The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011307	Intestinimonas butyriciproducens strain AF211 chromosome, complete genome	3376475	464318	493755	3376475	head,tail,portal,terminase,plate	unidentified_phage(29.41%)	41	NA	NA
WP_158453351.1|464318_466631_-	DUF3987 domain-containing protein	NA	A0A0K0N7B1	Gordonia_phage	25.0	7.3e-12
WP_158453352.1|466590_466773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058116971.1|466895_467822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158453353.1|467818_469306_+	recombinase family protein	NA	A0A2K9V2Y5	Faecalibacterium_phage	38.7	1.3e-89
WP_033118895.1|469809_470331_-	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	42.7	1.0e-22
WP_033118894.1|470410_470875_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	50.0	3.8e-37
WP_052082855.1|470981_471440_-	ImmA/IrrE family metallo-endopeptidase	NA	Q0H245	Geobacillus_phage	37.0	2.1e-19
WP_033118893.1|471440_471896_-	helix-turn-helix transcriptional regulator	NA	A0A2P1JU09	Anoxybacillus_phage	30.3	1.3e-10
WP_058116972.1|472125_472311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052082853.1|472307_472595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129868767.1|472711_472939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033118891.1|472931_473339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158453354.1|473428_473602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156113809.1|473791_473962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058116975.1|474038_474647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147586043.1|474568_475684_+	hypothetical protein	NA	A0A2H4IZQ5	uncultured_Caudovirales_phage	39.5	9.9e-07
WP_058116977.1|475701_476322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033118888.1|476588_476825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058116978.1|476817_478074_+|terminase	terminase	terminase	B6CXD2	Clostridium_phage	45.8	8.1e-98
WP_158453355.1|478173_479520_+|portal	phage portal protein	portal	H7BWE8	unidentified_phage	56.6	1.2e-152
WP_058116980.1|479516_479972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033118885.1|480214_481312_+	hypothetical protein	NA	A0A2I7RQ09	Vibrio_phage	29.9	6.3e-14
WP_058116981.1|481358_481727_+|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_058116982.1|481729_482116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033118882.1|482129_482573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058116983.1|482557_482764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058116984.1|482764_484099_+|tail	phage tail sheath protein	tail	H7BWE1	unidentified_phage	66.9	2.5e-113
WP_033118880.1|484118_484577_+|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	51.0	9.3e-36
WP_033118879.1|484651_485059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143433371.1|485417_485567_+	xylan 1,4-beta-xylosidase	NA	NA	NA	NA	NA
WP_058116986.1|485693_485906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147586044.1|485945_487430_+	DUF846 domain-containing protein	NA	H7BWD9	unidentified_phage	34.8	4.8e-41
WP_058116988.1|487645_488290_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A2H4J2N2	uncultured_Caudovirales_phage	35.3	3.7e-22
WP_058116989.1|488286_489237_+	hypothetical protein	NA	H7BWD8	unidentified_phage	51.1	4.2e-83
WP_033118875.1|489237_489480_+	DUF2577 family protein	NA	NA	NA	NA	NA
WP_033118874.1|489482_489908_+	DUF2634 domain-containing protein	NA	A0A0A7RTU4	Clostridium_phage	43.0	1.2e-16
WP_147586236.1|490045_490234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033118873.1|490452_490662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147586239.1|490753_490891_+	xylan 1,4-beta-xylosidase	NA	NA	NA	NA	NA
WP_058116991.1|491187_492588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058116992.1|492675_493755_+|plate	baseplate J/gp47 family protein	plate	H7BWD5	unidentified_phage	53.2	8.7e-109
>prophage 2
NZ_CP011307	Intestinimonas butyriciproducens strain AF211 chromosome, complete genome	3376475	1846526	1905019	3376475	integrase,transposase	Bacillus_phage(50.0%)	48	1842750:1842769	1881552:1881571
1842750:1842769	attL	TCCGGCGGGCAGCGGCAGCG	NA	NA	NA	NA
WP_058117834.1|1846526_1847720_-|integrase	site-specific integrase	integrase	A0A0U3U8Y8	Bacillus_phage	30.7	1.1e-32
WP_058117835.1|1847817_1848006_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_058117836.1|1847998_1848892_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_147586138.1|1850678_1851233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158453376.1|1851515_1852073_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_058117838.1|1852144_1852585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058117839.1|1852770_1853919_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_058117840.1|1853950_1855168_-	CoA transferase	NA	NA	NA	NA	NA
WP_058117841.1|1855359_1856313_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_082636050.1|1856347_1856554_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_058117842.1|1856882_1857296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058117843.1|1857292_1858255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058117844.1|1858257_1859301_-	epoxyqueuosine reductase	NA	NA	NA	NA	NA
WP_058117845.1|1859374_1860781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058117846.1|1861156_1862560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058117847.1|1862635_1863565_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_058117848.1|1863953_1864247_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_050617135.1|1864563_1865706_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_058117849.1|1865784_1867149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058118756.1|1867426_1868896_-	4-hydroxyphenylacetate 3-hydroxylase	NA	NA	NA	NA	NA
WP_058117850.1|1869048_1870353_-	4-hydroxybutyrate CoA-transferase	NA	NA	NA	NA	NA
WP_058117851.1|1870349_1872083_-	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_058117852.1|1872631_1872832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158453377.1|1873455_1873818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082636053.1|1874180_1875146_+|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	46.2	1.2e-69
WP_147586140.1|1875414_1875765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058117854.1|1875785_1877432_-	thiol reductant ABC exporter subunit CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	35.4	4.0e-20
WP_058118757.1|1877413_1879165_-	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	30.0	2.9e-21
WP_082636184.1|1879154_1879568_-	YbaN family protein	NA	NA	NA	NA	NA
WP_058117855.1|1879862_1881110_+|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	26.4	1.9e-30
WP_058117856.1|1881223_1881991_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	24.8	1.2e-11
1881552:1881571	attR	CGCTGCCGCTGCCCGCCGGA	NA	NA	NA	NA
WP_058117857.1|1881977_1882994_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_058117858.1|1882956_1883916_-	heme ABC transporter substrate-binding protein IsdE	NA	NA	NA	NA	NA
WP_058117859.1|1883917_1884862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058117860.1|1884892_1885714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058117861.1|1885810_1887358_-	S-layer homology domain-containing protein	NA	NA	NA	NA	NA
WP_058117862.1|1887456_1892802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058117863.1|1892882_1893413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058117864.1|1893915_1894686_-	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_058117865.1|1894919_1895222_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_058117866.1|1895214_1895478_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_058118759.1|1896026_1896644_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_058117867.1|1896702_1898496_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.3	8.1e-27
WP_058117868.1|1898512_1900264_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.7	5.7e-41
WP_058117869.1|1900651_1901893_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_058117870.1|1902060_1902333_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	53.3	3.4e-17
WP_058117871.1|1902505_1902991_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_082635993.1|1904053_1905019_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	45.8	1.3e-68
>prophage 3
NZ_CP011307	Intestinimonas butyriciproducens strain AF211 chromosome, complete genome	3376475	2793727	2807764	3376475	transposase	Streptococcus_phage(37.5%)	11	NA	NA
WP_158453391.1|2793727_2796835_+	recombinase family protein	NA	E4ZFJ8	Streptococcus_phage	35.3	4.4e-12
WP_058118374.1|2796854_2797526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058118375.1|2797515_2798541_+	DNA (cytosine-5-)-methyltransferase	NA	A0A0C5AFC4	Paenibacillus_phage	36.7	9.0e-47
WP_058118376.1|2798537_2800574_+	C40 family peptidase	NA	A0A1S5SEZ8	Streptococcus_phage	41.1	1.0e-17
WP_082635958.1|2800600_2800993_+|transposase	IS200/IS605 family transposase	transposase	G9CU69	Helicobacter_phage	66.9	3.7e-49
WP_058116759.1|2801002_2802115_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0H3UZC2	Geobacillus_virus	48.7	3.1e-93
WP_058118377.1|2802302_2802746_+	hypothetical protein	NA	Q6JIG5	Burkholderia_virus	57.8	4.8e-37
WP_058118378.1|2802755_2803496_+	hypothetical protein	NA	G9BWC3	Planktothrix_phage	42.6	5.2e-44
WP_006058365.1|2803482_2803740_+	DUF4315 family protein	NA	NA	NA	NA	NA
WP_058118795.1|2803729_2804431_+	DUF4366 domain-containing protein	NA	NA	NA	NA	NA
WP_058118380.1|2806090_2807764_-	recombinase family protein	NA	D0R0F3	Streptococcus_phage	23.6	6.4e-18
