The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012194	Corynebacterium glutamicum strain CP, complete genome	3342897	485324	522934	3342897	transposase	Catovirus(20.0%)	22	NA	NA
WP_060563799.1|485324_486590_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	97.4	2.3e-233
WP_060563801.1|487893_490545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155761551.1|490584_491451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060563804.1|491488_492865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060563805.1|493083_493968_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_077311031.1|494095_494818_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_060563812.1|496761_497184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089158484.1|497571_502101_-	glycosyltransferase	NA	A0A1V0SAE6	Catovirus	31.6	2.3e-33
WP_060563814.1|502431_503685_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HFY9	Paramecium_bursaria_Chlorella_virus	25.0	8.8e-20
WP_081302975.1|507001_509194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060563823.1|509236_510145_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_060563825.1|510423_511611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060563827.1|511645_514873_+	glycosyltransferase	NA	A0A1V0SAE6	Catovirus	28.3	8.9e-32
WP_081299819.1|515131_515416_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_060563542.1|515463_516774_-|transposase	ISL3-like element IS13869 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	44.2	2.5e-86
WP_089158485.1|517283_517622_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_152024167.1|517435_518218_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	28.6	5.9e-14
WP_155761552.1|518195_519397_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	30.6	1.8e-25
WP_075348078.1|519455_519635_-|transposase	transposase	transposase	A0A1B3AZF8	Gordonia_phage	49.1	2.4e-08
WP_060563841.1|519774_520254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075348475.1|520454_521864_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.2	1.1e-45
WP_075348476.1|522055_522934_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	39.9	9.4e-45
>prophage 2
NZ_CP012194	Corynebacterium glutamicum strain CP, complete genome	3342897	1524238	1588433	3342897	protease,transposase,integrase	Liberibacter_phage(10.0%)	58	1577344:1577395	1590971:1591022
WP_081381763.1|1524238_1525657_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_060564449.1|1527594_1528830_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_060564450.1|1528826_1531913_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	29.3	1.8e-58
WP_081299843.1|1531896_1532643_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_060564451.1|1532684_1534316_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_060564452.1|1534312_1535410_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_060564454.1|1536304_1537270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060564455.1|1537270_1537552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107111914.1|1538420_1539260_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	34.5	1.5e-07
WP_060564456.1|1539340_1540264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060564457.1|1540397_1541810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060564458.1|1541904_1543131_+	leucine-rich repeat protein	NA	NA	NA	NA	NA
WP_080506418.1|1543796_1544054_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060564459.1|1544161_1545316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011014272.1|1545312_1545639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060564460.1|1545635_1547399_-	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_107111918.1|1547737_1548028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060565493.1|1548567_1548897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034983522.1|1549175_1550486_+|transposase	ISL3-like element IS31831 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	42.2	1.0e-82
WP_003861489.1|1553154_1553313_-	hypothetical protein	NA	A0A1V0SKJ6	Klosneuvirus	60.0	8.2e-08
WP_060564461.1|1553370_1554780_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_060564462.1|1554886_1555639_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_060564463.1|1555687_1556167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060564464.1|1556227_1556794_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	36.8	1.6e-08
WP_003861499.1|1556776_1557484_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060564465.1|1557737_1559183_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_060564466.1|1559201_1559795_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_075861295.1|1560141_1561221_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_003858852.1|1561229_1561388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003858849.1|1561429_1562428_+	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_060564468.1|1562452_1563535_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_060564469.1|1563591_1564572_-	DUF3515 domain-containing protein	NA	NA	NA	NA	NA
WP_060564470.1|1564639_1565629_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_060564471.1|1565628_1566378_+	uracil-DNA glycosylase	NA	S4VZ65	Pandoravirus	35.7	1.2e-29
WP_075861336.1|1566509_1568093_+	DAK2 domain-containing protein	NA	NA	NA	NA	NA
WP_060564473.1|1568097_1570221_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_003858832.1|1570240_1570456_+	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit	NA	NA	NA	NA	NA
WP_060564474.1|1570455_1571040_+	RsmD family RNA methyltransferase	NA	NA	NA	NA	NA
WP_060564475.1|1571043_1571526_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	30.8	1.9e-15
WP_060564476.1|1572097_1572862_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.6	1.2e-27
WP_060564477.1|1572865_1573816_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003858822.1|1573858_1574863_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_060564478.1|1574962_1575772_+	DUF1266 domain-containing protein	NA	NA	NA	NA	NA
WP_003858816.1|1575854_1576835_-	DUF368 domain-containing protein	NA	NA	NA	NA	NA
1577344:1577395	attL	GTTTCCGCTGGTAGTGGTGCCCCTGGTGAGACTCGAACTCACACTGGACGGG	NA	NA	NA	NA
WP_011014293.1|1577482_1578241_-|integrase	site-specific integrase	integrase	G9FH48	Rhodococcus_phage	32.1	1.8e-15
WP_011014294.1|1578226_1578637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003861519.1|1578633_1579380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003858809.1|1579572_1580007_+	metallopeptidase	NA	NA	NA	NA	NA
WP_155761555.1|1580685_1581887_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	33.8	1.2e-26
WP_003858803.1|1581992_1582607_+	DUF4258 domain-containing protein	NA	NA	NA	NA	NA
WP_003858801.1|1582609_1582831_+	DUF2283 domain-containing protein	NA	NA	NA	NA	NA
WP_038583885.1|1583479_1583914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003858799.1|1583929_1584145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003858795.1|1584583_1584955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075861297.1|1584975_1585293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003858792.1|1585671_1585875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003861526.1|1586846_1587224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003861528.1|1587482_1588433_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
1590971:1591022	attR	GTTTCCGCTGGTAGTGGTGCCCCTGGTGAGACTCGAACTCACACTGGACGGG	NA	NA	NA	NA
>prophage 3
NZ_CP012194	Corynebacterium glutamicum strain CP, complete genome	3342897	1820491	1825902	3342897	integrase	Corynephage(33.33%)	7	1814697:1814710	1825360:1825373
1814697:1814710	attL	TCGCCGCCACCAAC	NA	NA	NA	NA
WP_081299849.1|1820491_1820803_+	TM2 domain-containing protein	NA	A0A1B0T6B3	Bacillus_phage	42.7	4.4e-05
WP_060564601.1|1820841_1821432_+	hypothetical protein	NA	A0A1P8D5Q9	Corynebacterium_phage	53.3	2.6e-22
WP_060564602.1|1822164_1822923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060564603.1|1823027_1823360_+	hypothetical protein	NA	Q9ZWV7	Corynephage	45.0	2.8e-18
WP_060564604.1|1823390_1823933_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9ZWV7	Corynephage	31.0	2.7e-10
WP_060564605.1|1824036_1824267_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1L6BZH2	Pasteurella_phage	43.1	1.3e-06
WP_060564606.1|1824270_1825902_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1V0SKJ1	Klosneuvirus	26.5	6.0e-37
1825360:1825373	attR	GTTGGTGGCGGCGA	NA	NA	NA	NA
>prophage 4
NZ_CP012194	Corynebacterium glutamicum strain CP, complete genome	3342897	3194982	3252640	3342897	transposase,integrase	Streptococcus_phage(13.33%)	57	3215776:3215791	3249749:3249764
WP_040968032.1|3194982_3195273_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_040968033.1|3195816_3196023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075861323.1|3196298_3197861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003860174.1|3198645_3199272_-	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	36.4	1.9e-23
WP_011013963.1|3199621_3199981_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_046552205.1|3199980_3200577_+	cadmium transporter	NA	NA	NA	NA	NA
WP_003859023.1|3200835_3202257_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	30.0	1.2e-44
WP_003859021.1|3202355_3202745_+	heavy metal-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_060565376.1|3203235_3203946_-|transposase	IS6-like element ISCef5 family transposase	transposase	A0A077SL39	Escherichia_phage	59.8	3.6e-79
WP_003862073.1|3204049_3204361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040968043.1|3204357_3204600_-	DUF2892 domain-containing protein	NA	NA	NA	NA	NA
WP_003862071.1|3204836_3206138_-	APC family permease	NA	NA	NA	NA	NA
WP_060565377.1|3206203_3207685_-	multicopper oxidase family protein	NA	NA	NA	NA	NA
WP_003862069.1|3207681_3207948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081302982.1|3208617_3209166_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q8W6R2	Burkholderia_virus	54.2	9.7e-40
WP_075348430.1|3209126_3209411_+	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_075348431.1|3209496_3210237_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_011015535.1|3210392_3210629_+	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_011015536.1|3210834_3211152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060565379.1|3211795_3213673_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	37.2	6.0e-105
WP_003861174.1|3214880_3215255_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	38.7	4.5e-12
WP_060565381.1|3215440_3215647_+	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
3215776:3215791	attL	TTTGCTTATCGACGCC	NA	NA	NA	NA
WP_011015541.1|3215819_3217166_+	MFS transporter	NA	NA	NA	NA	NA
WP_003861180.1|3217125_3217308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075348434.1|3217318_3217921_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060565382.1|3218127_3219660_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	42.3	1.1e-88
WP_003855068.1|3220267_3220720_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_060565383.1|3220776_3221454_-	single-stranded DNA-binding protein	NA	A0A1P8D5R5	Corynebacterium_phage	52.7	2.9e-49
WP_003855074.1|3221490_3221778_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_003861194.1|3222137_3222329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011015546.1|3222325_3223786_-	DUF2029 domain-containing protein	NA	NA	NA	NA	NA
WP_060565384.1|3223831_3225994_-	penicillin-binding protein	NA	NA	NA	NA	NA
WP_060565385.1|3226085_3226478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003855083.1|3226669_3227143_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011015549.1|3227170_3228115_+	universal stress protein	NA	NA	NA	NA	NA
WP_003861203.1|3228146_3228644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060565386.1|3228711_3229035_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_060565387.1|3229055_3229994_-	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_060565388.1|3230041_3231307_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_003855103.1|3231303_3231996_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	43.1	1.0e-38
WP_060565535.1|3231999_3233838_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_003855107.1|3234204_3235296_+	inositol-3-phosphate synthase	NA	A0A0H4IPK5	Stenotrophomonas_phage	42.4	8.6e-72
WP_075348539.1|3235371_3235926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060565390.1|3235991_3237479_-	DUF1846 domain-containing protein	NA	NA	NA	NA	NA
WP_006285365.1|3237847_3238261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006285366.1|3238437_3239343_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	U5P429	Shigella_phage	27.5	3.4e-13
WP_081299886.1|3239656_3240862_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	32.7	2.1e-31
WP_060565391.1|3241370_3241868_-	DNA starvation/stationary phase protection protein Dps	NA	NA	NA	NA	NA
WP_075348438.1|3242013_3242829_+	Fpg/Nei family DNA glycosylase	NA	NA	NA	NA	NA
WP_060565393.1|3243065_3244217_+	RtcB family protein	NA	A0A0M5M6X2	Mycobacterium_phage	63.2	1.4e-136
WP_003855120.1|3244223_3244700_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	42.7	5.0e-16
WP_075348439.1|3244714_3245728_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_060565394.1|3245885_3246809_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_060565395.1|3247112_3248291_+	MFS transporter	NA	NA	NA	NA	NA
WP_060565396.1|3248566_3249745_+	NADP-dependent malic enzyme	NA	NA	NA	NA	NA
WP_065532602.1|3249875_3251249_+	hypothetical protein	NA	NA	NA	NA	NA
3249749:3249764	attR	TTTGCTTATCGACGCC	NA	NA	NA	NA
WP_034983522.1|3251329_3252640_+|transposase	ISL3-like element IS31831 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	42.2	1.0e-82
