The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013112	Escherichia coli strain YD786 chromosome, complete genome	4863501	287704	312338	4863501	lysis,integrase	Enterobacteria_phage(46.88%)	40	280939:280953	310587:310601
280939:280953	attL	AAATTAATGAAAAAA	NA	NA	NA	NA
WP_000533646.1|287704_288775_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	99.7	1.9e-201
WP_001303849.1|288752_288971_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545745.1|289010_289178_-	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.9e-27
WP_000120065.1|289420_290023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763365.1|290233_290455_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	97.3	1.4e-34
WP_000188870.1|290553_290769_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
WP_023148020.1|290845_291037_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.8e-26
WP_072126246.1|291009_291192_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	2.2e-28
WP_001372450.1|291188_291869_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	98.7	3.0e-131
WP_000100847.1|291865_292651_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995439.1|292656_292953_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000233576.1|293028_293235_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000210934.1|293743_294571_-	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
WP_000389051.1|294567_295317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000858975.1|295439_296129_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_001067458.1|296233_296464_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_001182899.1|296533_297073_+	toxin YdaT domain-containing protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.0e-61
WP_077249941.1|297069_298089_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.4	1.7e-109
WP_001372464.1|298085_298787_+	replication P family protein	NA	K7P6G2	Enterobacteria_phage	99.6	3.8e-129
WP_000145917.1|298783_299077_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000720581.1|299561_300122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000825400.1|300118_300571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072157016.1|300663_300765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001372486.1|300761_301217_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.2	5.9e-59
WP_000224914.1|301216_301387_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_001372487.1|301379_301670_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	91.7	4.8e-46
WP_001372483.1|301666_302029_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	97.4	1.5e-60
WP_000971068.1|302025_302166_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	5.5e-08
WP_001204777.1|302251_302629_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.2	7.3e-55
WP_000780581.1|302784_303309_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	1.1e-48
WP_000592543.1|303501_304461_+	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_000839582.1|305730_305946_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	1.2e-33
WP_001372488.1|305945_306443_+	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	97.0	1.6e-89
WP_000092273.1|306439_306907_+|lysis	lysis protein	lysis	A0A2D1GLQ7	Escherichia_phage	96.8	1.6e-75
WP_001139678.1|306894_307047_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	3.1e-20
WP_000079508.1|307398_307809_-	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_000105084.1|307865_308099_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	94.4	7.3e-21
WP_001372490.1|308487_309048_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.8	4.9e-87
WP_000239881.1|309938_310607_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
310587:310601	attR	TTTTTTCATTAATTT	NA	NA	NA	NA
WP_001753290.1|311006_312338_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	1.4e-20
>prophage 2
NZ_CP013112	Escherichia coli strain YD786 chromosome, complete genome	4863501	396529	405299	4863501	integrase	Salmonella_phage(90.0%)	12	396475:396488	405617:405630
396475:396488	attL	AAAACAATAAGTTA	NA	NA	NA	NA
WP_001372563.1|396529_397582_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.4e-106
WP_001678408.1|397673_398618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001680871.1|398629_399508_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.4	1.7e-30
WP_000188448.1|399653_399875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460892.1|399907_400417_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	1.3e-86
WP_000956192.1|400424_400721_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	88.5	1.9e-21
WP_000996717.1|400838_401180_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
WP_001244224.1|401247_401481_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	1.9e-32
WP_000752610.1|401480_401708_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	7.8e-36
WP_001544405.1|401704_402562_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.8	9.5e-159
WP_001376443.1|402558_404952_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	93.7	0.0e+00
WP_001376441.1|405110_405299_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	95.2	2.0e-24
405617:405630	attR	TAACTTATTGTTTT	NA	NA	NA	NA
>prophage 3
NZ_CP013112	Escherichia coli strain YD786 chromosome, complete genome	4863501	619753	646203	4863501	transposase,integrase	Acinetobacter_phage(25.0%)	20	609839:609855	632253:632269
609839:609855	attL	GCCATATCCGGCTGGCG	NA	NA	NA	NA
WP_085947771.1|619753_620916_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000627409.1|621018_621510_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_000611856.1|621506_622493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000279862.1|623040_624249_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.2	6.5e-44
WP_000164164.1|624472_626038_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_001349431.1|626053_626302_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001242278.1|626402_628226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000282094.1|629435_629999_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_000609175.1|631022_631388_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	93.8	2.0e-57
WP_012311606.1|631743_633363_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
632253:632269	attR	GCCATATCCGGCTGGCG	NA	NA	NA	NA
WP_012311662.1|633388_633541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000876712.1|634998_635766_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000433876.1|635765_636506_+	O-antigen export ABC transporter ATP-binding protein RfbB	NA	A0A2K9L3Z8	Tupanvirus	27.2	3.5e-08
WP_057915970.1|636520_638413_+	DUF4422 domain-containing protein	NA	NA	NA	NA	NA
WP_000828112.1|638431_639586_+	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	41.6	7.7e-79
WP_000683047.1|639582_640473_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_160379547.1|640473_641619_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_000654812.1|642902_643871_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.7	2.1e-186
WP_114141182.1|643867_644984_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.4e-47
WP_162842843.1|644990_646203_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	97.6	3.9e-166
>prophage 4
NZ_CP013112	Escherichia coli strain YD786 chromosome, complete genome	4863501	763411	774189	4863501	integrase	Enterobacteria_phage(40.0%)	11	764686:764709	776194:776217
WP_000444487.1|763411_764662_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
764686:764709	attL	AACGGGCGTGTTATACGCCCGTTG	NA	NA	NA	NA
WP_000741339.1|764775_765918_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21929	Phage_21	99.7	8.1e-206
WP_000088653.1|765907_766144_-	excisionase	NA	NA	NA	NA	NA
WP_000488406.1|766283_766523_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	94.9	3.9e-38
WP_001678640.1|766570_766789_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	94.4	3.2e-34
WP_001678641.1|766942_768007_-	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	64.8	1.7e-133
WP_000149533.1|768003_768162_-	DUF1317 family protein	NA	M1FJ61	Enterobacteria_phage	88.5	6.4e-21
WP_001372461.1|768158_768839_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	98.7	5.1e-131
WP_072163463.1|768835_769147_-	recombinase	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	2.4e-43
WP_001753331.1|769329_769869_+	toxin YdaT domain-containing protein	NA	M9NZI6	Enterobacteria_phage	65.6	7.5e-61
WP_000379042.1|772233_774189_+	AAA family ATPase	NA	K4I1H4	Acidithiobacillus_phage	28.6	7.5e-26
776194:776217	attR	CAACGGGCGTATAACACGCCCGTT	NA	NA	NA	NA
>prophage 5
NZ_CP013112	Escherichia coli strain YD786 chromosome, complete genome	4863501	1177903	1204097	4863501	lysis,integrase	Escherichia_phage(23.53%)	28	1179241:1179255	1203019:1203033
WP_171819265.1|1177903_1179919_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	96.6	0.0e+00
1179241:1179255	attL	CAATCCGCGACGGCG	NA	NA	NA	NA
WP_000762889.1|1180811_1181633_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	59.0	2.7e-78
WP_000904112.1|1181629_1182004_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	8.4e-35
WP_001373319.1|1182016_1183066_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	4.2e-108
WP_023147795.1|1183067_1183346_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	7.4e-12
WP_000980999.1|1183412_1183664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012578894.1|1183879_1184035_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	2.5e-17
WP_023147794.1|1184763_1185744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023147793.1|1186103_1186706_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E036	Clostridioides_phage	31.2	3.7e-08
WP_001678529.1|1187023_1188373_+	hypothetical protein	NA	A0A1W6JNS5	Morganella_phage	98.0	5.7e-259
WP_001678528.1|1188920_1189865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032181058.1|1189994_1190417_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	84.9	5.9e-61
WP_000054501.1|1190457_1191423_-	hypothetical protein	NA	U5P0A0	Shigella_phage	63.9	9.7e-59
WP_072163420.1|1191403_1191646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|1191729_1191918_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083281.1|1191914_1192106_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_001372999.1|1192199_1194671_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	59.8	6.1e-57
WP_000005552.1|1194743_1194995_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000877001.1|1195029_1196310_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	6.6e-156
WP_001360138.1|1196329_1196440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836058.1|1196497_1197517_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001295394.1|1197528_1198743_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|1198948_1199275_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705211.1|1199409_1199751_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|1199785_1200346_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|1200348_1201059_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001307224.1|1201166_1201472_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041556.1|1201670_1204097_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	7.7e-214
1203019:1203033	attR	CAATCCGCGACGGCG	NA	NA	NA	NA
>prophage 6
NZ_CP013112	Escherichia coli strain YD786 chromosome, complete genome	4863501	1592021	1669257	4863501	transposase,integrase	Acinetobacter_phage(23.08%)	49	1591763:1591822	1660691:1660771
1591763:1591822	attL	CGATTCCTCTGTAGTTCAGTCGGTAGAACGGCGGACTGTTAATCCGTATGTCACTGGTTC	NA	NA	NA	NA
WP_032181268.1|1592021_1593296_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	39.9	9.7e-75
WP_000042269.1|1593366_1593618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_170931526.1|1593984_1594890_+	hypothetical protein	NA	S5VKI3	Leptospira_phage	31.7	4.0e-30
WP_032181087.1|1594879_1595734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032181089.1|1595745_1596090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032181091.1|1596204_1597668_-	shufflon system plasmid conjugative transfer pilus tip adhesin PilV	NA	NA	NA	NA	NA
WP_032181092.1|1597720_1598278_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_032181094.1|1598675_1598981_-	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_032284006.1|1601344_1602664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085947598.1|1603606_1604768_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_085947598.1|1606106_1607269_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_057915993.1|1608832_1609219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001524918.1|1609302_1609572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032181100.1|1610924_1611662_+	replication/maintenance protein RepL	NA	M1Q742	Cellulophaga_phage	39.6	8.2e-26
WP_032181102.1|1611686_1612478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032181104.1|1612563_1613043_+	DUF4756 family protein	NA	NA	NA	NA	NA
WP_001287374.1|1613200_1613605_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_001773972.1|1613797_1614547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032181107.1|1614598_1615015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032181108.1|1615064_1615307_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_032181110.1|1615379_1615676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023155944.1|1616091_1616310_-	AlpA family transcriptional regulator	NA	B7SYF9	Stenotrophomonas_phage	52.8	3.0e-08
WP_001339197.1|1616801_1618010_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_032181116.1|1619214_1620477_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	38.8	2.6e-72
WP_032181117.1|1620670_1621975_-	yersiniabactin biosynthesis salicylate synthase YbtS	NA	NA	NA	NA	NA
WP_032181119.1|1622002_1623283_-	yersiniabactin-associated zinc MFS transporter YbtX	NA	NA	NA	NA	NA
WP_032181121.1|1623275_1625078_-	yersiniabactin ABC transporter ATP-binding/permease protein YbtQ	NA	W8CYL7	Bacillus_phage	26.8	4.6e-22
WP_032181124.1|1625064_1626777_-	yersiniabactin ABC transporter ATP-binding/permease protein YbtP	NA	W8CYL7	Bacillus_phage	27.0	1.0e-31
WP_000140405.1|1627033_1627993_+	yersiniabactin transcriptional regulator YbtA	NA	NA	NA	NA	NA
WP_032181126.1|1628183_1634291_+	yersiniabactin non-ribosomal peptide synthetase HMWP2	NA	A0A2K9L3I8	Tupanvirus	27.3	4.0e-33
WP_032181129.1|1634378_1643870_+	yersiniabactin polyketide synthase HMWP1	NA	D0R7J2	Paenibacillus_phage	36.8	1.2e-49
WP_000982873.1|1643866_1644967_+	yersiniabactin biosynthesis oxidoreductase YbtU	NA	NA	NA	NA	NA
WP_000194281.1|1644963_1645767_+	yersiniabactin biosynthesis thioesterase YbtT	NA	NA	NA	NA	NA
WP_001088813.1|1645770_1647348_+	yersiniabactin biosynthesis salycil-AMP ligase YbtE	NA	NA	NA	NA	NA
WP_000784549.1|1647479_1649501_+	siderophore yersiniabactin receptor FyuA	NA	NA	NA	NA	NA
WP_000039786.1|1650151_1650901_+	inverse autotransporter beta domain-containing protein	NA	NA	NA	NA	NA
WP_046642113.1|1652542_1652992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000480495.1|1653119_1654172_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_000378563.1|1654486_1655803_+	shikimate transporter	NA	NA	NA	NA	NA
WP_001060232.1|1655904_1657359_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000532912.1|1657701_1658418_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_122657720.1|1659046_1660690_-	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_001011017.1|1660807_1661758_-	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
1660691:1660771	attR	CGATTCCTCTGTAGTTCAGTCGGTAGAACGGCGGACTGTTAATCCGTATGTCACTGGTTCGAGTCCAGTCAGAGGAGCCAA	NA	NA	NA	NA
WP_001011466.1|1661859_1662777_-	nitrogen assimilation transcriptional regulator NAC	NA	NA	NA	NA	NA
WP_000986331.1|1663233_1664169_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001193786.1|1664230_1665310_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001297350.1|1665321_1666065_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_000973159.1|1666061_1666607_-	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_085947598.1|1668094_1669257_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
>prophage 7
NZ_CP013112	Escherichia coli strain YD786 chromosome, complete genome	4863501	1817015	1826457	4863501		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292773.1|1817015_1818152_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
WP_001374182.1|1818148_1820149_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.3	0.0e+00
WP_001295429.1|1820273_1820735_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|1820775_1821246_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|1821292_1822012_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|1822008_1823694_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|1823915_1824647_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|1824706_1824814_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|1824794_1825526_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569361.1|1825530_1826457_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
>prophage 8
NZ_CP013112	Escherichia coli strain YD786 chromosome, complete genome	4863501	2438159	2451342	4863501		Escherichia_phage(50.0%)	12	NA	NA
WP_001272924.1|2438159_2440721_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
WP_001141340.1|2440826_2441483_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	8.0e-49
WP_001297141.1|2441533_2442301_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_000847985.1|2442496_2443405_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590392.1|2443401_2444664_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278994.1|2444660_2445299_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001136918.1|2445303_2446080_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_000104456.1|2446168_2447533_+	GntP family transporter	NA	NA	NA	NA	NA
WP_000081550.1|2447626_2448619_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272592.1|2448681_2449821_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|2449960_2450587_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001374723.1|2450580_2451342_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	2.0e-59
>prophage 9
NZ_CP013112	Escherichia coli strain YD786 chromosome, complete genome	4863501	2673629	2740491	4863501	tRNA,transposase,protease,integrase	Enterobacteria_phage(33.33%)	54	2670197:2670256	2729459:2730226
2670197:2670256	attL	GGTGATGCTGCCAACTTACTGATTTAGTGTATGATGGTGTTTTTGAGGTGCTCCAGTGGC	NA	NA	NA	NA
WP_001299420.1|2673629_2674388_+|protease	metalloprotease LoiP	protease	NA	NA	NA	NA
WP_000105566.1|2674593_2675514_-	agmatinase	NA	NA	NA	NA	NA
WP_000758917.1|2675649_2676381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295380.1|2676526_2678503_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_001297406.1|2678511_2678643_-	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_001303650.1|2678778_2678994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001062128.1|2679297_2680452_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
WP_001112301.1|2680887_2682282_+	galactose/proton symporter	NA	NA	NA	NA	NA
WP_000858396.1|2682358_2682856_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_000286500.1|2682950_2683658_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001222508.1|2683737_2684469_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000593273.1|2684481_2685432_+	glutathione synthase	NA	NA	NA	NA	NA
WP_001053178.1|2685540_2686104_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000017106.1|2686103_2686520_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_071885018.1|2686682_2687663_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000997795.1|2687680_2688385_+	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001094831.1|2688402_2688969_+	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_001277222.1|2688965_2689256_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174743.1|2689263_2689857_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_000239928.1|2689849_2690986_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_000745217.1|2691140_2692148_-	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000394125.1|2692264_2693311_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000984796.1|2693486_2694206_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_001107564.1|2694389_2694716_-	YggL family protein	NA	NA	NA	NA	NA
WP_000786911.1|2694715_2695435_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001295382.1|2695595_2696648_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000091700.1|2696675_2696951_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_000760323.1|2697015_2698095_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_001049791.1|2698296_2699553_+	nucleoside permease NupG	NA	NA	NA	NA	NA
WP_000839748.1|2699602_2701738_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_000234526.1|2702135_2702843_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_057916002.1|2703221_2704484_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	42.8	1.0e-79
WP_057916003.1|2706261_2707233_-|transposase	IS481-like element ISEc18 family transposase	transposase	NA	NA	NA	NA
WP_000548583.1|2707609_2708824_+	DUF4338 domain-containing protein	NA	NA	NA	NA	NA
WP_001765256.1|2708845_2710492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057916004.1|2710503_2712387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000455181.1|2712398_2713442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001519247.1|2713438_2718949_+	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	21.9	1.8e-48
WP_085973487.1|2719198_2720308_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	25.5	2.9e-06
WP_000481334.1|2720373_2721156_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_001519250.1|2721208_2722201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001519251.1|2722223_2722742_-	fimbrial protein	NA	NA	NA	NA	NA
WP_023566316.1|2722825_2723389_-	PixJ protein	NA	NA	NA	NA	NA
WP_001171049.1|2723425_2724157_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_057916005.1|2724225_2726736_-	fimbria/pilus outer membrane usher protein	NA	NA	NA	NA	NA
WP_001519255.1|2726856_2727444_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000920486.1|2727529_2728036_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_077634565.1|2728080_2728338_-	adhesin biosynthesis transcription regulatory family protein	NA	NA	NA	NA	NA
WP_001765251.1|2730751_2731999_-	two-component system response regulator PgtA	NA	NA	NA	NA	NA
2729459:2730226	attR	GCCACTGGAGCACCTCAAAAACACCATCATACACTAAATCAGTAAGTTGGCAGCATCACCTAAGCACGTTATGTATATAACTTACCCCAATTAATATTCAGCTTTTACGTTTGTGCCGCATAACCTGCTGAGTGATGAAGGCCTGATATTCTTCTATGGTGCTGAAGGAGTTACTGCCCCGCAGTATCAGTGCCTGACAGATACGCCTTTTCAGATGTCCGTGGGCACTTTCAACCGAACCATTTTCGTGGCCCCGACTGGTATTATCGTGTACGCCCTGCATTCCGTAGTACTGACAGAGAGCAGCATAGCGCTCAGTCAACTCGCAGCGTCCATCTTTTGCCTTGTTGTTTCCATGCCGCCCTCAGGCTGTCCGTTTTATGTTCTGCCGGCACTCCACCCAGTTGTCCGAGGGCTTCCTGCAAACCTTCAGCCAGGGCAGAGAAGATCTCACCACCCAGCACAACTCGCATCCAGCTCCAGTGGCTCCATTCCAGACGGAAGTTATACAACTTATGCGCCAACAAATTACCGGCGATGGTGACCACCACACCTTTCAGTTTGGTAAAATCCAACAGGCCTCGCAGACCGGGCTGATGCCACTGGCGGAACATGACCTCCTGCTCTGCACCAGACTGTAGCTTCCATTTGCGAACCCGCCGTTGCATTGTTCTTCGAAGGCTTTTGGGGTACTGACCGGGATATTTATCCTGTAGCATCTCCAGCAGAGTTGTTGGTGTCAGAGCAGGCCTCTCTTTCAACAGAGGA	NA	NA	NA	NA
WP_001519259.1|2731988_2733998_-	two-component system sensor histidine kinase PgtB	NA	NA	NA	NA	NA
WP_085973488.1|2733994_2735212_-	phosphoglycerate transport regulator PgtC	NA	NA	NA	NA	NA
WP_033546150.1|2735610_2736975_+	phosphoglycerate transporter PgtP	NA	NA	NA	NA	NA
WP_057916006.1|2738521_2739319_-	IS21-like element IS21 family helper ATPase IstB	NA	U5N3V8	Enterobacteria_phage	98.9	4.7e-144
WP_001519266.1|2739318_2740491_-|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	98.5	1.1e-226
>prophage 10
NZ_CP013112	Escherichia coli strain YD786 chromosome, complete genome	4863501	3953811	3996975	4863501	head,capsid,tail,plate,integrase,holin,protease,lysis,tRNA,terminase,portal	Shigella_phage(42.86%)	59	3970041:3970054	3997984:3997997
WP_000956557.1|3953811_3954345_+	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
WP_000654815.1|3954541_3954715_+	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	100.0	4.4e-23
WP_001093918.1|3954762_3955044_-	pyocin activator PrtN family protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
WP_001061339.1|3955080_3955653_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	97.9	6.7e-108
WP_016236813.1|3956334_3956526_-	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	4.7e-26
WP_057916021.1|3956527_3957124_-	ead/Ea22-like family protein	NA	K7P881	Enterobacteria_phage	79.2	8.4e-37
WP_000476211.1|3957120_3957360_-	hypothetical protein	NA	S5MQM0	Escherichia_phage	98.7	2.2e-36
WP_000156999.1|3957352_3957556_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	98.5	6.1e-32
WP_032209648.1|3957552_3958431_-	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2R2Z314	Escherichia_phage	93.5	1.5e-167
WP_057916022.1|3958421_3958958_-	5'-deoxynucleotidase	NA	Q8SBG0	Shigella_phage	98.9	4.8e-100
WP_000081287.1|3959086_3959911_-	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_057916023.1|3959976_3960339_-	hypothetical protein	NA	U5P4J6	Shigella_phage	99.2	7.3e-60
WP_001514782.1|3960939_3961215_-	hypothetical protein	NA	Q8SBF7	Shigella_phage	97.8	7.0e-47
WP_000981537.1|3961448_3962102_-	helix-turn-helix domain-containing protein	NA	K7PLZ5	Enterobacterial_phage	60.8	5.7e-71
WP_001231956.1|3962197_3962395_+	Cro/Cl family transcriptional regulator	NA	K7PHB1	Enterobacterial_phage	56.9	1.1e-14
WP_000514174.1|3962422_3963007_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	60.9	5.5e-57
WP_001250270.1|3963182_3963395_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	5.4e-15
WP_057916024.1|3963351_3964344_+	hypothetical protein	NA	U5P0A0	Shigella_phage	98.8	2.8e-93
WP_000066917.1|3964438_3965092_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_000210187.1|3965088_3965415_+	LexA family transcriptional regulator	NA	A5LH73	Enterobacteria_phage	100.0	1.6e-53
WP_021563283.1|3965411_3965801_+	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	98.4	6.0e-68
WP_001061378.1|3965820_3966630_+	KilA-N domain-containing protein	NA	Q8SBE6	Shigella_phage	98.5	8.2e-152
WP_064764475.1|3966637_3967627_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.8	2.8e-194
WP_057916026.1|3967640_3968393_+	antitermination protein	NA	Q8SBE4	Shigella_phage	98.4	2.9e-135
WP_001569330.1|3968543_3968801_+	hypothetical protein	NA	A0A1C9IHX4	Salmonella_phage	95.3	5.6e-38
WP_001283169.1|3968880_3969267_+|holin	phage holin family protein	holin	A0A192Y8P2	Salmonella_phage	100.0	7.0e-61
WP_000422366.1|3969253_3969535_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	45.2	9.7e-20
WP_001075795.1|3969534_3970149_+	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	98.0	8.2e-112
3970041:3970054	attL	CTACGGTGCCGATA	NA	NA	NA	NA
WP_000858463.1|3970145_3970607_+|lysis	lysis protein	lysis	K7P6Y5	Enterobacteria_phage	88.9	3.2e-68
WP_000877024.1|3970809_3971340_+	KilA-N domain-containing protein	NA	B8K1H1	Salmonella_phage	95.5	3.4e-90
WP_001135096.1|3971655_3972006_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	95.7	4.0e-63
WP_000929172.1|3972131_3972626_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B3B2F4	Salmonella_phage	99.4	8.6e-88
WP_122991537.1|3972859_3974356_+|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.6	9.7e-300
WP_000605606.1|3974367_3974550_+	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_000466255.1|3974549_3975791_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	2.0e-242
WP_023277702.1|3975768_3976419_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	99.5	9.5e-119
WP_000257514.1|3976433_3977639_+|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	98.8	7.7e-223
WP_000601360.1|3977688_3977889_+	hypothetical protein	NA	S5FNU1	Shigella_phage	97.0	3.8e-26
WP_000927711.1|3977891_3978215_+|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_001579916.1|3978211_3978622_+|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	94.1	6.7e-70
WP_000224836.1|3978596_3979103_+	hypothetical protein	NA	Q8SBH5	Shigella_phage	92.9	2.9e-83
WP_000779292.1|3979099_3979660_+	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	100.0	1.0e-105
WP_000497751.1|3979668_3979839_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_057916027.1|3979822_3981319_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	U5P0H3	Shigella_phage	98.2	8.3e-275
WP_000090998.1|3981318_3981675_+|tail	phage tail tube protein	tail	U5P076	Shigella_phage	100.0	5.3e-63
WP_000661054.1|3981674_3981944_+|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
WP_000807197.1|3982085_3983921_+|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	99.7	1.5e-307
WP_057916028.1|3983981_3985310_+	DNA circularization N-terminal domain-containing protein	NA	Q8SBG8	Shigella_phage	98.9	2.5e-246
WP_000999510.1|3985306_3986386_+|plate	baseplate protein	plate	U5P0H6	Shigella_phage	100.0	5.3e-207
WP_001259088.1|3986385_3986934_+|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	98.4	3.3e-96
WP_000424732.1|3986933_3987359_+	phage GP46 family protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_000785312.1|3987345_3988404_+|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	99.4	8.6e-202
WP_057916029.1|3988394_3988979_+	YmfQ family protein	NA	O22003	Shigella_phage	99.0	7.0e-113
WP_057916030.1|3988982_3989684_+|tail	tail fiber protein	tail	U5P0I1	Shigella_phage	94.4	2.4e-51
WP_057916031.1|3989683_3990286_+|tail	tail fiber assembly protein	tail	A0A0F7LDQ5	Escherichia_phage	88.0	2.3e-87
WP_025713551.1|3990930_3992874_-	glycosyl transferase	NA	NA	NA	NA	NA
WP_057916032.1|3992875_3993721_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_001514812.1|3994751_3995849_-|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.2	1.4e-210
WP_077870171.1|3995937_3996975_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
3997984:3997997	attR	CTACGGTGCCGATA	NA	NA	NA	NA
>prophage 11
NZ_CP013112	Escherichia coli strain YD786 chromosome, complete genome	4863501	4636623	4654906	4863501	tail,integrase	Shigella_phage(33.33%)	23	4640480:4640538	4662538:4662596
WP_057916035.1|4636623_4637679_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.6	2.2e-117
WP_001285288.1|4637966_4639070_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893260.1|4639081_4640335_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.0	1.7e-95
4640480:4640538	attL	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTTAAATCAATAA	NA	NA	NA	NA
WP_000051887.1|4640539_4641703_-|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_000206058.1|4641929_4642274_-	hypothetical protein	NA	U5P0J0	Shigella_phage	80.7	2.0e-30
WP_024176184.1|4642270_4643149_-	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2R2Z314	Escherichia_phage	92.4	5.3e-165
WP_001371719.1|4643139_4643676_-	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	98.3	2.0e-98
WP_000081269.1|4643803_4644628_-	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	6.0e-150
WP_000135680.1|4644693_4645056_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_001312635.1|4645549_4646047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000450738.1|4646277_4646904_-	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	2.5e-47
WP_000205494.1|4647001_4647202_+	cell division protein	NA	NA	NA	NA	NA
WP_000515846.1|4647239_4647797_+	protein YmfL	NA	S5FXP0	Shigella_phage	96.2	1.5e-96
WP_001250269.1|4647972_4648152_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_046642588.1|4648431_4649085_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	3.3e-127
WP_000210164.1|4649081_4649408_+	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	100.0	9.2e-54
WP_000767127.1|4649404_4649794_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	99.2	1.6e-68
WP_001061378.1|4649813_4650623_+	KilA-N domain-containing protein	NA	Q8SBE6	Shigella_phage	98.5	8.2e-152
WP_001542657.1|4650630_4651620_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.2	1.5e-192
WP_089503370.1|4651634_4652003_+	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	86.7	3.6e-54
WP_001542658.1|4652031_4653363_-	hypothetical protein	NA	R9TRQ8	Vibrio_phage	29.4	3.2e-20
WP_001355891.1|4653635_4653830_+	hypothetical protein	NA	Q8SBE3	Shigella_phage	100.0	1.8e-28
WP_174245757.1|4654369_4654906_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	86.0	1.8e-59
4662538:4662596	attR	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTTAAATCAATAA	NA	NA	NA	NA
