|2315626_2316274_-	fatty acyl CoA synthetase	NA	NA	NA	NA	NA
WP_010893298.1|2316197_2317178_-	acyltransferase	NA	NA	NA	NA	NA
WP_010893297.1|2317174_2317462_-	beta-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
WP_155641428.1|2317511_2317676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010893295.1|2317703_2318444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010893294.1|2318418_2318688_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_088372132.1|2319051_2320032_+	pteridine-dependent deoxygenase	NA	NA	NA	NA	NA
WP_010893291.1|2320457_2321753_+	TIGR01244 family phosphatase	NA	NA	NA	NA	NA
WP_010893290.1|2321746_2322091_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010893289.1|2322087_2322495_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_010893288.1|2322491_2322932_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_088372130.1|2322928_2323714_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_010893285.1|2324286_2324862_+	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	67.7	2.8e-69
WP_088372128.1|2325130_2326093_-	DUF1684 domain-containing protein	NA	NA	NA	NA	NA
WP_088372126.1|2326092_2327952_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	36.2	4.0e-85
WP_010893281.1|2329764_2330253_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_088372122.1|2332188_2333523_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	34.5	2.5e-36
WP_010893277.1|2333588_2334446_-	virulence factor family protein	NA	NA	NA	NA	NA
WP_088372274.1|2334572_2336222_-	formylglycine-generating enzyme family protein	NA	A0A075BSL8	Microcystis_phage	34.8	1.3e-26
WP_088372120.1|2336497_2337586_+	ribonuclease D	NA	NA	NA	NA	NA
WP_010893272.1|2337864_2338269_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_010893271.1|2339054_2340110_-	23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM	NA	NA	NA	NA	NA
WP_080507228.1|2340257_2340857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023908099.1|2341093_2341237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031337099.1|2341805_2342162_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010893266.1|2342142_2342442_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.4	3.6e-12
WP_023908100.1|2342465_2344844_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_031337101.1|2344927_2345923_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	35.5	9.7e-30
WP_010893263.1|2346200_2346560_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_004090402.1|2346570_2346768_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_075584689.1|2347013_2347541_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.7	6.3e-12
WP_010893260.1|2347608_2349516_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.5	1.3e-126
2350191:2350207	attL	AATACACCAATACTGTA	NA	NA	NA	NA
WP_060872013.1|2351676_2351895_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_088372116.1|2351891_2352374_-|tail	phage tail protein	tail	A0A193GYE0	Enterobacter_phage	47.6	1.2e-28
WP_010894923.1|2354715_2355003_-|tail	phage tail assembly protein	tail	A0A193GYZ8	Enterobacter_phage	43.4	6.9e-13
WP_088372112.1|2355005_2355515_-|tail	phage major tail tube protein	tail	A0A088FRU2	Escherichia_phage	52.7	1.2e-47
WP_023907007.1|2355514_2356693_-|tail	phage tail sheath family protein	tail	A0A088FVH5	Escherichia_phage	56.3	4.4e-138
WP_088372110.1|2356757_2358350_-	hypothetical protein	NA	V9IQX0	Stenotrophomonas_phage	36.2	5.4e-83
WP_031336758.1|2358357_2358915_-|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	54.4	5.1e-52
WP_088372108.1|2358907_2359801_-|plate	baseplate assembly protein	plate	V9IQV9	Stenotrophomonas_phage	45.8	4.7e-68
WP_088372106.1|2359800_2360139_-|plate	phage baseplate protein	plate	A0A088FV58	Escherichia_phage	60.4	4.6e-32
WP_010894925.1|2360356_2360659_+	type II toxin-antitoxin system MqsR family toxin	NA	NA	NA	NA	NA
WP_060872143.1|2360661_2361063_+	type II toxin-antitoxin system MqsA family antitoxin	NA	NA	NA	NA	NA
WP_088372104.1|2361131_2361719_-|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_023907017.1|2361715_2362258_-	hypothetical protein	NA	D5LGZ6	Escherichia_phage	42.9	1.7e-36
WP_010893241.1|2362233_2362755_-	hypothetical protein	NA	D5LGZ7	Escherichia_phage	33.9	2.8e-12
WP_042462902.1|2362751_2363075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010893239.1|2363074_2363335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088372102.1|2363352_2365233_-|capsid	phage major capsid protein	capsid	V5YSS9	Pseudomonas_phage	48.4	4.2e-167
WP_088372096.1|2367361_2369314_-|terminase	phage terminase large subunit family protein	terminase	A0A088FQV3	Escherichia_phage	67.6	2.2e-251
WP_088372094.1|2369306_2369852_-	DNA-packaging protein	NA	A0A193GYK5	Enterobacter_phage	61.3	8.2e-47
WP_088372272.1|2370024_2370246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088372092.1|2370250_2370712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010893232.1|2370701_2371013_-	hypothetical protein	NA	A0A172PZR6	Pseudomonas_phage	43.0	2.0e-18
WP_088372270.1|2371483_2372101_-	hypothetical protein	NA	V5YTF6	Pseudomonas_phage	48.8	1.1e-26
WP_088372088.1|2372292_2372490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109161021.1|2373001_2375533_-	DNA primase	NA	C8CLH6	Xylella_phage	72.1	0.0e+00
WP_088372268.1|2375672_2376455_-	hypothetical protein	NA	C8CLH5	Xylella_phage	59.7	5.5e-28
WP_155115001.1|2376953_2377115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023907050.1|2377242_2377488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010894932.1|2377548_2377797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010894933.1|2377793_2377982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051372715.1|2378035_2378260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023907048.1|2378361_2378667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031338060.1|2378663_2378864_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_010894935.1|2378937_2379708_+	helix-turn-helix transcriptional regulator	NA	C8CLH0	Xylella_phage	34.5	6.0e-27
WP_010894936.1|2379876_2380416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052262873.1|2380452_2380764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010894938.1|2380951_2381407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010894939.1|2381512_2381902_+	hypothetical protein	NA	C8CLG9	Xylella_phage	37.5	1.0e-06
WP_081089775.1|2381898_2382300_+	hypothetical protein	NA	C8CLG8	Xylella_phage	68.3	1.1e-11
WP_088372084.1|2382299_2382701_+	hypothetical protein	NA	C8CLG7	Xylella_phage	67.7	2.8e-44
WP_088372082.1|2382697_2382892_+	hypothetical protein	NA	C8CLG6	Xylella_phage	79.7	2.7e-21
WP_010893213.1|2382923_2383196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088372080.1|2383192_2383384_+	hypothetical protein	NA	C8CLG5	Xylella_phage	76.8	1.1e-14
WP_109161022.1|2383383_2383881_+	hypothetical protein	NA	C8CLG4	Xylella_phage	73.0	4.1e-37
WP_088372078.1|2385154_2385721_+	DUF2815 family protein	NA	C8CLG2	Xylella_phage	95.7	3.5e-101
WP_088372266.1|2385789_2386947_+	hypothetical protein	NA	C8CLG1	Xylella_phage	86.5	1.8e-189
WP_109161023.1|2386948_2389129_+	DNA polymerase	NA	C8CLG0	Xylella_phage	91.2	0.0e+00
WP_023906708.1|2389125_2389404_+	VRR-NUC domain-containing protein	NA	C8CLF9	Xylella_phage	96.7	2.5e-44
WP_010894949.1|2389405_2389801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088372074.1|2389864_2391283_+	DEAD/DEAH box helicase	NA	C8CLF7	Xylella_phage	92.8	6.4e-261
WP_023907056.1|2391436_2391685_+	DUF4224 domain-containing protein	NA	C8CLF5	Xylella_phage	80.5	3.0e-33
WP_109161024.1|2391684_2392704_+|integrase	tyrosine-type recombinase/integrase	integrase	C8CLF4	Xylella_phage	86.4	1.6e-165
2392795:2392811	attR	AATACACCAATACTGTA	NA	NA	NA	NA
