The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013252	Clostridium butyricum strain KNU-L09 chromosome 1, complete sequence	3824894	163402	175874	3824894	integrase	Erysipelothrix_phage(66.67%)	7	162216:162242	175236:175262
162216:162242	attL	TGGCGGAGAGAAGGGGATTTGAACCCC	NA	NA	NA	NA
WP_058141620.1|163402_166351_-	DEAD/DEAH box helicase family protein	NA	A0A2K5B256	Erysipelothrix_phage	47.2	1.3e-234
WP_081256859.1|166363_167938_-	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	43.6	2.5e-96
WP_058141625.1|168568_169327_-	DUF4391 domain-containing protein	NA	A0A2K5B2C0	Erysipelothrix_phage	23.2	1.2e-06
WP_058146856.1|169336_172594_-	DEAD/DEAH box helicase family protein	NA	A0A2K5B2B9	Erysipelothrix_phage	50.9	7.3e-300
WP_058141627.1|173758_173938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058141629.1|174107_175064_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	31.6	7.1e-38
WP_058141631.1|175424_175874_-	nucleoside deaminase	NA	A0A2H4PQS8	Staphylococcus_phage	33.1	3.3e-09
175236:175262	attR	TGGCGGAGAGAAGGGGATTTGAACCCC	NA	NA	NA	NA
>prophage 2
NZ_CP013252	Clostridium butyricum strain KNU-L09 chromosome 1, complete sequence	3824894	298638	305274	3824894	protease,transposase	Faustovirus(16.67%)	7	NA	NA
WP_058141651.1|298638_299790_+	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A1X7QGF3	Faustovirus	29.9	8.4e-17
WP_002582832.1|299846_300422_+|protease	spore protease YyaC	protease	G3M9W0	Bacillus_virus	36.0	1.2e-19
WP_002581275.1|300656_301988_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	31.2	2.8e-24
WP_002582831.1|302087_302609_-	DUF4446 family protein	NA	NA	NA	NA	NA
WP_002582830.1|302648_303512_-	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	35.7	6.5e-14
WP_002582829.1|303525_304287_-	ParA family protein	NA	Q8JL10	Natrialba_phage	30.3	1.4e-20
WP_058141652.1|304494_305274_-	nucleoid occlusion protein	NA	S5WII0	Leptospira_phage	40.4	4.3e-17
>prophage 3
NZ_CP013252	Clostridium butyricum strain KNU-L09 chromosome 1, complete sequence	3824894	760503	815172	3824894	protease,coat,transposase,tRNA	Clostridium_phage(25.0%)	53	NA	NA
WP_002582329.1|760503_761523_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	41.6	2.5e-65
WP_043853365.1|761531_762536_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_002582327.1|762650_763877_+	trypsin-like peptidase domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	27.2	2.0e-21
WP_003412645.1|764012_764330_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002582325.1|764409_764769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043853364.1|764890_766033_+	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002582323.1|766102_767227_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_035764142.1|767374_768391_+|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
WP_080630488.1|768362_769139_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_003429682.1|769318_770353_+|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
WP_002582319.1|770512_771634_-	glycosyltransferase family 4 protein	NA	A0A2K9VGK0	Pontimonas_phage	40.3	5.0e-06
WP_002582318.1|771742_772741_+|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
WP_002582317.1|772886_773750_+	sporulation peptidase YabG	NA	NA	NA	NA	NA
WP_002582316.1|774038_774281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002582315.1|774658_776221_+	DUF3794 domain-containing protein	NA	NA	NA	NA	NA
WP_002582314.1|776350_777166_+	cyanophycinase	NA	NA	NA	NA	NA
WP_002582313.1|777168_779778_+	cyanophycin synthetase	NA	NA	NA	NA	NA
WP_002582312.1|779866_780709_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_002582311.1|780784_781468_+	stage II sporulation protein R	NA	NA	NA	NA	NA
WP_003412599.1|781482_782472_+	DUF814 domain-containing protein	NA	NA	NA	NA	NA
WP_002582309.1|782519_782930_+	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_003412658.1|783132_783444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002582307.1|783626_785234_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	51.4	2.5e-152
WP_003412620.1|785516_787052_+	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_002582305.1|787087_788200_-	galactosyldiacylglycerol synthase	NA	NA	NA	NA	NA
WP_002582304.1|788401_788611_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_002582303.1|789013_789601_+	thymidine kinase	NA	A0A249XXF6	Clostridium_phage	57.4	9.4e-57
WP_035764129.1|789622_791380_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_002582301.1|791614_792697_+	peptide chain release factor 1	NA	NA	NA	NA	NA
WP_002582300.1|792811_793399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002582299.1|793417_794467_+	threonylcarbamoyl-AMP synthase	NA	S4VW33	Pandoravirus	38.0	1.2e-46
WP_002582298.1|794487_794937_+	ribose 5-phosphate isomerase B	NA	NA	NA	NA	NA
WP_002582297.1|795075_795705_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_002582296.1|795723_796218_+	cytidine deaminase	NA	A0A2H5BMD7	Streptomyces_phage	39.8	2.0e-15
WP_002582295.1|796314_797463_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	27.7	9.8e-26
WP_002582294.1|797698_798880_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_002581975.1|798997_800581_+|transposase	IS1182-like element ISClbu1 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	33.1	9.9e-61
WP_002582293.1|801540_801900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002582292.1|801918_802599_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_002582291.1|802630_802846_+	ATP synthase F0 subunit C	NA	NA	NA	NA	NA
WP_002582290.1|802897_803377_+	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_002582289.1|803379_803919_+	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_003412606.1|803929_805444_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_027637068.1|805619_806468_+	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_002582286.1|806484_807876_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_002582285.1|807890_808292_+	ATP synthase F1 subunit epsilon	NA	NA	NA	NA	NA
WP_035764124.1|808548_809190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003412628.1|809212_810475_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_003412591.1|810729_811800_+	stage II sporulation protein D	NA	Q2XU88	Pseudomonas_phage	35.1	9.1e-34
WP_002582281.1|812289_813051_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_002582280.1|813206_813461_+	sporulation transcriptional regulator SpoIIID	NA	M9Q261	Clostridium_phage	57.3	1.1e-17
WP_002582279.1|813540_814575_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_002582278.1|814647_815172_-|protease	spore protease YyaC	protease	A0A0A8WIQ6	Clostridium_phage	37.7	5.1e-22
>prophage 4
NZ_CP013252	Clostridium butyricum strain KNU-L09 chromosome 1, complete sequence	3824894	1528118	1538209	3824894		Prochlorococcus_phage(42.86%)	7	NA	NA
WP_058141824.1|1528118_1531865_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	24.5	1.2e-32
WP_002579500.1|1532121_1532601_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	43.7	1.3e-27
WP_002579501.1|1532600_1533308_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SLB8	Cyanophage	44.8	2.1e-47
WP_002579502.1|1533415_1534828_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.8	1.1e-55
WP_035762527.1|1534919_1535924_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	45.4	1.5e-67
WP_058141825.1|1535911_1536520_+	phosphoribosylglycinamide formyltransferase	NA	R9S626	Prochlorococcus_phage	37.5	3.7e-24
WP_002579505.1|1536700_1538209_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	E3SNU8	Prochlorococcus_phage	46.0	1.8e-35
>prophage 5
NZ_CP013252	Clostridium butyricum strain KNU-L09 chromosome 1, complete sequence	3824894	2929455	2936808	3824894	integrase	Brevibacillus_phage(14.29%)	10	2918641:2918656	2940278:2940293
2918641:2918656	attL	AATAATTTGTAAAAAT	NA	NA	NA	NA
WP_058142182.1|2929455_2930172_-	ORF6C domain-containing protein	NA	S5MP04	Brevibacillus_phage	42.1	6.8e-25
WP_002580419.1|2930193_2930433_-	AbrB family transcriptional regulator	NA	A0A2I7SC16	Paenibacillus_phage	44.6	1.8e-11
WP_058146877.1|2930487_2931135_-	ATP-binding protein	NA	Q0H276	Geobacillus_phage	40.7	3.6e-33
WP_058142183.1|2931163_2932276_-	phage replisome organizer N-terminal domain-containing protein	NA	V5UQV4	Oenococcus_phage	43.4	8.3e-22
WP_081256853.1|2932445_2932610_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_058142184.1|2932641_2932851_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_058142185.1|2932869_2933097_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_058142186.1|2933256_2933931_+	helix-turn-helix transcriptional regulator	NA	A0A139ZPJ2	Marinitoga_camini_virus	38.3	1.0e-06
WP_058142187.1|2933995_2935174_+|integrase	site-specific integrase	integrase	A0A1C8E994	Bacillus_phage	27.3	9.8e-21
WP_081256854.1|2935200_2936808_-	ATP-dependent helicase	NA	Q331U3	Clostridium_botulinum_C_phage	23.1	3.9e-12
2940278:2940293	attR	ATTTTTACAAATTATT	NA	NA	NA	NA
>prophage 6
NZ_CP013252	Clostridium butyricum strain KNU-L09 chromosome 1, complete sequence	3824894	3020736	3087990	3824894	tail,protease,integrase,plate,portal,tRNA,transposase,terminase,capsid,holin	Clostridium_phage(24.39%)	86	3041180:3041196	3093510:3093526
WP_035761361.1|3020736_3022410_-|protease	ATP-dependent protease LonB	protease	A0A1V0SHJ7	Hokovirus	23.8	3.0e-07
WP_002580912.1|3022597_3023887_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	62.2	1.0e-143
WP_002580913.1|3023929_3024535_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.7	2.2e-53
WP_002580914.1|3024695_3025979_-	trigger factor	NA	NA	NA	NA	NA
WP_002580915.1|3026065_3026881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002580916.1|3026976_3027171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002580917.1|3027577_3028753_-	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	A0A0F7LAY0	uncultured_marine_virus	25.2	1.0e-25
WP_002580918.1|3028950_3029277_-	phosphoribosyl-ATP diphosphatase	NA	NA	NA	NA	NA
WP_002580919.1|3029310_3029640_-	phosphoribosyl-AMP cyclohydrolase	NA	NA	NA	NA	NA
WP_002580920.1|3029668_3030430_-	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_002580921.1|3030479_3031196_-	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_002580922.1|3031192_3031813_-	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_002580923.1|3031840_3032428_-	imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_002580924.1|3032450_3033488_-	histidinol-phosphate aminotransferase family protein	NA	A0A142C026	Faustovirus	24.1	9.8e-17
WP_003425009.1|3033474_3034773_-	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_002580926.1|3034953_3035583_-	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_003407320.1|3035627_3036761_-	ATP phosphoribosyltransferase regulatory subunit	NA	A0A1V0SLE3	Klosneuvirus	25.8	1.1e-16
WP_002580928.1|3037112_3037751_+	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
WP_002580929.1|3037785_3038943_-|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_003425005.1|3038942_3040091_-	cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	28.1	6.6e-30
WP_058142210.1|3040330_3041191_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	24.6	5.1e-19
3041180:3041196	attL	TATTTTTTTCATTATTA	NA	NA	NA	NA
WP_002580932.1|3041206_3042301_-	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
WP_002580933.1|3042569_3043367_-	RelA/SpoT domain-containing protein	NA	NA	NA	NA	NA
WP_058142211.1|3043454_3044399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003426559.1|3044633_3045836_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_002580935.1|3046206_3047154_-	N-acetylmuramoyl-L-alanine amidase	NA	Q24LG3	Clostridium_phage	37.8	3.4e-16
WP_002580936.1|3047208_3047457_-|holin	phage holin family protein	holin	A0A0A7RW97	Clostridium_phage	51.9	3.2e-14
WP_002580937.1|3047458_3047743_-	hypothetical protein	NA	A0A2H4J1Q4	uncultured_Caudovirales_phage	54.9	2.0e-20
WP_058142212.1|3047805_3048810_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0E3T6D9	Bacillus_phage	27.9	5.2e-15
WP_058142213.1|3049065_3050103_-	acyltransferase family protein	NA	NA	NA	NA	NA
WP_058142214.1|3050203_3052567_-	hypothetical protein	NA	M1I7I9	Paramecium_bursaria_Chlorella_virus	38.7	2.4e-18
WP_002580942.1|3052580_3052793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002580943.1|3052785_3053103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002580944.1|3053116_3054514_-|tail	phage tail protein	tail	A0A0A7RTP0	Clostridium_phage	56.6	5.2e-45
WP_002580945.1|3054506_3055352_-|tail	phage tail protein I	tail	A0A0C5AJ63	Bacteriophage	34.2	1.4e-24
WP_125390900.1|3055351_3056500_-|plate	baseplate J/gp47 family protein	plate	A0A059WFM2	Vibrio_phage	31.8	6.8e-51
WP_002580947.1|3056495_3056813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002580948.1|3056818_3057376_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_002580949.1|3057375_3057618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125390901.1|3057617_3058526_-	hypothetical protein	NA	H7BVZ1	unidentified_phage	30.4	1.3e-28
WP_064062198.1|3058534_3058768_-|tail	tail protein X	tail	A0A2K9V2S8	Faecalibacterium_phage	43.8	1.9e-08
WP_058142215.1|3058739_3060938_-	hypothetical protein	NA	A0A218KCH0	Bacillus_phage	46.5	4.5e-43
WP_002580953.1|3061103_3061442_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_002580954.1|3061499_3062030_-|tail	phage major tail tube protein	tail	A0A0C5AJ56	Bacteriophage	35.3	6.3e-20
WP_058142216.1|3062030_3063467_-	hypothetical protein	NA	H7BVZ4	unidentified_phage	36.4	2.9e-75
WP_002580956.1|3063479_3063998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058142217.1|3063999_3064578_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_002580958.1|3064577_3064892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035778953.1|3064878_3065142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058146399.1|3065117_3066164_-|capsid	major capsid protein	capsid	A0A0C5ABI0	Bacteriophage	41.7	1.6e-78
WP_058146400.1|3066186_3066540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058146402.1|3066539_3067751_-|protease	Clp protease ClpP	protease	A0A0E3Y6E9	Fusobacterium_phage	30.5	3.1e-30
WP_058146404.1|3067710_3069261_-|portal	phage portal protein	portal	A0A0C5AJ48	Bacteriophage	59.3	2.2e-169
WP_002580964.1|3069271_3069505_-	hypothetical protein	NA	A0A0C5AEE0	Bacteriophage	48.0	5.1e-14
WP_058146406.1|3069553_3071380_-|terminase	phage terminase large subunit family protein	terminase	A0A2K9V3X4	Faecalibacterium_phage	50.3	2.7e-171
WP_058146409.1|3071351_3071933_-	hypothetical protein	NA	A0A2K9V441	Faecalibacterium_phage	30.7	1.3e-13
WP_058146411.1|3072010_3072748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002580968.1|3072932_3073502_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0S2GLG4	Bacillus_phage	52.5	4.4e-43
WP_058146878.1|3073498_3073723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002580970.1|3073754_3074153_-	hypothetical protein	NA	M9Q1J7	Clostridium_phage	37.9	1.6e-12
WP_002580971.1|3074326_3074656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002580972.1|3074775_3075009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002580973.1|3075046_3075463_-	hypothetical protein	NA	A0A141DZP9	Streptococcus_phage	39.0	1.8e-09
WP_002580974.1|3075576_3075819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058146879.1|3076044_3076350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058146413.1|3076475_3076766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058146415.1|3077070_3077253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058146417.1|3077252_3077507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002580979.1|3077573_3077705_-	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
WP_002580980.1|3077722_3077911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002580981.1|3078020_3078209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058146420.1|3078223_3078379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002580983.1|3078371_3078707_-	hypothetical protein	NA	A0A0S2MVE6	Bacillus_phage	37.6	5.2e-12
WP_002580984.1|3078693_3079542_-	helix-turn-helix domain-containing protein	NA	A0A1L2BY83	Clostridium_phage	52.5	3.4e-60
WP_058146421.1|3079558_3080686_-	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_002580986.1|3080670_3081426_-	ParA family protein	NA	H7BUL8	unidentified_phage	31.0	1.7e-26
WP_002580988.1|3081637_3081823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002580989.1|3081833_3082010_-	hypothetical protein	NA	Q8SBM7	Clostridium_phage	66.7	3.8e-14
WP_002580990.1|3082028_3082463_-	helix-turn-helix transcriptional regulator	NA	A0A1L2BY71	Clostridium_phage	49.0	3.2e-30
WP_002580991.1|3082600_3082798_-	helix-turn-helix domain-containing protein	NA	A0A0B5D0D3	Listeria_phage	52.5	7.1e-09
WP_002580992.1|3082949_3083294_+	helix-turn-helix transcriptional regulator	NA	A0A1L2BY72	Clostridium_phage	62.3	8.8e-31
WP_002580993.1|3083643_3084213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002580994.1|3084503_3085538_+	hypothetical protein	NA	A0A0U2S621	Escherichia_phage	26.4	4.1e-15
WP_002580995.1|3085488_3086091_-	sce7726 family protein	NA	A0A0U2RXY7	Escherichia_phage	39.5	4.3e-33
WP_002580996.1|3086325_3086823_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A1L2BY64	Clostridium_phage	47.9	2.0e-36
WP_058146424.1|3086940_3087990_+|integrase	site-specific integrase	integrase	Q8SBN2	Clostridium_phage	67.2	6.4e-141
3093510:3093526	attR	TATTTTTTTCATTATTA	NA	NA	NA	NA
>prophage 1
NZ_CP013489	Clostridium butyricum strain KNU-L09 chromosome 2, complete sequence	803000	3706	59481	803000	tail,plate,protease,capsid	uncultured_Caudovirales_phage(42.86%)	57	NA	NA
WP_058372113.1|3706_4684_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_058372114.1|4792_6103_-	sensor histidine kinase	NA	X5JAC0	Clostridium_phage	30.4	1.5e-17
WP_002581243.1|6114_6825_-	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	37.5	3.7e-31
WP_058372115.1|6996_9591_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_003413325.1|9590_10277_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.6	1.0e-33
WP_043665323.1|10360_11350_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_043665328.1|11336_12023_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_058372116.1|12529_13555_-	glycosyl hydrolase 53 family protein	NA	NA	NA	NA	NA
WP_043853920.1|13967_14966_-	glycosyl hydrolase 53 family protein	NA	NA	NA	NA	NA
WP_043853744.1|15278_17342_-	beta-galactosidase	NA	NA	NA	NA	NA
WP_058372117.1|17515_19060_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_058372118.1|19296_20835_-	DUF3502 domain-containing protein	NA	NA	NA	NA	NA
WP_035764313.1|21032_21923_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_081044150.1|22038_23019_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_058372119.1|23254_24796_+	response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	30.9	4.0e-06
WP_136954475.1|24698_26567_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	28.4	5.3e-21
WP_003413637.1|26622_27312_+	DUF624 domain-containing protein	NA	NA	NA	NA	NA
WP_058372120.1|27518_27962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058372121.1|28161_28713_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_058372123.1|30153_30471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058372124.1|30467_30704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058372125.1|30798_31002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058372126.1|30986_31859_-	ParM/StbA family protein	NA	Q0SPH6	Clostridium_phage	29.7	4.5e-23
WP_125390915.1|31991_32162_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J765	uncultured_Caudovirales_phage	64.3	1.3e-11
WP_058372128.1|32288_32813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003432416.1|33208_33409_-	alpha/beta-type small acid-soluble spore protein	NA	Q77YX0	Bacillus_phage	42.2	2.8e-05
WP_125390911.1|33579_34299_-	restriction endonuclease	NA	A0A0A7S0U2	Clostridium_phage	35.8	1.5e-24
WP_058372130.1|34298_34661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058372131.1|34611_35679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003414383.1|35984_36164_-	hypothetical protein	NA	A0A2H4J069	uncultured_Caudovirales_phage	75.0	3.6e-12
WP_058372132.1|36623_38246_-	hypothetical protein	NA	I3VYU6	Thermoanaerobacterium_phage	33.1	7.4e-19
WP_058372133.1|38296_38620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035763532.1|38637_38850_-	hemolysin XhlA family protein	NA	NA	NA	NA	NA
WP_058372134.1|39143_39443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058372136.1|40464_41082_-	YmfQ family protein	NA	A0A0A7RTU9	Clostridium_phage	40.2	4.4e-41
WP_064062222.1|41082_42975_-	hypothetical protein	NA	A0A0A7S1G0	Clostridium_phage	57.9	1.5e-26
WP_058372137.1|42975_44103_-|plate	baseplate J/gp47 family protein	plate	A0A2H4J7K8	uncultured_Caudovirales_phage	36.2	2.1e-52
WP_045144373.1|44109_44547_-	DUF2634 domain-containing protein	NA	A0A2H4J4Q8	uncultured_Caudovirales_phage	43.4	2.3e-23
WP_058372138.1|44539_44884_-	hypothetical protein	NA	A0A0A8WFG6	Clostridium_phage	42.7	2.6e-14
WP_058372223.1|44873_45851_-	hypothetical protein	NA	A0A2H4J063	uncultured_Caudovirales_phage	47.4	6.3e-74
WP_058372139.1|45899_46466_-	HNH endonuclease	NA	L0P6F5	Lactobacillus_phage	37.6	9.1e-33
WP_081044151.1|46559_46721_+	ribbon-helix-helix domain-containing protein	NA	NA	NA	NA	NA
WP_058372140.1|46730_47213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058372141.1|47583_48423_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_058877159.1|48460_52225_-|tail	phage tail tape measure protein	tail	A0A2H4J055	uncultured_Caudovirales_phage	33.2	1.2e-85
WP_058372143.1|52428_52923_-	XkdN	NA	A0A2H4J883	uncultured_Caudovirales_phage	39.7	1.7e-19
WP_003432463.1|52955_53375_-|tail	phage tail tube protein	tail	A0A2H4J032	uncultured_Caudovirales_phage	61.8	1.2e-42
WP_058372144.1|53392_54832_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	B6SBT7	Clostridium_virus	46.0	1.8e-109
WP_027635367.1|54831_55065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058372145.1|55080_55902_-	hypothetical protein	NA	A0A2H4J4Q0	uncultured_Caudovirales_phage	53.1	2.1e-83
WP_002581889.1|55905_56331_-	hypothetical protein	NA	A0A2H4J736	uncultured_Caudovirales_phage	44.8	1.5e-24
WP_058372146.1|56335_56719_-	hypothetical protein	NA	A0A2H4J057	uncultured_Caudovirales_phage	51.6	4.0e-32
WP_003432470.1|56718_57039_-	hypothetical protein	NA	A0A2H4J040	uncultured_Caudovirales_phage	56.4	4.7e-26
WP_058372147.1|57041_57293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058372148.1|57349_58405_-|capsid	major capsid protein	capsid	D9ZND6	Clostridium_phage	49.7	2.0e-86
WP_058372149.1|58421_58826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058372150.1|58854_59481_-	phage scaffolding protein	NA	A0A0K2CP96	Brevibacillus_phage	35.0	5.2e-13
>prophage 2
NZ_CP013489	Clostridium butyricum strain KNU-L09 chromosome 2, complete sequence	803000	71235	87532	803000	integrase	uncultured_Caudovirales_phage(28.57%)	24	70045:70060	85626:85641
70045:70060	attL	TCTTAAATATATTTTC	NA	NA	NA	NA
WP_033127229.1|71235_72237_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	28.9	4.3e-17
WP_058372163.1|72488_72698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058372164.1|73533_74145_-	hypothetical protein	NA	A0A2H4J8I2	uncultured_Caudovirales_phage	39.5	2.0e-33
WP_058372165.1|74168_74438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058372166.1|74460_75180_-	hypothetical protein	NA	A0A1L2BY85	Clostridium_phage	36.3	3.2e-30
WP_058372167.1|75223_75412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045144349.1|75416_75821_-	RusA family crossover junction endodeoxyribonuclease	NA	J9QE82	Clostridium_phage	40.8	5.3e-19
WP_058372168.1|75909_76215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045144347.1|76230_76506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058372169.1|76506_77583_-	DUF3102 domain-containing protein	NA	A0A2H4J025	uncultured_Caudovirales_phage	43.4	4.6e-17
WP_058372170.1|77583_79173_-	PcfJ domain-containing protein	NA	A0A2H4J8D4	uncultured_Caudovirales_phage	37.5	5.1e-73
WP_058372171.1|79186_79588_-	hypothetical protein	NA	A0A2H4J073	uncultured_Caudovirales_phage	35.4	3.7e-12
WP_003406460.1|79627_79972_-	hypothetical protein	NA	A0A0A7RTL9	Clostridium_phage	52.6	1.0e-23
WP_058372172.1|79949_80186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058372173.1|80182_80530_-	Spo0E family sporulation regulatory protein-aspartic acid phosphatase	NA	NA	NA	NA	NA
WP_058372174.1|80545_81352_-	ATP-binding protein	NA	A0A1B1P7U2	Bacillus_phage	33.5	4.2e-31
WP_058372175.1|81293_82136_-	phage replisome organizer N-terminal domain-containing protein	NA	C5J987	Streptococcus_phage	39.3	1.4e-29
WP_058372176.1|82289_83003_-	MBL fold metallo-hydrolase	NA	A0A1L2JY21	Aeribacillus_phage	43.9	1.1e-51
WP_058372177.1|83002_83893_-	recombinase RecT	NA	A0A1L2JY28	Aeribacillus_phage	42.4	6.8e-51
WP_058372178.1|83896_84082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058372179.1|84081_86052_-	AAA family ATPase	NA	S0A069	Cellulophaga_phage	33.3	2.3e-75
85626:85641	attR	TCTTAAATATATTTTC	NA	NA	NA	NA
WP_058372180.1|86525_86741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058372181.1|86754_87282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058372182.1|87289_87532_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A0K2CZ86	Paenibacillus_phage	56.4	3.8e-20
