The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013219	Streptomyces hygroscopicus subsp. limoneus strain KCTC 1717 chromosome I	8648026	12785	64162	8648026	integrase,transposase	Gordonia_phage(50.0%)	39	NA	NA
WP_058083625.1|12785_14273_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_058078891.1|14635_15589_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_159103773.1|16640_17018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058078893.1|17687_17960_-	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_058078894.1|18056_18602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159103774.1|20136_20307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058078895.1|20955_23094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159103775.1|23090_23576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159103776.1|23701_23863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058078897.1|24508_24787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159103777.1|24798_25566_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_058078898.1|25466_25790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058078899.1|26043_26610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159103778.1|26787_28086_-	protein kinase	NA	NA	NA	NA	NA
WP_058078902.1|28811_29732_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	40.2	6.9e-46
WP_159103779.1|29728_29992_-|transposase	transposase	transposase	A0A1B3AZF8	Gordonia_phage	55.7	3.7e-13
WP_159103780.1|29923_30580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159103781.1|30679_31372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107112966.1|31653_32802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159103782.1|32993_33647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058078906.1|33957_34341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058078907.1|34588_34861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058078908.1|34845_38163_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_058083628.1|38820_39561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079087880.1|40155_40947_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_058078909.1|40903_41434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058078910.1|42948_43929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058078903.1|45821_46130_+|transposase	transposase	transposase	A0A1B3AZF8	Gordonia_phage	52.0	1.3e-17
WP_058078911.1|46126_47047_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	33.3	7.9e-34
WP_058078912.1|47635_48406_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_058078913.1|48402_48762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159103783.1|49085_49469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079087883.1|49351_49963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058078915.1|49928_50702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159103784.1|50698_51208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063823242.1|51236_51497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079087884.1|51544_58678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058078917.1|59262_62694_+	DNRLRE domain-containing protein	NA	NA	NA	NA	NA
WP_058078918.1|63070_64162_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP013219	Streptomyces hygroscopicus subsp. limoneus strain KCTC 1717 chromosome I	8648026	745809	807606	8648026	transposase,protease	Bacillus_phage(33.33%)	58	NA	NA
WP_058079276.1|745809_746763_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_058079277.1|746926_748258_-	MFS transporter	NA	NA	NA	NA	NA
WP_058079278.1|748341_748956_-	amino acid transporter	NA	NA	NA	NA	NA
WP_058079279.1|749022_749913_+	LysR family transcriptional regulator ArgP	NA	NA	NA	NA	NA
WP_014670730.1|750713_750965_+	WhiB family transcriptional regulator	NA	A0A2P1JRB7	Mycobacterium_phage	42.5	1.1e-11
WP_058079280.1|750985_751435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058079281.1|751525_753376_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	32.7	2.2e-27
WP_058079282.1|753372_754080_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.9	6.7e-25
WP_058079283.1|754100_754835_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_058079284.1|754904_756314_-	M1 family metallopeptidase	NA	NA	NA	NA	NA
WP_058079285.1|756501_756837_+	DUF488 family protein	NA	NA	NA	NA	NA
WP_058079286.1|756839_758513_-	FAD-binding dehydrogenase	NA	A0A2P0ZL82	Lactobacillus_phage	32.4	3.9e-07
WP_014670738.1|758610_759231_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_058079287.1|759346_759976_+	alpha-ketoglutarate-dependent dioxygenase AlkB	NA	A0A1X6WG33	Pacmanvirus	26.9	9.5e-07
WP_058079288.1|760057_760804_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_058079289.1|761574_762810_+	DUF4032 domain-containing protein	NA	NA	NA	NA	NA
WP_058079290.1|762811_763678_-	universal stress protein	NA	NA	NA	NA	NA
WP_014670743.1|763674_763923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014670744.1|763938_765615_+	response regulator	NA	G3MA85	Bacillus_virus	29.7	1.2e-32
WP_058079291.1|765611_767063_+	cyclic nucleotide-binding domain-containing protein	NA	NA	NA	NA	NA
WP_058079292.1|767059_767410_+	UBP-type zinc finger domain-containing protein	NA	NA	NA	NA	NA
WP_079087915.1|768026_769790_-	M4 family metallopeptidase	NA	NA	NA	NA	NA
WP_058083694.1|771529_772858_-|protease	serine protease	protease	NA	NA	NA	NA
WP_058079294.1|774130_775069_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015493185.1|776069_776744_+	AIM24 family protein	NA	NA	NA	NA	NA
WP_058079295.1|776896_777937_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_058079296.1|777933_778959_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_058079297.1|779050_780010_+	threonine/serine dehydratase	NA	NA	NA	NA	NA
WP_058079298.1|780163_781744_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_058079299.1|781794_782766_+	LLM class F420-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_058079300.1|782915_783419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079088222.1|783561_784641_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_058079301.1|784687_785116_+	SsgA family sporulation/cell division regulator	NA	NA	NA	NA	NA
WP_014670765.1|785231_785840_+	DUF2238 domain-containing protein	NA	NA	NA	NA	NA
WP_058079302.1|785903_786398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058079303.1|786451_787435_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_058079304.1|787554_788184_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_058079305.1|788180_789653_-	MFS transporter	NA	NA	NA	NA	NA
WP_058083696.1|789807_790488_-	lipase family protein	NA	E5ERW5	Ostreococcus_lucimarinus_virus	30.1	3.5e-15
WP_058079306.1|790963_792229_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_058079307.1|792294_793497_-	FAD-binding monooxygenase	NA	NA	NA	NA	NA
WP_079087917.1|793648_793927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079087918.1|793851_794574_-	ribonuclease HI	NA	A0A1D6Y7Z5	Golden_Marseillevirus	35.4	5.8e-16
WP_058079308.1|794608_795403_-	VOC family protein	NA	NA	NA	NA	NA
WP_058079309.1|795522_796437_+	aminoglycoside phosphotransferase family protein	NA	NA	NA	NA	NA
WP_014670775.1|796459_796942_-	VOC family protein	NA	NA	NA	NA	NA
WP_058079310.1|797100_797514_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014670777.1|797775_798666_+	RNA polymerase sigma factor SigF	NA	A0A0A0RV91	Bacillus_phage	32.3	2.3e-22
WP_058079311.1|798726_799206_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_058079312.1|799358_799769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058079313.1|800133_800517_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_014670781.1|800665_801658_-	L-glyceraldehyde 3-phosphate reductase	NA	NA	NA	NA	NA
WP_014670782.1|801769_802678_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_058083698.1|802766_803267_+	DUF664 domain-containing protein	NA	NA	NA	NA	NA
WP_058079276.1|803622_804576_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_058079314.1|804572_805652_-	adenosine deaminase	NA	NA	NA	NA	NA
WP_014670785.1|805699_806089_-	VOC family protein	NA	NA	NA	NA	NA
WP_058079315.1|806676_807606_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
>prophage 3
NZ_CP013219	Streptomyces hygroscopicus subsp. limoneus strain KCTC 1717 chromosome I	8648026	1009332	1063859	8648026	transposase,tail,protease	Bacillus_phage(33.33%)	33	NA	NA
WP_058079445.1|1009332_1012146_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_058079446.1|1014764_1017536_+	SpoIIE family protein phosphatase	NA	A0A1J0MCT1	Streptomyces_phage	47.6	2.6e-08
WP_058079447.1|1017657_1017990_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_014671002.1|1018242_1018986_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_058079448.1|1019138_1023884_+	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	39.8	1.3e-18
WP_014671004.1|1023908_1024457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058079449.1|1024544_1025012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058079451.1|1025774_1027109_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_058079452.1|1027123_1027492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058079453.1|1027796_1028360_+	universal stress protein	NA	NA	NA	NA	NA
WP_014671010.1|1029159_1029843_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.1	7.9e-23
WP_058079455.1|1029982_1030663_-	potassium-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_058079456.1|1030674_1032771_-	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.5	1.1e-27
WP_058079457.1|1032803_1034465_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_016434100.1|1034472_1034562_-	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_058079458.1|1034558_1034906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058079459.1|1035073_1035457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058079460.1|1035374_1037873_-	sensor histidine kinase KdpD	NA	NA	NA	NA	NA
WP_058079461.1|1038547_1040500_+	APC family permease	NA	NA	NA	NA	NA
WP_058079462.1|1041151_1041985_+	DUF4157 domain-containing protein	NA	NA	NA	NA	NA
WP_058079463.1|1042095_1043409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079087928.1|1043710_1044349_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_058079465.1|1044626_1046720_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_058079466.1|1046729_1047425_+	DUF4255 domain-containing protein	NA	NA	NA	NA	NA
WP_058079467.1|1047421_1049542_+	ATP-binding protein	NA	A0A2D2W2C3	Stenotrophomonas_phage	28.2	1.9e-06
WP_058079468.1|1051024_1051792_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_058079469.1|1051864_1052248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058083714.1|1052854_1053250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107112812.1|1053265_1054146_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_079087932.1|1054322_1055552_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_107112813.1|1057901_1061294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058079472.1|1061799_1063365_+|tail	phage tail sheath family protein	tail	J9PVC2	Bacillus_phage	34.0	7.3e-72
WP_014671025.1|1063415_1063859_+|tail	phage tail protein	tail	NA	NA	NA	NA
>prophage 4
NZ_CP013219	Streptomyces hygroscopicus subsp. limoneus strain KCTC 1717 chromosome I	8648026	8584304	8621439	8648026	transposase,protease	Bacillus_phage(50.0%)	27	NA	NA
WP_058083590.1|8584304_8585456_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_159103870.1|8586354_8586828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058083593.1|8587502_8588810_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_058083595.1|8589338_8589662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058084234.1|8592428_8593391_-	hypothetical protein	NA	M1H502	Paramecium_bursaria_Chlorella_virus	36.8	5.5e-46
WP_159103871.1|8594274_8594505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058083597.1|8594518_8595685_-	peptidoglycan bridge formation glycyltransferase FemA/FemB family protein	NA	NA	NA	NA	NA
WP_079088206.1|8595773_8596829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058083598.1|8597621_8598314_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	29.1	3.1e-19
WP_058084236.1|8598306_8599440_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_058083599.1|8600067_8601450_-	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_058083600.1|8602162_8603203_+	D-alanine--(R)-lactate ligase	NA	NA	NA	NA	NA
WP_058083601.1|8603199_8603808_+	D-Ala-D-Ala dipeptidase VanX	NA	NA	NA	NA	NA
WP_159103872.1|8603779_8604451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058083944.1|8606990_8607497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107112877.1|8607438_8608245_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_058083603.1|8608529_8609879_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_058084237.1|8609993_8610299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159103873.1|8610371_8610515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159103874.1|8611235_8612387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107112961.1|8612434_8613644_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	34.7	4.8e-31
WP_063823273.1|8613738_8614311_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_079088301.1|8614927_8615269_+	DUF4440 domain-containing protein	NA	NA	NA	NA	NA
WP_058083608.1|8616089_8616992_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_058083609.1|8617595_8618159_+	DinB family protein	NA	NA	NA	NA	NA
WP_107113022.1|8618420_8619902_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_079088209.1|8620005_8621439_+|transposase	IS1380 family transposase	transposase	A0A222ZN33	Mycobacterium_phage	47.0	5.2e-93
>prophage 1
NZ_CP013220	Streptomyces hygroscopicus subsp. limoneus strain KCTC 1717 chromosome II	1889906	12792	70473	1889906	transposase,integrase	Tupanvirus(16.67%)	49	NA	NA
WP_058083625.1|12792_14280_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_159103876.1|14674_15151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159103875.1|15254_15926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058083617.1|17258_18059_+	rubrerythrin family protein	NA	NA	NA	NA	NA
WP_058083616.1|19030_19537_-	transglycosylase SLT domain-containing protein	NA	A0A0M5M3L4	Enterococcus_phage	46.1	1.4e-16
WP_058083615.1|20111_20585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058083614.1|20808_21123_-	plastocyanin	NA	M4SLM5	Cyanophage	35.7	2.4e-06
WP_058084242.1|21294_21585_+	helicase	NA	NA	NA	NA	NA
WP_058083613.1|22646_22901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058083612.1|23264_24320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162493806.1|24457_25262_-|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	32.7	4.9e-24
WP_058084247.1|26006_26426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058084248.1|26719_27328_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_058084249.1|28643_28850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058084250.1|29750_31124_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0S949	Catovirus	28.9	1.7e-40
WP_058084251.1|32839_34981_-	MMPL family transporter	NA	NA	NA	NA	NA
WP_079088430.1|35150_35558_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_058084253.1|35698_35884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058084254.1|36020_36605_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_058084255.1|36601_37357_+	anti-sigma factor	NA	NA	NA	NA	NA
WP_058084256.1|37376_37685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058084257.1|37771_38434_-	fasciclin domain-containing protein	NA	NA	NA	NA	NA
WP_107113025.1|38538_40284_-	sulfite oxidase	NA	NA	NA	NA	NA
WP_058084259.1|40901_41108_+	DUF397 domain-containing protein	NA	NA	NA	NA	NA
WP_058085327.1|41268_41982_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_058084261.1|42779_43190_-	ATP-binding protein	NA	A0A1V0E640	Streptomyces_phage	38.0	1.1e-06
WP_058084262.1|43401_44208_-	DUF1295 domain-containing protein	NA	NA	NA	NA	NA
WP_058084263.1|44204_45512_-	class I SAM-dependent methyltransferase	NA	A0A2K9L4K8	Tupanvirus	27.0	2.3e-23
WP_058084264.1|45508_46807_-	methyltransferase domain-containing protein	NA	A0A2K9L0U7	Tupanvirus	29.0	2.4e-28
WP_107113055.1|46803_47568_-	DUF1365 domain-containing protein	NA	NA	NA	NA	NA
WP_058084265.1|47561_48857_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_058084266.1|49276_49876_-	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
WP_159103883.1|49960_51340_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	40.7	4.9e-64
WP_058085329.1|52049_52277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058084268.1|52444_53356_-	transcriptional regulator CynR	NA	Q6JIH3	Burkholderia_virus	27.6	2.5e-08
WP_058084269.1|53480_54089_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_058084270.1|54200_54671_+	cyanase	NA	NA	NA	NA	NA
WP_058084271.1|55416_55890_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_058085330.1|56481_56610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058084272.1|57371_58637_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_058079300.1|58772_59276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079088222.1|59418_60498_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_063823321.1|60642_61251_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_058084274.1|61175_61715_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_107113056.1|62805_63990_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_079088306.1|64584_68766_-	hypothetical protein	NA	A0A1V0SLL0	Klosneuvirus	31.2	2.8e-22
WP_058084278.1|69291_69591_+|transposase	transposase	transposase	Q9ETV7	Enterobacteria_phage	39.0	4.5e-07
WP_079088307.1|69587_69908_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_159103884.1|70224_70473_+|transposase	transposase	transposase	Q6J1X2	Lactobacillus_phage	42.6	7.8e-05
>prophage 2
NZ_CP013220	Streptomyces hygroscopicus subsp. limoneus strain KCTC 1717 chromosome II	1889906	81165	138206	1889906	transposase,integrase	Trichoplusia_ni_ascovirus(28.57%)	45	84021:84038	99324:99341
WP_079087880.1|81165_81957_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_063823322.1|82289_82697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058084285.1|83018_83327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159103889.1|83323_83470_+	hypothetical protein	NA	NA	NA	NA	NA
84021:84038	attL	CCGCGCCCGGTCCACCAC	NA	NA	NA	NA
WP_058084286.1|84165_84645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058084287.1|84769_84958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058084288.1|85223_86081_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_058084289.1|87186_87426_+	hypothetical protein	NA	A0A1B3AYL7	Gordonia_phage	46.7	2.6e-05
WP_058084290.1|87425_87803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058084291.1|89060_90464_+|transposase	IS1380 family transposase	transposase	A0A222ZN33	Mycobacterium_phage	43.8	4.6e-86
WP_079088312.1|90627_91152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058084292.1|91162_92263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063823321.1|93069_93678_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_058084274.1|93602_94142_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_079088433.1|95127_96186_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_159103892.1|100659_101268_+	hypothetical protein	NA	NA	NA	NA	NA
99324:99341	attR	CCGCGCCCGGTCCACCAC	NA	NA	NA	NA
WP_058084295.1|101264_101603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079088222.1|102316_103396_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_058079300.1|103538_104042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_030655824.1|104804_105494_-	nickel pincer cofactor biosynthesis protein LarB	NA	A0A096XTB6	Enterococcus_phage	32.1	4.7e-15
WP_058084297.1|105490_106771_-	nickel-dependent lactate racemase	NA	NA	NA	NA	NA
WP_058084298.1|106767_107703_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_058084299.1|107699_108695_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_058084300.1|108694_109546_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_058084301.1|109658_110363_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_058084302.1|110666_111974_+	fuconate dehydratase	NA	NA	NA	NA	NA
WP_058084303.1|111970_112729_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.3	1.9e-09
WP_058084304.1|112829_113906_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_058084305.1|113926_115435_+	sugar ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	32.3	1.8e-11
WP_058084306.1|116569_118987_+	glycoside hydrolase family 95 protein	NA	NA	NA	NA	NA
WP_058084307.1|119457_119775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058084308.1|120083_120866_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_058085335.1|120850_121699_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_058084309.1|121683_122022_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_058084310.1|122018_123200_-	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	23.9	3.5e-10
WP_058084311.1|123231_124140_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_058084312.1|124136_125090_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_058084313.1|125091_126462_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_058084314.1|127383_128145_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.6	5.4e-12
WP_058084315.1|128141_129161_-	alcohol dehydrogenase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_079088313.1|129249_130299_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_058084316.1|131458_134107_+	right-handed parallel beta-helix repeat-containing protein	NA	NA	NA	NA	NA
WP_058084317.1|135154_135478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058084318.1|135598_136417_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_058084320.1|136928_138206_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP013220	Streptomyces hygroscopicus subsp. limoneus strain KCTC 1717 chromosome II	1889906	174387	246658	1889906	transposase,integrase	Bacillus_phage(25.0%)	58	166539:166559	216315:216335
166539:166559	attL	CTGCTGAATCACCCACCAGCC	NA	NA	NA	NA
WP_058084347.1|174387_175374_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_058084348.1|175846_176728_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_058084349.1|176797_177721_+	EamA family transporter	NA	NA	NA	NA	NA
WP_159103897.1|177717_178227_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_159103898.1|178603_178903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058084351.1|180986_181235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058085341.1|181203_181719_-	N-acetyltransferase	NA	A0A1P8CWJ6	Bacillus_phage	33.3	3.4e-18
WP_058084352.1|182092_182659_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_058084354.1|184096_184549_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_058084355.1|184562_185630_+	NAD-dependent epimerase/dehydratase family protein	NA	L7RCI0	Acanthamoeba_polyphaga_moumouvirus	22.4	2.1e-06
WP_159103899.1|186109_186340_+	LysE family transporter	NA	NA	NA	NA	NA
WP_058084274.1|186371_186911_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_063823321.1|186835_187444_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_159103900.1|187701_188607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159103901.1|189150_189879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159103902.1|190347_192552_-	CHAT domain-containing protein	NA	NA	NA	NA	NA
WP_159103903.1|192728_193295_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	37.9	8.5e-23
WP_058084359.1|193532_193967_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_159103904.1|194462_194666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058084362.1|195072_196533_-	DUF642 domain-containing protein	NA	NA	NA	NA	NA
WP_058084363.1|196661_197225_-	DUF642 domain-containing protein	NA	NA	NA	NA	NA
WP_058084364.1|198824_199049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159103905.1|200352_200502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058084366.1|202504_202846_-	hypothetical protein	NA	A0A142K9D3	Gordonia_phage	40.7	4.4e-06
WP_107113029.1|203073_204054_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_058084368.1|205253_206126_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_041664925.1|206271_206676_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_063823301.1|207162_209118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159103906.1|209102_209288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058084370.1|209353_209935_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_058084371.1|209970_211233_+	alpha/beta hydrolase fold domain-containing protein	NA	NA	NA	NA	NA
WP_058084372.1|211290_211701_-	VOC family protein	NA	NA	NA	NA	NA
WP_058084373.1|212701_212905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107113030.1|212924_215741_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_058084374.1|215961_216321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058085343.1|217950_220140_-	MMPL family transporter	NA	NA	NA	NA	NA
216315:216335	attR	CTGCTGAATCACCCACCAGCC	NA	NA	NA	NA
WP_079082465.1|221664_222363_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_159103907.1|222907_223093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058084377.1|223233_224508_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_058085344.1|224766_225993_-	cytochrome P450	NA	NA	NA	NA	NA
WP_058085345.1|226004_227195_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_058084378.1|227206_227404_-	ferredoxin	NA	NA	NA	NA	NA
WP_058084379.1|227642_228320_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_058084380.1|228316_229615_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_058084381.1|229966_232222_-	MMPL family transporter	NA	NA	NA	NA	NA
WP_058085346.1|232394_233246_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_107113060.1|233664_234210_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_058085347.1|234316_234721_+	winged helix DNA-binding protein	NA	NA	NA	NA	NA
WP_041666057.1|235672_235900_+	ferredoxin	NA	NA	NA	NA	NA
WP_058084383.1|235896_237264_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_058084384.1|237299_238520_+	cytochrome P450	NA	NA	NA	NA	NA
WP_041665681.1|239225_239699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058084385.1|239963_240515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058079306.1|242148_243414_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_058084386.1|243596_243809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058084387.1|243876_244611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058084388.1|245337_245883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148282127.1|246403_246658_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP013220	Streptomyces hygroscopicus subsp. limoneus strain KCTC 1717 chromosome II	1889906	1803785	1861621	1889906	transposase	Acanthocystis_turfacea_Chlorella_virus(40.0%)	36	NA	NA
WP_058085485.1|1803785_1804556_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_058085300.1|1806526_1807297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058085301.1|1807557_1808067_+	SigE family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_058085302.1|1808059_1808872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079088423.1|1809885_1810671_+	TIM barrel protein	NA	NA	NA	NA	NA
WP_058085303.1|1810684_1810918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058085304.1|1810965_1812396_-	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_058085305.1|1812471_1813062_-	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_058085306.1|1813230_1814094_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_058085307.1|1814571_1814781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058085308.1|1815666_1816449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079088476.1|1816526_1818575_+	ABC transporter substrate-binding protein	NA	M1HTZ5	Acanthocystis_turfacea_Chlorella_virus	26.1	5.1e-09
WP_058085309.1|1818577_1820731_+	ABC transporter substrate-binding protein	NA	M1I231	Acanthocystis_turfacea_Chlorella_virus	27.4	1.3e-10
WP_058085310.1|1820839_1821418_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_058085312.1|1824274_1824844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159103955.1|1825347_1826019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079088477.1|1826763_1827714_+	oxidoreductase	NA	NA	NA	NA	NA
WP_014670151.1|1828273_1829113_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_014670152.1|1829269_1829476_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	62.7	6.7e-18
WP_058085315.1|1831359_1832505_-	cell surface receptor IPT/TIG domain-containing protein	NA	NA	NA	NA	NA
WP_058085316.1|1833334_1834405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079088478.1|1835400_1835823_-	Ig-like domain repeat protein	NA	NA	NA	NA	NA
WP_079088425.1|1836033_1837053_-	cell shape-determining protein	NA	A0A222ZEQ0	Arthrobacter_phage	37.2	6.5e-05
WP_014670158.1|1838043_1838790_+	cell surface protein	NA	NA	NA	NA	NA
WP_079088426.1|1839341_1845668_-	type I polyketide synthase	NA	D0R7J2	Paenibacillus_phage	33.7	1.5e-27
WP_079088479.1|1845912_1847181_-	ketoacyl synthase	NA	NA	NA	NA	NA
WP_014670161.1|1847926_1848331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058085318.1|1849603_1850155_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_079088429.1|1851280_1852366_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_058085490.1|1852435_1853266_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_058085320.1|1853562_1853997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058085321.1|1855903_1857181_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_058079300.1|1857303_1857807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079088222.1|1857949_1859029_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_058084249.1|1859271_1859478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079088222.1|1860541_1861621_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
