The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013118	Salinivirga cyanobacteriivorans strain L21-Spi-D4 chromosome, complete genome	4812386	89856	110723	4812386	integrase,transposase	Enterobacteria_phage(33.33%)	20	92664:92691	112901:112928
WP_057951392.1|89856_91164_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_057951393.1|91152_92292_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
92664:92691	attL	AGTAGTGTTTGCCAAATTCTACGTTATG	NA	NA	NA	NA
WP_057951394.1|92963_94514_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_057951395.1|94531_95251_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	29.4	4.4e-24
WP_057951396.1|95295_95871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057951397.1|96028_96358_+	helix-turn-helix transcriptional regulator	NA	Q0H244	Geobacillus_phage	39.1	3.2e-06
WP_057951398.1|96433_97216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057951399.1|97220_98198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057951401.1|98989_99748_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	34.0	4.2e-33
WP_157754489.1|99750_101292_-|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	23.2	5.8e-13
WP_157754490.1|101806_102478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081421400.1|102509_105101_-	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_057951397.1|105258_105588_+	helix-turn-helix transcriptional regulator	NA	Q0H244	Geobacillus_phage	39.1	3.2e-06
WP_057951404.1|105652_106072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057951405.1|106068_107130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157754491.1|107101_107404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057951408.1|108433_108742_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_057951409.1|108735_108984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095532260.1|109024_109888_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_169792590.1|109871_110723_-|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	27.6	6.0e-12
112901:112928	attR	AGTAGTGTTTGCCAAATTCTACGTTATG	NA	NA	NA	NA
>prophage 2
NZ_CP013118	Salinivirga cyanobacteriivorans strain L21-Spi-D4 chromosome, complete genome	4812386	123809	180281	4812386	transposase,integrase	Leptospira_phage(25.0%)	49	137399:137458	186768:186893
WP_095532260.1|123809_124673_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_169792590.1|124656_125508_-|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	27.6	6.0e-12
WP_057951411.1|125622_128259_-	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_057951412.1|128414_128750_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_057951413.1|128793_129339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157754493.1|129350_131042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057951421.1|131080_131506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057951422.1|131978_132560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157754494.1|132572_134045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057951401.1|134872_135631_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	34.0	4.2e-33
WP_157754495.1|135633_137175_-|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	23.2	5.8e-13
137399:137458	attL	AGCAGGCTCGCTTAACTCGGGCAGCGGTTGGCTGTGACTGCGATGTGGAGTTTACGGAAC	NA	NA	NA	NA
WP_157754490.1|137675_138347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081421401.1|138378_140940_-	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_057951425.1|141103_141439_+	helix-turn-helix transcriptional regulator	NA	A0A139ZPI6	Marinitoga_camini_virus	41.2	6.2e-05
WP_057951426.1|141567_142341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057951427.1|142352_143330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157754490.1|144390_145062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057951428.1|145093_147697_-	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_057951429.1|147860_148196_+	helix-turn-helix transcriptional regulator	NA	A0A139ZPI6	Marinitoga_camini_virus	41.2	6.2e-05
WP_057951430.1|148252_148885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157754496.1|148894_149917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057951432.1|150285_151680_-	YARHG domain-containing protein	NA	NA	NA	NA	NA
WP_157754497.1|151686_152970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057951435.1|153338_154508_-	YARHG domain-containing protein	NA	NA	NA	NA	NA
WP_057951436.1|154517_155513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157754490.1|156585_157257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081421402.1|157288_159850_-	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_057951437.1|160006_160339_+	helix-turn-helix transcriptional regulator	NA	Q0H244	Geobacillus_phage	33.0	7.7e-08
WP_057951438.1|160358_160868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057951439.1|160864_162865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157754498.1|163206_163365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095532261.1|163372_164335_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_057954807.1|164466_164778_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_057951441.1|164958_165321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157754499.1|165313_166006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157754490.1|167019_167691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157754500.1|167722_168691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057951445.1|168793_170278_-	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_057951446.1|170434_170770_+	helix-turn-helix transcriptional regulator	NA	Q0H244	Geobacillus_phage	33.0	6.0e-08
WP_057951447.1|170839_171238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057951448.1|171212_172565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057951421.1|172516_172942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057951449.1|173414_174641_-	YARHG domain-containing protein	NA	NA	NA	NA	NA
WP_157754501.1|174645_176160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157754502.1|176152_176911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057951453.1|177967_178324_-	DUF2442 domain-containing protein	NA	NA	NA	NA	NA
WP_057951454.1|178307_178544_-	DUF4160 domain-containing protein	NA	NA	NA	NA	NA
WP_095532292.1|178582_179143_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_169792591.1|179429_180281_-|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	24.8	2.1e-09
186768:186893	attR	AGCAGGCTCGCTTAACTCGGGCAGCGGTTGGCTGTGACTGCGATGTGGAGTTTACGGAACATGGCAGGCGCAGACAAAGGAGCTGCCAATGAGGAAGATTGAGGAACGCAAAAAACATGACAAGCT	NA	NA	NA	NA
>prophage 3
NZ_CP013118	Salinivirga cyanobacteriivorans strain L21-Spi-D4 chromosome, complete genome	4812386	187676	303174	4812386	transposase,integrase	Leptospira_phage(38.1%)	101	275738:275797	303175:303244
WP_081421404.1|187676_188540_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_169792592.1|188523_189375_-|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	25.2	9.6e-10
WP_057951465.1|189489_192156_-	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_057951457.1|192307_192643_+	helix-turn-helix transcriptional regulator	NA	H0UST7	Bacillus_phage	36.2	1.3e-10
WP_057951466.1|192890_193103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057951467.1|193112_196106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057951418.1|196215_197037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057951419.1|197039_197960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057951469.1|198979_199300_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_057951470.1|199579_200746_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_057951471.1|200789_201116_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_095532293.1|201155_201728_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_057951472.1|202002_202884_-|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	27.0	3.3e-13
WP_057951473.1|203011_205585_-	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_057954811.1|205743_206076_+	helix-turn-helix transcriptional regulator	NA	Q8LTJ3	Vibrio_virus	35.2	2.4e-09
WP_057951474.1|206089_206569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057951475.1|206555_207767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057951332.1|208985_210185_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_057951477.1|210256_210583_-	DUF2442 domain-containing protein	NA	NA	NA	NA	NA
WP_057951454.1|210566_210803_-	DUF4160 domain-containing protein	NA	NA	NA	NA	NA
WP_095532262.1|210841_211705_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_169792592.1|211688_212540_-|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	25.2	9.6e-10
WP_057951479.1|212654_215267_-	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_057954811.1|215425_215758_+	helix-turn-helix transcriptional regulator	NA	Q8LTJ3	Vibrio_virus	35.2	2.4e-09
WP_057951474.1|215771_216251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057951475.1|216237_217449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157754490.1|218451_219123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057951480.1|219154_221737_-	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_057951481.1|221889_222231_+	helix-turn-helix transcriptional regulator	NA	A8ASM2	Listeria_phage	41.2	2.6e-06
WP_057951482.1|222292_222841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157754503.1|222824_225077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057951484.1|225403_226603_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_157754490.1|227498_228170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057951485.1|228201_230784_-	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_057951481.1|230936_231278_+	helix-turn-helix transcriptional regulator	NA	A8ASM2	Listeria_phage	41.2	2.6e-06
WP_057951486.1|231445_231841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057951394.1|232088_233639_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_057951395.1|233656_234376_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	29.4	4.4e-24
WP_057951487.1|234490_234910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057951488.1|234906_235191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057951489.1|235236_235776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057951490.1|235859_236660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057951491.1|236662_237556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057951469.1|238591_238912_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_057951492.1|238895_239222_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_081421407.1|239261_240125_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_157754504.1|240108_240990_-|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	27.5	9.6e-13
WP_057951494.1|241074_243795_-	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_057951495.1|243959_244301_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_057951496.1|244482_244761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057951497.1|244765_246838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057951469.1|247894_248215_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_057951492.1|248198_248525_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_081421407.1|248564_249428_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_157754504.1|249411_250293_-|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	27.5	9.6e-13
WP_057951498.1|250377_252390_-	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_057951499.1|252380_253274_-|transposase	IS1595-like element ISUnb1 family transposase	transposase	NA	NA	NA	NA
WP_057951500.1|253320_254016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057951501.1|254180_254522_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_157754505.1|254542_255487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057951503.1|255510_257589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057951504.1|257592_258981_-	YARHG domain-containing protein	NA	NA	NA	NA	NA
WP_057951505.1|258992_260546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157754506.1|261091_261688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057951507.1|261671_262940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057951508.1|263006_264275_-	YARHG domain-containing protein	NA	NA	NA	NA	NA
WP_057951509.1|264264_265734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057951510.1|266206_266788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157754507.1|266799_269478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057951512.1|269618_270113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057951513.1|270317_270833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157754508.1|270825_272379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057951462.1|273446_273755_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_057951463.1|273748_273997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157754711.1|274037_274415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057951516.1|274383_274902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169792591.1|274885_275737_-|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	24.8	2.1e-09
275738:275797	attL	CCACTTTCGGAAGTTTTCGGATAAAAACACGAACTGTTTACTTTCGATTCTCCTATTAAC	NA	NA	NA	NA
WP_057951518.1|275894_278297_-	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_057951519.1|278436_279816_-|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	36.9	5.4e-71
WP_057951520.1|280354_280702_+	helix-turn-helix transcriptional regulator	NA	A0A2P1JU09	Anoxybacillus_phage	32.7	1.2e-06
WP_057951521.1|280715_281987_-	YARHG domain-containing protein	NA	NA	NA	NA	NA
WP_057951522.1|281983_283495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157754509.1|283487_284246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057951524.1|284789_286355_+|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	23.2	7.6e-13
WP_057951401.1|286357_287116_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	34.0	4.2e-33
WP_057951453.1|287879_288236_-	DUF2442 domain-containing protein	NA	NA	NA	NA	NA
WP_057951454.1|288219_288456_-	DUF4160 domain-containing protein	NA	NA	NA	NA	NA
WP_095532262.1|288494_289358_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_169792593.1|289341_290193_-|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	25.2	9.6e-10
WP_169792594.1|290350_292999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057951528.1|293150_293510_+	helix-turn-helix transcriptional regulator	NA	H0UST7	Bacillus_phage	37.8	6.9e-10
WP_057951529.1|293484_293805_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_057951531.1|294658_294847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057951458.1|294887_295925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057951459.1|295917_297258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157754511.1|297824_299366_+|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	22.2	3.4e-13
WP_057951401.1|299368_300127_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	34.0	4.2e-33
WP_057951462.1|300884_301193_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_057951409.1|301186_301435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095532295.1|301475_302036_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_169792595.1|302322_303174_-|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	24.8	9.6e-10
303175:303244	attR	CCACTTTCGGAAGTTTTCGGATAAAAACACGAACTGTTTACTTTCGATTCTCCTATTAACACTTTTTTGG	NA	NA	NA	NA
>prophage 4
NZ_CP013118	Salinivirga cyanobacteriivorans strain L21-Spi-D4 chromosome, complete genome	4812386	456576	553824	4812386	tRNA,integrase,transposase	Escherichia_phage(15.79%)	88	440383:440398	499133:499148
440383:440398	attL	ATTACAAATAATAAAT	NA	NA	NA	NA
WP_057951634.1|456576_457161_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_057951635.1|458541_459402_-	DUF4249 domain-containing protein	NA	NA	NA	NA	NA
WP_057951636.1|459404_461735_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_057951637.1|461863_462136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057951638.1|462702_463494_-	alpha/beta hydrolase	NA	A0A023W7H4	Mycobacterium_phage	27.9	1.2e-14
WP_157754518.1|463869_464013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057951639.1|464291_464684_-	DUF4372 domain-containing protein	NA	NA	NA	NA	NA
WP_057951640.1|464684_464912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057951641.1|464917_465604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057951642.1|465718_466018_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_057951643.1|466008_466242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081421415.1|466537_466861_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_157754519.1|466836_467040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095532264.1|467390_470111_-	pyruvate, phosphate dikinase	NA	H8YJB7	Vibrio_phage	37.1	1.4e-83
WP_057951647.1|470324_471602_-	anthranilate synthase component I family protein	NA	A0A0B5J984	Pandoravirus	29.5	2.7e-24
WP_057951648.1|471588_472185_-	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	A0A0B5J984	Pandoravirus	31.9	7.1e-20
WP_057951649.1|472248_473319_-	alanine/ornithine racemase family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_057954820.1|473366_473876_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_057951650.1|474011_475103_+	AhpC/TSA family protein	NA	NA	NA	NA	NA
WP_057951651.1|475285_476452_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_057951652.1|476795_477185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057951654.1|477546_478992_+|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	30.8	5.4e-29
WP_057951655.1|479136_480078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057951656.1|480080_480470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057951657.1|480702_481035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081421613.1|481103_481349_+	SEC-C domain-containing protein	NA	V5LQX0	Emiliania_huxleyi_virus	60.0	4.5e-05
WP_057951660.1|481712_481922_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_057951661.1|481908_483933_+	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_057951662.1|483926_485408_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_057951519.1|485982_487362_+|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	36.9	5.4e-71
WP_057951664.1|487441_487726_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A222YWE2	Escherichia_phage	42.7	5.4e-10
WP_057951665.1|487737_488043_+	HigA family addiction module antidote protein	NA	M9MUN2	Rhodococcus_phage	51.4	1.4e-11
WP_057954821.1|488701_490195_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_057951666.1|490187_491462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057951667.1|491765_492419_+	Abi family protein	NA	NA	NA	NA	NA
WP_057951668.1|493199_494123_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_057951669.1|494935_496102_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_081421416.1|496389_496680_+	DUF1801 domain-containing protein	NA	NA	NA	NA	NA
WP_095532266.1|496794_497757_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_057954807.1|497888_498200_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_157754520.1|498364_499444_+	histidine kinase	NA	Q9EYF3	Enterobacteria_phage	25.7	3.8e-11
499133:499148	attR	ATTACAAATAATAAAT	NA	NA	NA	NA
WP_057951673.1|499424_500186_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_057951674.1|500309_502637_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_157754521.1|502653_503484_+	DUF4249 domain-containing protein	NA	NA	NA	NA	NA
WP_157754522.1|503760_504777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057951677.1|504901_506017_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_057951678.1|506034_506256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057951679.1|506324_507218_+|transposase	IS1595-like element ISUnb2 family transposase	transposase	NA	NA	NA	NA
WP_057951680.1|507249_508149_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_057951681.1|508536_508776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057951682.1|509554_509794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057951683.1|509786_510080_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_057951684.1|510458_511118_+	T9SS type A sorting domain-containing protein	NA	NA	NA	NA	NA
WP_057951686.1|511554_515055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057951687.1|515041_517093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081421417.1|517366_518569_-	group II intron reverse transcriptase/maturase	NA	H7BV92	unidentified_phage	25.3	7.9e-10
WP_057951688.1|518681_519431_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	33.2	1.4e-25
WP_057951689.1|519434_520994_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_057951690.1|521284_521575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057951691.1|521571_521811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057951401.1|522798_523557_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	34.0	4.2e-33
WP_057951524.1|523559_525125_-|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	23.2	7.6e-13
WP_057951692.1|525875_526628_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_057951693.1|526630_528241_-	family 20 glycosylhydrolase	NA	NA	NA	NA	NA
WP_057951694.1|528298_529177_-	pyridoxamine kinase	NA	NA	NA	NA	NA
WP_057951695.1|529309_531169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057951696.1|531211_532147_+|tRNA	methionyl-tRNA formyltransferase	tRNA	NA	NA	NA	NA
WP_157754523.1|532157_533153_+	acyltransferase family protein	NA	A0A1R3Y5Q6	Salmonella_virus	25.6	1.2e-08
WP_057951698.1|533163_534150_-	flippase-like domain-containing protein	NA	NA	NA	NA	NA
WP_057951699.1|534142_534910_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_057951700.1|534916_536881_-	glycoside hydrolase family 127 protein	NA	NA	NA	NA	NA
WP_057951701.1|537105_537558_+	nucleoside-diphosphate kinase	NA	A0A0M5KH58	Mollivirus	32.8	7.3e-09
WP_057951702.1|537592_537886_-	DUF721 domain-containing protein	NA	NA	NA	NA	NA
WP_057954822.1|537894_539001_-	DNA replication and repair protein RecF	NA	NA	NA	NA	NA
WP_057951703.1|539147_539846_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_057951704.1|539923_540427_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	39.3	1.2e-20
WP_057951705.1|540419_540722_+	Dabb family protein	NA	NA	NA	NA	NA
WP_057951708.1|541780_544399_-	hypothetical protein	NA	A0A1V0SHP6	Klosneuvirus	27.7	6.8e-14
WP_157754712.1|544614_544737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057951709.1|544936_545194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057951710.1|545304_545535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057951711.1|545629_547003_+	radical SAM protein	NA	D5GVT8	Campylobacter_virus	26.4	6.5e-08
WP_157754524.1|546983_548282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057951713.1|548287_548659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057951470.1|548971_550138_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_057951392.1|550411_551719_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_057951715.1|552242_552560_+	SPASM domain-containing protein	NA	NA	NA	NA	NA
WP_057951332.1|552624_553824_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP013118	Salinivirga cyanobacteriivorans strain L21-Spi-D4 chromosome, complete genome	4812386	686661	763992	4812386	tail,tRNA,transposase	Cowpox_virus(11.11%)	55	NA	NA
WP_057951822.1|686661_687735_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_057951499.1|687790_688684_-|transposase	IS1595-like element ISUnb1 family transposase	transposase	NA	NA	NA	NA
WP_057951823.1|688734_689130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057951392.1|689381_690689_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_057951824.1|690879_695715_-	T9SS type A sorting domain-containing protein	NA	NA	NA	NA	NA
WP_057951825.1|696122_696998_+	YicC family protein	NA	NA	NA	NA	NA
WP_057951826.1|697000_697567_+	guanylate kinase	NA	A0A212PP84	Cowpox_virus	33.0	3.0e-20
WP_057951827.1|697563_698154_+	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_057951828.1|698209_698728_+	DUF308 domain-containing protein	NA	NA	NA	NA	NA
WP_057951829.1|698807_700769_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	43.0	3.6e-137
WP_057951830.1|700903_702595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057951831.1|702602_705710_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_057951832.1|705897_707034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057951833.1|707114_707927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057951834.1|707928_708774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057951835.1|709236_710418_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_057951836.1|710448_712269_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.2	1.3e-59
WP_057951837.1|712495_712948_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_057951838.1|713046_713247_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	47.6	1.3e-10
WP_057951839.1|713261_713522_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_057951840.1|714555_715479_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_157754536.1|715590_717228_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_057951842.1|717224_718127_-	flippase-like domain-containing protein	NA	NA	NA	NA	NA
WP_057951843.1|718318_719326_+	NAD-dependent epimerase/dehydratase family protein	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.9	4.9e-37
WP_057951844.1|719330_720461_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_057951845.1|720480_721371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057951846.1|721477_722233_-	7-cyano-7-deazaguanine synthase	NA	NA	NA	NA	NA
WP_169792596.1|722356_724156_-	hypothetical protein	NA	F2Y0V3	Organic_Lake_phycodnavirus	24.0	8.5e-08
WP_057951848.1|724282_724696_+	DUF2141 domain-containing protein	NA	NA	NA	NA	NA
WP_057951849.1|724863_725979_-	toxin-antitoxin system YwqK family antitoxin	NA	NA	NA	NA	NA
WP_057951850.1|725975_726779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057951851.1|726832_728791_+	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_057951852.1|728940_729525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157754537.1|729598_730108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057951854.1|730109_733658_+	OmpA family protein	NA	NA	NA	NA	NA
WP_057951855.1|734775_735156_-	DUF1987 domain-containing protein	NA	NA	NA	NA	NA
WP_057951856.1|735281_736421_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_057951857.1|736442_736817_-	DUF1987 domain-containing protein	NA	NA	NA	NA	NA
WP_057951858.1|736999_738034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057951859.1|738259_738934_+	DUF2807 domain-containing protein	NA	NA	NA	NA	NA
WP_057951860.1|738926_739703_+	Rossmann-like and DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_057951861.1|739886_740393_+	HAD hydrolase family protein	NA	A0A140XBD6	Dickeya_phage	30.1	1.3e-14
WP_057951862.1|740435_741392_+	geranylgeranylglycerol-phosphate geranylgeranyltransferase	NA	NA	NA	NA	NA
WP_095532267.1|741388_741970_+	septum formation protein Maf	NA	NA	NA	NA	NA
WP_095532268.1|741987_744162_+	S46 family peptidase	NA	NA	NA	NA	NA
WP_057951863.1|744207_745104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057951864.1|745123_746434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169792597.1|746435_747506_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_081421615.1|747639_748656_+	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_057951529.1|749729_750050_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_057951867.1|750276_751521_+	GAF domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_057954830.1|752061_753495_-	carbon starvation protein A	NA	NA	NA	NA	NA
WP_057951868.1|753905_757337_+|tail	tail fiber domain-containing protein	tail	D6PFV0	uncultured_phage	33.9	1.3e-09
WP_057951869.1|757354_759919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057951870.1|760056_763992_+|tail	tail fiber domain-containing protein	tail	A0A1W6JU56	Escherichia_phage	32.3	3.5e-06
>prophage 6
NZ_CP013118	Salinivirga cyanobacteriivorans strain L21-Spi-D4 chromosome, complete genome	4812386	777099	789454	4812386		Hokovirus(50.0%)	6	NA	NA
WP_057951877.1|777099_779886_-	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	30.0	5.0e-15
WP_057951878.1|780040_781171_-	hybrid sensor histidine kinase/response regulator	NA	W8CYM9	Bacillus_phage	40.4	7.4e-18
WP_057951879.1|781335_785766_+	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	35.7	3.5e-39
WP_057951880.1|785809_787072_+	response regulator	NA	W8CYM9	Bacillus_phage	41.3	3.4e-19
WP_057951881.1|787090_788326_+	response regulator	NA	W8CYM9	Bacillus_phage	39.9	6.2e-18
WP_057951882.1|788338_789454_+	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	31.1	6.2e-25
>prophage 7
NZ_CP013118	Salinivirga cyanobacteriivorans strain L21-Spi-D4 chromosome, complete genome	4812386	1582723	1639332	4812386	transposase,protease	Hokovirus(25.0%)	39	NA	NA
WP_057952474.1|1582723_1583662_-|protease	aspartyl protease family protein	protease	NA	NA	NA	NA
WP_057952475.1|1583909_1584914_-	DUF4065 domain-containing protein	NA	NA	NA	NA	NA
WP_057952476.1|1585047_1585398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057952477.1|1588196_1590098_-	M28 family peptidase	NA	NA	NA	NA	NA
WP_057952478.1|1590094_1590751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095532304.1|1591785_1595013_+	S41 family peptidase	NA	NA	NA	NA	NA
WP_057951392.1|1597304_1598612_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_057952483.1|1599219_1600329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057952484.1|1600490_1603862_-	hypothetical protein	NA	A0A1V0SGX0	Hokovirus	30.8	6.2e-28
WP_057952485.1|1604140_1604416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057952486.1|1604515_1606357_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	27.0	5.4e-50
WP_057952487.1|1606367_1607180_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_057952488.1|1607210_1608122_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_157754578.1|1608196_1609300_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_057952490.1|1609299_1610397_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_057952491.1|1610481_1611348_+	gliding motility-associated C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_057952492.1|1612407_1612971_+	DUF4199 domain-containing protein	NA	NA	NA	NA	NA
WP_057952493.1|1613022_1613970_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	28.4	5.6e-19
WP_057952494.1|1614078_1614567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057952495.1|1614570_1614885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057952496.1|1615066_1615942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157754579.1|1616121_1618245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057952498.1|1618264_1619407_-	DUF4249 domain-containing protein	NA	NA	NA	NA	NA
WP_057952499.1|1619396_1622189_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_057952500.1|1622175_1622901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057952501.1|1623127_1623811_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	29.6	3.1e-27
WP_057952502.1|1623811_1625134_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_057952503.1|1625253_1626672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057952504.1|1626682_1628026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057954849.1|1628045_1628975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057952505.1|1628994_1629459_-	glycine zipper family protein	NA	NA	NA	NA	NA
WP_157754580.1|1629566_1629950_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_057952507.1|1630092_1631088_-	YhdH/YhfP family quinone oxidoreductase	NA	NA	NA	NA	NA
WP_057952508.1|1631251_1632271_-	sodium:calcium antiporter	NA	NA	NA	NA	NA
WP_057952509.1|1632367_1632817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057952510.1|1633036_1635733_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_057952511.1|1635974_1636808_+	NmrA family NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_057952512.1|1637203_1637992_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_057951785.1|1638024_1639332_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP013118	Salinivirga cyanobacteriivorans strain L21-Spi-D4 chromosome, complete genome	4812386	1710177	1718438	4812386		Enterobacteria_phage(33.33%)	7	NA	NA
WP_057952564.1|1710177_1711374_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	25.5	1.5e-21
WP_057954853.1|1711524_1712238_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_057952565.1|1712472_1715115_+	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	35.4	3.3e-40
WP_057952566.1|1715127_1716009_-	dTDP-4-dehydrorhamnose reductase	NA	A0A1D8EQE2	Escherichia_phage	38.4	8.6e-38
WP_057952567.1|1716001_1716562_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	50.7	2.9e-39
WP_057952568.1|1716565_1717438_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	61.8	1.3e-102
WP_057952569.1|1717472_1718438_-	SDR family oxidoreductase	NA	A0A2K9KZK0	Tupanvirus	47.6	1.5e-75
>prophage 9
NZ_CP013118	Salinivirga cyanobacteriivorans strain L21-Spi-D4 chromosome, complete genome	4812386	2265296	2337520	4812386	tRNA,transposase	Lactococcus_phage(16.67%)	57	NA	NA
WP_057952975.1|2265296_2266604_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_057952976.1|2266767_2268537_+	M14 family metallopeptidase	NA	NA	NA	NA	NA
WP_157754610.1|2268500_2268650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081421487.1|2268718_2270707_+	alkaline phosphatase family protein	NA	NA	NA	NA	NA
WP_057952978.1|2271132_2271891_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	34.7	3.2e-33
WP_081421488.1|2272043_2273600_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_057952979.1|2273607_2274366_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	35.2	9.3e-33
WP_057952980.1|2274531_2276049_-|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	23.2	7.4e-13
WP_057952981.1|2276696_2277701_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_057952982.1|2277700_2279107_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_157754611.1|2279441_2279942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057952985.1|2280042_2282247_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_057952986.1|2282259_2282595_+	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_057951470.1|2282826_2283993_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_057952987.1|2284265_2284838_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_057952988.1|2284851_2287665_+	serine/threonine protein kinase	NA	A0A1V0SDC3	Indivirus	28.6	5.6e-14
WP_057952989.1|2287970_2289533_-	SBBP repeat-containing protein	NA	A0A1V0SHI6	Klosneuvirus	28.2	1.6e-26
WP_057952990.1|2289563_2290055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157754612.1|2290211_2290385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057952992.1|2291023_2292331_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_057952993.1|2292433_2296354_-	PAS domain S-box protein	NA	W8CYF6	Bacillus_phage	26.7	2.8e-19
WP_057952994.1|2296353_2297049_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_057952995.1|2297329_2298346_-	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
WP_057952996.1|2298447_2299290_-	universal stress protein	NA	NA	NA	NA	NA
WP_081421622.1|2299338_2300874_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_057952997.1|2301237_2302422_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_057952998.1|2302596_2303730_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_081421490.1|2303896_2305051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057953000.1|2305037_2305502_+	gliding motility lipoprotein GldH	NA	NA	NA	NA	NA
WP_057953001.1|2305504_2306221_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_057953002.1|2306204_2306522_+	MGMT family protein	NA	NA	NA	NA	NA
WP_057953003.1|2306534_2307632_+	Mrp/NBP35 family ATP-binding protein	NA	NA	NA	NA	NA
WP_057953004.1|2307673_2310337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057953005.1|2310376_2311927_+	bifunctional response regulator/alkaline phosphatase family protein	NA	NA	NA	NA	NA
WP_057953006.1|2311923_2312352_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_057953007.1|2312344_2312737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057953008.1|2312733_2313234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057953009.1|2313237_2315379_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.0	5.6e-67
WP_057953010.1|2315541_2316156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057953011.1|2316156_2317608_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_057953012.1|2317666_2319106_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	40.3	7.6e-84
WP_057953013.1|2319128_2320607_-|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	27.6	4.2e-45
WP_057953014.1|2320750_2321611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057954868.1|2321632_2322655_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_081421491.1|2322731_2323955_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	34.5	2.7e-29
WP_057953015.1|2324103_2324568_+	ribosome assembly cofactor RimP	NA	NA	NA	NA	NA
WP_057953016.1|2324581_2325817_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_057953017.1|2325875_2328785_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	44.7	2.7e-19
WP_057953018.1|2328859_2329909_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_057953019.1|2329905_2330634_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_057953020.1|2330636_2331422_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_057953021.1|2331434_2331689_-	DUF3098 domain-containing protein	NA	NA	NA	NA	NA
WP_057954870.1|2331700_2332579_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_057953022.1|2332787_2333675_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	25.2	1.8e-11
WP_057953023.1|2333759_2334476_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_169792605.1|2334633_2336088_+	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_057951529.1|2337199_2337520_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP013118	Salinivirga cyanobacteriivorans strain L21-Spi-D4 chromosome, complete genome	4812386	4402306	4441846	4812386	integrase,transposase	unidentified_phage(25.0%)	38	4411787:4411846	4442604:4444655
WP_081421488.1|4402306_4403863_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_057952979.1|4403870_4404629_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	35.2	9.3e-33
WP_057954934.1|4405746_4406049_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_057954523.1|4406104_4406395_-	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_081421633.1|4407222_4408578_+	group II intron reverse transcriptase/maturase	NA	H7BV92	unidentified_phage	26.0	1.2e-09
WP_057954524.1|4408680_4409349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057954525.1|4410361_4411114_-	transporter	NA	NA	NA	NA	NA
WP_057954526.1|4411300_4411600_-	NirD/YgiW/YdeI family stress tolerance protein	NA	NA	NA	NA	NA
4411787:4411846	attL	TGTGTGTGCCCTGCATGAGCATGCAGCACACACTCGACCGAAAGCAATTGAAAAAGCCGA	NA	NA	NA	NA
WP_081421634.1|4412389_4413745_+	group II intron reverse transcriptase/maturase	NA	H7BV92	unidentified_phage	26.0	1.2e-09
WP_057954527.1|4414093_4416310_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_057954529.1|4416726_4417266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057954530.1|4417252_4417786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057951785.1|4417804_4419112_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_057954531.1|4419312_4421619_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_081421635.1|4421596_4421950_-	DUF2023 family protein	NA	NA	NA	NA	NA
WP_057954532.1|4422000_4422498_-	flavodoxin	NA	NA	NA	NA	NA
WP_057954533.1|4422503_4422842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057954534.1|4422853_4423603_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_057954535.1|4423602_4425342_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	1.3e-37
WP_057954536.1|4425334_4427110_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	22.8	9.5e-28
WP_057954537.1|4427125_4427824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057954538.1|4427998_4428733_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_057954539.1|4428736_4429711_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.5	1.5e-27
WP_057954540.1|4429700_4429997_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_057954541.1|4430097_4430682_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_057954542.1|4430674_4431385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057954543.1|4432598_4432937_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_057954544.1|4432926_4433229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057954545.1|4433486_4433855_-	hypothetical protein	NA	A0A222YXG1	Escherichia_phage	52.1	7.7e-25
WP_057954546.1|4433866_4434163_-	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	38.6	2.1e-12
WP_057954548.1|4434722_4435922_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_057954549.1|4435973_4436525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057954550.1|4436769_4437555_-	Fic family protein	NA	NA	NA	NA	NA
WP_057954551.1|4437808_4438120_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_081421587.1|4438126_4438354_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_095532289.1|4438426_4439389_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_057954807.1|4439520_4439832_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_057951785.1|4440538_4441846_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
4442604:4444655	attR	TGTGTGTGCCCTGCATGAGCATGCAGCACACACTCGACCGAAAGCAATTGAAAAAGCCGAAATATGCAAATAAATTTTCAATATGCCATGGTCGAGTGGTGTTATTTTAGTCCAAAGGGTGTAAATCCTTTATCGGCAAGCTGATAAATAAGCATGAGCCGATTAGTAAGACGCAAGGTGGTTCAGAGCGATCTGAGCACTGAAGGAAGCGAAACTGCAAAGACCTGTACTGACGCACAGGAAGTGCATACAGAGGCAGGAAAAGGAGGGTTAGCAATCACAGCTTTGCAAAGCCTGAAATCAGCATTCTTTTCCTGTAGATGCAACAGGAATAGGTCGAAGGACGATGTTCTTACCAGGGGAGGTCTTGGACTAGATTCGGTATTTCTATACACCAAGAAGTCAGCCGAAGCCGTAGTAACCAGTGGTAACGAGCCAAACCCTTAATGATAGACAGGTAAGTTTGGAGGCCTCACAAGCCGGCGAAGGGCTGAACTTTAAATCGTTGCAAATTCGCGTAGGAGGTCTATGCACTGCAAGGTGAATACCAGCCGCGGGAAAGCGTAACAGGAAACAGAAAAGGAAATGGAAATCAAAGAAGAATTGATCGACAAGATTTTGCAACCGGCCAACTTAACGATGGCTTGTAAAGAGGTTGTTCGCAACAAAGGCGCTGGCGGTGTCGACGGCATGAAGGTGAGCGAACTTGAAGCCCACCTGCATGAACACCGAACCACCCTGACCGAGCAAATAAGGAAAGGGAACTACCACGCTCAACCGATCAGGGGCAAAGAGATACCCAAGGGAGGAGGTAAAATGCGCCTTCTGGGTATCCCTACCGCAGTAGACCGGACGCTACAACAGGCAGTTCTACGTGTGGTAATGTTGCGCTACGAACAGGAATTTTCAAACTATAGTTATGGGTTTCGTCCGGAACGGAACACGCATCAGGCCGTAGGAAAATCATTGCGCTACATCAATTCAGGCTACCAACACATTGTTGAAATCGATCTCAAACAGTTTTTCGACAATGTCGATCATGTGCTGCTTTTACAATTGCTCTACCGGAAGGTTAAGTGTAAAGCCACCATGAGTCTTATCAGGCGTTGGTTGAGAGCACCACTCGAAAAAGATGGTAAACTCATAAAACGCAGGAAAGGAGTACCGCAAGGCAGTCCGATTAGCCCGTTACTGTCCAACATCATCTTACATGAGTTAGATACAGAAATGGAGCGTCTAGGGCTAAGATTTGTCCGCTATGCCGATGATTTTAGCATTTACTGCAAAACAAAATCAGAAGCAAGGAGAGCAGGCAATCAGGTTTACCTTTACCTGAGGGATAAGTTAAAACTTCCGATTAACCGGGAGAAAAGCGGCATCCGACGGCCTACACAATTCCAGATACTGGGATTTGGATTTGCCCCGGTCTACCAAAAAGGAGTAAAGGGCAAATACCAACTAGTTGTGACCCGGAAGAGATGGAAAGCGTTTAAAGCCAAGCTGAAAGATATAACCCGGAAGACCAAACCAATGAATTTTGATGAGCGTATTGCAAAGCTGAAAGAAATCCAACGAGGGTGGCTCAACGCTTTTAAATACGCCAATATCAAAGTGAAATTGGAGGAATTAGACGGATGGCTCCGTAACCGCTTACGTTACTGCATCTGGCATCACTGGAAAAAACCTGAAAAGAAAAGGCGGAGCCTTCTCCGATTGGGCGTCGATCCAGACCATGCTTATGCATGGAGCCGTACCAGGATGGGAGGTTGGGCAGTCGCTCAAAGCCCAATATTGGGCACCACCATCACCAAAACCCGTCTAAAGAAACGCGGTTATGTCTCTTTAACAGAAATGTTTAAAACGATCTCCAAAACTTCGGGTATCTACACGCTGTTTAGCTTCGCTGAACTCGTCCTTCGTCCTCGGTTCCCATGGTTTAGAGAACCGCCGTATACGTGATCCGTACGTACGGTGGTACTTCGACAGGCTCAGCAGAACTGTGAGAGGTGCTCCGGTGGGCTGTTTTAGCTCACCGGCCATCTACTCGATTGT	NA	NA	NA	NA
>prophage 11
NZ_CP013118	Salinivirga cyanobacteriivorans strain L21-Spi-D4 chromosome, complete genome	4812386	4445544	4490834	4812386	transposase	Escherichia_phage(80.0%)	35	NA	NA
WP_057954554.1|4445544_4446930_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_057954555.1|4447410_4447971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057954556.1|4448131_4448962_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	E9P639	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	29.1	1.6e-22
WP_057951332.1|4449054_4450254_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_057954557.1|4450615_4450921_-	HigA family addiction module antidote protein	NA	A0A2P1MXE5	Escherichia_phage	32.6	1.9e-08
WP_081421588.1|4450932_4451142_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A222YWE2	Escherichia_phage	41.9	4.1e-07
WP_057952155.1|4451211_4452771_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_057951688.1|4452774_4453524_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	33.2	1.4e-25
WP_057954558.1|4454027_4454819_+	PKD domain-containing protein	NA	NA	NA	NA	NA
WP_057951470.1|4455323_4456490_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_057954560.1|4457229_4458816_-	M81 family metallopeptidase	NA	NA	NA	NA	NA
WP_057951785.1|4459095_4460403_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_057954561.1|4460677_4461271_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_057954562.1|4461787_4462546_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	33.6	1.2e-32
WP_057954563.1|4462548_4463352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057954564.1|4463373_4464114_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_057954565.1|4464910_4465276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057954566.1|4465431_4469250_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_057954567.1|4469284_4470514_+	TolC family protein	NA	NA	NA	NA	NA
WP_057954568.1|4470674_4472516_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_057954569.1|4472542_4472881_+	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_057954570.1|4472969_4473188_+	SHOCT domain-containing protein	NA	NA	NA	NA	NA
WP_057954571.1|4473314_4476248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057954572.1|4476865_4477777_+	CHAD domain-containing protein	NA	NA	NA	NA	NA
WP_057954573.1|4477788_4478526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057954574.1|4478631_4478988_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_057954575.1|4479204_4481832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057954576.1|4481795_4482410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157754697.1|4482607_4484341_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_057954578.1|4484439_4485765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057954579.1|4485890_4486403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057954580.1|4486426_4487407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057954581.1|4487568_4489158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057954582.1|4489283_4489556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057954155.1|4489634_4490834_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP013118	Salinivirga cyanobacteriivorans strain L21-Spi-D4 chromosome, complete genome	4812386	4540643	4579239	4812386	tRNA,integrase,transposase	IC4_retrovirus(25.0%)	30	4554690:4554749	4573863:4574369
WP_057951332.1|4540643_4541843_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_057954615.1|4541914_4543861_-	AAA family ATPase	NA	Q67624	IC4_retrovirus	25.4	2.1e-12
WP_057954616.1|4544100_4545561_+	sodium:solute symporter	NA	NA	NA	NA	NA
WP_057954617.1|4545608_4547546_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	37.7	4.1e-125
WP_057954618.1|4547552_4547837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057954619.1|4547849_4548896_-	nucleoid-associated protein	NA	NA	NA	NA	NA
WP_169792624.1|4549451_4551980_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_057954622.1|4552214_4552586_+	STAS/SEC14 domain-containing protein	NA	NA	NA	NA	NA
WP_057954623.1|4552659_4553373_+	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_157754716.1|4553726_4554824_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
4554690:4554749	attL	TTTTTCTGTTGTACTGGTGGGTTTTCTGCCTGGCCGTTTGCCAAGAGATTTATAATAATA	NA	NA	NA	NA
WP_057954807.1|4554820_4555132_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_057954626.1|4555938_4556973_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_057954627.1|4556977_4557751_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_057954628.1|4557764_4558334_+	alpha-ribazole phosphatase	NA	NA	NA	NA	NA
WP_057954629.1|4558957_4560613_+	putative transporter	NA	NA	NA	NA	NA
WP_057954630.1|4560615_4562157_+	acyl-CoA carboxylase subunit beta	NA	NA	NA	NA	NA
WP_057954631.1|4562173_4563658_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_057954632.1|4563667_4564201_+	biotin/lipoyl-binding protein	NA	NA	NA	NA	NA
WP_057954633.1|4564743_4566909_+	ribonucleoside triphosphate reductase	NA	D9ZNH0	Clostridium_phage	45.9	5.2e-153
WP_081421592.1|4566911_4567658_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	NA	NA	NA	NA
WP_057954634.1|4567978_4569223_+	T9SS type A sorting domain-containing protein	NA	NA	NA	NA	NA
WP_057954635.1|4569427_4571818_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	30.6	1.5e-07
WP_057954636.1|4571824_4572481_-	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_057954637.1|4572650_4572923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095532289.1|4572899_4573862_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_057954807.1|4573993_4574305_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_057954638.1|4574528_4575674_-	ATP-binding protein	NA	NA	NA	NA	NA
4573863:4574369	attR	TTTTTCTGTTGTACTGGTGGGTTTTCTGCCTGGCCGTTTGCCAAGAGATTTATAATAATATTGATGCTTGGTAACTCCGGCAATGGAAAGAGCAATGTCTCTGCGAAGTCCAAACCCAATATATTTACAAACTATTTCTTTTTTCTCGCCCAGGCATACTTCTTTTTTAGCATATCATCTTTGAGCCGCCCTTCAAGTTCTTTTTCGGCTAAAAGCTTTTTCAGCGTTTCGTTTTCTTTTTCTAAACGCTTAATCTCTTTTAACTGAGCAGGGGTCATCCCATGGCGAAAGCCAGCTTCTCCCATGGTTTCGAATTTTTTCTTCCAACCATAATATGTGGCCGGATAAATTCCGTGTTTCTCAAGGGTTACGTTAACTCCTTGTTCTGTAGCTTCTTTTATAATCTGAAGCTTTTCCTCTTTGGTGAATTTTCTTTTTTTCATGTCTGTGTGCATAATTACTAATTTTTATTGATAATTATGTCAGACTTATTCGGGGGCTAATTCA	NA	NA	NA	NA
WP_057954639.1|4576414_4577305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057954640.1|4577331_4577853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057954641.1|4578039_4579239_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP013118	Salinivirga cyanobacteriivorans strain L21-Spi-D4 chromosome, complete genome	4812386	4670831	4731303	4812386	tRNA,transposase	Acanthocystis_turfacea_Chlorella_virus(33.33%)	53	NA	NA
WP_057952156.1|4670831_4671998_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_057954697.1|4672659_4673334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057954698.1|4673484_4676625_-	beta-phosphoglucomutase family hydrolase	NA	M1H9H9	Acanthocystis_turfacea_Chlorella_virus	26.2	3.7e-06
WP_057954699.1|4676655_4677858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057954700.1|4677985_4679023_-	T9SS type A sorting domain-containing protein	NA	NA	NA	NA	NA
WP_057954942.1|4679104_4679668_-	HupE/UreJ family protein	NA	NA	NA	NA	NA
WP_057954701.1|4679717_4680182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057954702.1|4680171_4682748_+	gliding motility-associated C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_057954703.1|4682758_4683949_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_057954704.1|4684079_4684754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157754705.1|4685943_4686117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057954489.1|4686186_4687677_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_057954706.1|4687679_4688501_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_057954707.1|4688916_4689606_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_057954708.1|4689605_4690118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057954709.1|4690313_4691972_-	ATP-binding protein	NA	A0A1V0SHU6	Klosneuvirus	30.1	6.0e-08
WP_057951529.1|4692684_4693005_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_057954710.1|4694754_4695945_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_057951529.1|4697316_4697637_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_057954711.1|4697664_4698930_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_057954712.1|4698926_4699541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057954713.1|4699530_4699929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057954714.1|4700077_4700977_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_057954715.1|4701735_4702140_-	hemerythrin family protein	NA	NA	NA	NA	NA
WP_057954716.1|4702152_4703211_-	DUF2027 domain-containing protein	NA	NA	NA	NA	NA
WP_057954943.1|4703427_4704624_+|tRNA	S-adenosylmethionine:tRNA ribosyltransferase-isomerase	tRNA	NA	NA	NA	NA
WP_057954717.1|4704780_4707144_+	cache domain-containing protein	NA	NA	NA	NA	NA
WP_057954718.1|4707159_4707873_-	DUF5020 family protein	NA	NA	NA	NA	NA
WP_057954719.1|4708098_4708602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057954720.1|4708661_4709093_-	OsmC family protein	NA	NA	NA	NA	NA
WP_057954721.1|4709260_4709986_-	DUF4405 domain-containing protein	NA	NA	NA	NA	NA
WP_057954722.1|4709954_4710860_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_057954723.1|4710861_4711731_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_057954724.1|4711766_4712630_-	DUF89 family protein	NA	NA	NA	NA	NA
WP_057954725.1|4712775_4712997_-	DUF5320 domain-containing protein	NA	NA	NA	NA	NA
WP_057954726.1|4713013_4713328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169792627.1|4713434_4713887_-	DUF5606 domain-containg protein	NA	NA	NA	NA	NA
WP_057954728.1|4713973_4714693_-	TerB family tellurite resistance protein	NA	E3T4P7	Cafeteria_roenbergensis_virus	46.4	4.1e-06
WP_057954729.1|4714685_4715276_-	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_057954730.1|4715285_4716302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057954731.1|4716459_4716774_-	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_057954732.1|4716784_4717252_-	DUF1573 domain-containing protein	NA	NA	NA	NA	NA
WP_081421602.1|4717264_4718224_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_057954734.1|4718632_4719019_+	PUR family DNA/RNA-binding protein	NA	NA	NA	NA	NA
WP_057954735.1|4719218_4720526_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_057954736.1|4720684_4721767_-	[citrate (pro-3S)-lyase] ligase	NA	NA	NA	NA	NA
WP_057954737.1|4721756_4723145_-	citrate lyase holo-[acyl-carrier protein] synthase	NA	NA	NA	NA	NA
WP_057954738.1|4723157_4724714_-	citrate lyase subunit alpha	NA	NA	NA	NA	NA
WP_057954944.1|4724720_4725599_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_057954739.1|4725630_4725921_-	citrate lyase acyl carrier protein	NA	NA	NA	NA	NA
WP_057954740.1|4726215_4727313_-	glutaminyl-peptide cyclotransferase	NA	NA	NA	NA	NA
WP_057954741.1|4727460_4729848_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_057951785.1|4729995_4731303_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
