The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012930	Salmonella enterica subsp. enterica serovar Heidelberg strain N13-01290 chromosome, complete genome	4809628	371744	415340	4809628	portal,coat,protease,lysis,terminase,integrase	Enterobacteria_phage(44.44%)	64	375591:375636	414856:414901
WP_001043660.1|371744_372797_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	2.2e-112
WP_001285275.1|373079_374183_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_000893221.1|374194_375445_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	48.2	2.1e-98
375591:375636	attL	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCA	NA	NA	NA	NA
WP_000051900.1|375650_376814_-|integrase	site-specific integrase	integrase	A0A075B8E2	Enterobacteria_phage	99.7	2.4e-229
WP_000016640.1|377043_377679_-	hypothetical protein	NA	A0A075B8I7	Enterobacteria_phage	99.5	1.3e-120
WP_001277769.1|377779_377959_-	Eag protein	NA	A0A075B8F7	Enterobacteria_phage	98.3	1.6e-28
WP_000208013.1|378055_378742_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	53.2	4.3e-53
WP_000224223.1|378752_379016_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	2.0e-30
WP_001289978.1|379017_379503_-	ead/Ea22-like family protein	NA	A5VWB3	Enterobacteria_phage	86.1	1.3e-43
WP_000812182.1|379499_380126_-	hypothetical protein	NA	A5VWB1	Enterobacteria_phage	71.2	7.1e-71
WP_001682200.1|380122_380287_-	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	98.1	1.6e-22
WP_001111313.1|380297_380594_-	DUF2856 family protein	NA	Q76H42	Enterobacteria_phage	90.8	3.9e-43
WP_000031375.1|380924_381542_-	ERF family protein	NA	A0A0N7CFJ3	Salmonella_phage	100.0	3.3e-105
WP_001163402.1|381538_381682_-	hypothetical protein	NA	A0A075B8I9	Enterobacteria_phage	100.0	3.2e-19
WP_000158027.1|381671_381860_-	DUF5444 family protein	NA	A0A075B8F9	Enterobacteria_phage	100.0	1.4e-30
WP_000582314.1|381840_381999_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A075B8H4	Enterobacteria_phage	100.0	4.0e-23
WP_000776964.1|382084_382396_-	superinfection exclusion protein	NA	A0A075B8E5	Enterobacteria_phage	100.0	1.1e-48
WP_001737461.1|382543_382747_-	DUF551 domain-containing protein	NA	A0A0N7CAQ5	Salmonella_phage	100.0	1.7e-34
WP_000651935.1|382746_382983_-	hypothetical protein	NA	A0A075B8J0	Enterobacteria_phage	100.0	4.3e-37
WP_000213983.1|383019_383214_-	hypothetical protein	NA	A0A075B8G0	Enterobacteria_phage	100.0	2.5e-30
WP_001682202.1|383428_384007_+	superinfection exclusion protein B	NA	A0A075B8E6	Enterobacteria_phage	100.0	8.8e-92
WP_000216175.1|384027_384330_-	hypothetical protein	NA	B8K1E6	Salmonella_phage	98.0	1.1e-48
WP_001095984.1|384683_385334_-	LexA family transcriptional regulator	NA	B1B6L9	Salmonella_phage	100.0	5.4e-122
WP_000276884.1|385414_385600_+	hypothetical protein	NA	Q5G8T3	Enterobacteria_phage	100.0	5.4e-27
WP_000424167.1|385706_385985_+	transcriptional regulator	NA	Q5G8T2	Enterobacteria_phage	100.0	2.5e-44
WP_001125981.1|386019_386166_+	DUF2740 family protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
WP_000067075.1|386158_386974_+	replication protein	NA	A0A075B8J2	Enterobacteria_phage	100.0	9.4e-148
WP_001248406.1|386970_388347_+	DNA helicase	NA	A0A075B8G2	Enterobacteria_phage	100.0	3.3e-254
WP_000736921.1|388420_388858_+	recombination protein NinB	NA	A8CGE3	Salmonella_phage	100.0	1.3e-79
WP_000679702.1|388854_389028_+	hypothetical protein	NA	C6ZR56	Salmonella_phage	100.0	5.2e-32
WP_000113772.1|388994_389171_+	NinE family protein	NA	I6RSQ2	Salmonella_phage	100.0	4.6e-28
WP_001531428.1|389173_389506_+	DUF2591 domain-containing protein	NA	A0A075B8G3	Enterobacteria_phage	100.0	3.5e-61
WP_000950959.1|389498_389675_+	protein ninF	NA	I6S668	Salmonella_phage	100.0	2.5e-26
WP_001129733.1|389667_390279_+	recombination protein NinG	NA	A0A075B8E9	Enterobacteria_phage	100.0	1.3e-98
WP_000036317.1|390275_390500_+	hypothetical protein	NA	Q5G8R9	Enterobacteria_phage	100.0	2.2e-38
WP_000149925.1|390496_390700_+	protein ninH	NA	A0A075B8J4	Enterobacteria_phage	100.0	7.2e-33
WP_000219131.1|390680_390860_+	hypothetical protein	NA	A0A1U8QR34	Salmonella_phage	100.0	1.4e-24
WP_001235453.1|390856_391480_+	antitermination protein	NA	A0A075B8H9	Enterobacteria_phage	100.0	2.3e-114
WP_000286100.1|391918_392122_+	hypothetical protein	NA	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_000074137.1|392099_392597_+	lysozyme	NA	A0A1R3Y5W5	Salmonella_virus	97.0	6.0e-89
WP_001531485.1|392685_393123_+|lysis	lysis protein	lysis	O80289	Bacteriophage	99.3	9.1e-73
WP_001177703.1|393335_394022_+	Rha family transcriptional regulator	NA	A0A192Y918	Salmonella_phage	99.6	4.7e-124
WP_000807785.1|394324_394567_+	DUF2560 family protein	NA	A0A0M4R322	Salmonella_phage	100.0	7.5e-37
WP_001278047.1|394568_394748_+	hypothetical protein	NA	Q9AZ02	Salmonella_phage	91.5	3.0e-22
WP_000729925.1|394771_395260_+	hypothetical protein	NA	O80290	Bacteriophage	100.0	2.9e-88
WP_000417849.1|395237_396737_+|terminase	terminase	terminase	A0A192Y824	Salmonella_phage	99.8	1.4e-306
WP_000774656.1|396736_398914_+|portal	portal protein	portal	A0A2H4FNE2	Salmonella_phage	99.9	0.0e+00
WP_000433852.1|398927_399839_+	scaffold protein	NA	A0A192Y6T4	Salmonella_phage	100.0	4.9e-161
WP_001196938.1|399838_401131_+|coat	coat protein	coat	A0A192Y6V4	Salmonella_phage	100.0	3.2e-243
WP_000684729.1|401169_401379_+	hypothetical protein	NA	A0A192Y697	Salmonella_phage	100.0	1.3e-32
WP_001166098.1|401362_401863_+	packaged DNA stabilization protein p27	NA	I1TEJ0	Salmonella_phage	99.4	5.5e-90
WP_001122424.1|401822_403241_+	Packaged DNA stabilization protein gp10	NA	A0A075B8I2	Enterobacteria_phage	100.0	7.6e-278
WP_000774927.1|403244_403946_+	hypothetical protein	NA	A0A192Y6T9	Salmonella_phage	100.0	8.8e-78
WP_000627697.1|403945_404401_+	DUF2824 family protein	NA	A0A192Y6V9	Salmonella_phage	100.0	5.2e-87
WP_000964902.1|404403_405096_+	hypothetical protein	NA	G5DA80	Enterobacteria_phage	98.7	1.2e-108
WP_000246945.1|405105_406401_+	phage DNA ejection protein	NA	Q716G3	Shigella_phage	84.5	2.1e-181
WP_001029838.1|406400_408398_+	hypothetical protein	NA	Q716G2	Shigella_phage	94.9	0.0e+00
WP_000749288.1|408488_408974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000287064.1|409376_409631_-	Arc family DNA-binding protein	NA	A0A088CPT2	Enterobacteria_phage	63.3	4.4e-19
WP_000129930.1|409766_411770_+	endorhamnosidase	NA	A0A2H4FWI0	Salmonella_phage	99.9	0.0e+00
WP_000671495.1|411828_413286_-	hypothetical protein	NA	A0A192Y7W8	Salmonella_phage	100.0	4.5e-241
WP_000703640.1|413275_414208_-	glycosyltransferase family 2 protein	NA	A0A192Y8W7	Salmonella_phage	100.0	5.5e-176
WP_000915528.1|414204_414567_-	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	100.0	5.0e-61
WP_001683918.1|415064_415340_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	64.1	1.9e-23
414856:414901	attR	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCA	NA	NA	NA	NA
>prophage 2
NZ_CP012930	Salmonella enterica subsp. enterica serovar Heidelberg strain N13-01290 chromosome, complete genome	4809628	1019566	1027589	4809628	protease,transposase	Dickeya_phage(14.29%)	8	NA	NA
WP_001201751.1|1019566_1020685_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_000125890.1|1020681_1022628_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
WP_000447499.1|1022757_1022979_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|1023302_1023623_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934063.1|1023653_1025930_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000502119.1|1026120_1026579_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_001117984.1|1026852_1027050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001531374.1|1027211_1027589_-	hypothetical protein	NA	A0A077KET4	Ralstonia_phage	40.2	1.7e-19
>prophage 3
NZ_CP012930	Salmonella enterica subsp. enterica serovar Heidelberg strain N13-01290 chromosome, complete genome	4809628	1078198	1176157	4809628	tRNA,tail,portal,protease,transposase,lysis,terminase,integrase	Salmonella_phage(44.83%)	104	1081107:1081126	1152045:1152064
WP_001154025.1|1078198_1079002_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288828.1|1078994_1080317_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_000060025.1|1080297_1081002_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_000572753.1|1081001_1085468_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
1081107:1081126	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_000925883.1|1085812_1087633_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000357052.1|1087892_1088441_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_001109471.1|1088468_1089116_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_060556237.1|1089177_1090368_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_000977713.1|1090552_1091644_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
WP_000117870.1|1092250_1093651_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000762342.1|1093851_1094313_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000544849.1|1094629_1095844_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000893206.1|1096088_1097522_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000191413.1|1097602_1098805_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001262307.1|1098999_1100292_-|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	100.0	3.4e-253
WP_000065276.1|1100336_1100585_-	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001682304.1|1100625_1100865_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	98.7	3.3e-37
WP_000189634.1|1100870_1101740_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	86.3	7.2e-146
WP_000187054.1|1101736_1102417_-	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	97.8	3.3e-130
WP_000100830.1|1102413_1103199_-	phage recombination protein Bet	NA	A0A0M4RD39	Salmonella_phage	98.8	2.4e-148
WP_000995352.1|1103204_1103501_-	host-nuclease inhibitor protein Gam	NA	A0A0M5M5Z9	Salmonella_phage	100.0	1.1e-48
WP_000186242.1|1103591_1103792_-	cell division protein FtsZ	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
WP_000373338.1|1104079_1104286_+	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	67.6	1.6e-16
WP_000091280.1|1104312_1104747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000439725.1|1104748_1105174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001230956.1|1105216_1105612_-	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	72.5	3.5e-47
WP_000992434.1|1105716_1105953_+	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	73.1	9.0e-27
WP_015675517.1|1105918_1106293_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	1.9e-63
WP_000024046.1|1106384_1107290_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	99.7	9.1e-176
WP_000788826.1|1107286_1107988_+	hypothetical protein	NA	A0A0M3ULE2	Salmonella_phage	99.1	1.9e-128
WP_023602525.1|1108032_1108434_+	ParB/RepB/Spo0J family partition protein	NA	S4TTI6	Salmonella_phage	98.5	5.4e-72
WP_000215887.1|1108430_1108964_+	hypothetical protein	NA	A0A192Y7N1	Salmonella_phage	89.8	8.1e-92
WP_000224239.1|1108965_1109223_+	hypothetical protein	NA	A0A192Y5W0	Salmonella_phage	95.3	4.5e-40
WP_000208143.1|1109233_1109635_+	hypothetical protein	NA	I6R0R2	Salmonella_phage	82.0	1.2e-18
WP_000877758.1|1109742_1110387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217669.1|1110617_1110851_+	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_014343878.1|1110967_1111216_+	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_000929790.1|1111250_1111853_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
WP_001096547.1|1112061_1112673_+	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	99.5	4.2e-92
WP_001617856.1|1112669_1112816_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001047631.1|1112805_1113603_+	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
WP_000508329.1|1113769_1113988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000658038.1|1114268_1114457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001682303.1|1114659_1114962_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000301013.1|1114939_1115479_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	72.4	2.2e-76
WP_086010216.1|1115795_1116281_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	80.4	1.1e-58
WP_000371784.1|1116491_1117025_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_000989238.1|1116981_1119120_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	6.9e-291
WP_000196190.1|1119116_1119323_+	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_001009205.1|1119319_1120867_+|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	63.8	1.1e-176
WP_077906133.1|1120790_1122869_+|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.3	2.4e-264
WP_001107908.1|1122959_1123283_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_000774239.1|1123275_1123575_+	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_000453192.1|1123555_1124122_+|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	95.7	2.1e-13
WP_000196703.1|1124118_1124520_+|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	2.0e-42
WP_000132755.1|1124531_1125281_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000478858.1|1125326_1125725_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_010989009.1|1125721_1126051_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_065305406.1|1126130_1129118_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.0	2.5e-262
WP_000978295.1|1129114_1129447_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	2.6e-35
WP_000410972.1|1129545_1130070_+	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	35.3	1.8e-19
WP_000877926.1|1130159_1130693_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001152416.1|1130782_1131478_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.0e-89
WP_000606356.1|1131487_1132225_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	75.6	5.2e-113
WP_020867839.1|1132122_1132827_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	2.0e-66
WP_000033414.1|1132898_1136249_+	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	69.3	0.0e+00
WP_000178849.1|1136287_1136530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001532020.1|1136583_1138959_+|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	64.9	1.9e-87
WP_031618324.1|1139459_1139780_+	hypothetical protein	NA	A0A0M4QWS3	Salmonella_phage	79.2	4.9e-44
WP_000143158.1|1139769_1140351_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	87.4	1.8e-92
WP_000161705.1|1140547_1141270_-	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
WP_000388788.1|1141482_1141701_+	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	89.7	1.7e-24
WP_000343758.1|1141920_1143141_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_071531551.1|1143137_1143635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000193784.1|1144069_1146682_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000291723.1|1146889_1147900_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001220671.1|1148065_1148608_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224069.1|1148604_1149714_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001086485.1|1149812_1151921_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000053044.1|1151933_1153841_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1152045:1152064	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_052867540.1|1153855_1155109_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000433414.1|1155113_1156754_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000759136.1|1156750_1157314_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001537784.1|1157569_1157737_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|1157836_1158355_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000156454.1|1158423_1160184_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877172.1|1160369_1160822_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_001674965.1|1160893_1161946_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288732.1|1162302_1162812_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001202375.1|1163028_1163634_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000950880.1|1163620_1165774_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261222.1|1165792_1166239_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420505.1|1166362_1168417_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_000424187.1|1168452_1168911_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847716.1|1169005_1169668_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_001537782.1|1169841_1170255_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|1170299_1170617_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000140480.1|1170674_1171886_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000859416.1|1172100_1172649_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000548082.1|1172674_1173454_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000072884.1|1173502_1173784_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904446.1|1173780_1174110_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000374046.1|1174196_1174856_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_000938191.1|1175476_1176157_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
>prophage 4
NZ_CP012930	Salmonella enterica subsp. enterica serovar Heidelberg strain N13-01290 chromosome, complete genome	4809628	2074517	2085118	4809628		Morganella_phage(25.0%)	12	NA	NA
WP_001157304.1|2074517_2075948_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	7.8e-105
WP_000377037.1|2076021_2076717_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	1.6e-07
WP_000107434.1|2076796_2077108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001080662.1|2077758_2078955_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	5.1e-110
WP_024131109.1|2079212_2079401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|2079411_2079624_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_000457664.1|2080078_2081347_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	1.2e-226
WP_000394197.1|2081349_2081769_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000500831.1|2081895_2082057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000598921.1|2082537_2083335_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001683376.1|2083706_2083997_+	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	52.6	2.1e-09
WP_001219015.1|2084644_2085118_+	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
>prophage 5
NZ_CP012930	Salmonella enterica subsp. enterica serovar Heidelberg strain N13-01290 chromosome, complete genome	4809628	2171113	2181619	4809628		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126349.1|2171113_2172427_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565905.1|2172453_2173533_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000648784.1|2173537_2174311_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018226.1|2174307_2175300_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973708.1|2175305_2175857_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000857529.1|2175857_2176736_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_001023662.1|2176783_2177683_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000697840.1|2177682_2178768_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_000981469.1|2179144_2180038_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001111845.1|2180215_2181619_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	6.8e-21
>prophage 6
NZ_CP012930	Salmonella enterica subsp. enterica serovar Heidelberg strain N13-01290 chromosome, complete genome	4809628	2249895	2259066	4809628	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195330.1|2249895_2251929_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703137.1|2252169_2252628_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_001197951.1|2252799_2253330_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|2253386_2253854_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|2253900_2254620_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272850.1|2254616_2256302_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_001240417.1|2256524_2257256_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|2257315_2257423_+	protein YohO	NA	NA	NA	NA	NA
WP_000824857.1|2257403_2258135_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569165.1|2258118_2259066_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
>prophage 7
NZ_CP012930	Salmonella enterica subsp. enterica serovar Heidelberg strain N13-01290 chromosome, complete genome	4809628	2278473	2344860	4809628	holin,lysis,tail	Salmonella_phage(25.0%)	59	NA	NA
WP_000989295.1|2278473_2279169_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_000553526.1|2279322_2280207_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_000920081.1|2280383_2281103_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_000605187.1|2281099_2281345_+	DUF2542 family protein	NA	NA	NA	NA	NA
WP_001136394.1|2281549_2282791_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000956097.1|2282784_2284020_+	NAD-dependent dihydropyrimidine dehydrogenase subunit PreA	NA	NA	NA	NA	NA
WP_001275101.1|2284094_2285105_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_000535907.1|2285120_2286641_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.9	1.0e-09
WP_001036943.1|2286774_2287773_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_000628631.1|2288271_2289294_-	HTH-type transcriptional regulator GalS	NA	NA	NA	NA	NA
WP_001520237.1|2289443_2290586_-	DUF418 family protein	NA	NA	NA	NA	NA
WP_001139611.1|2290600_2291269_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	4.1e-56
WP_000425488.1|2291598_2292456_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000876817.1|2292444_2292834_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001531764.1|2292838_2294206_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_000022910.1|2294422_2295310_+	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_000023807.1|2295342_2296665_+	MFS transporter	NA	NA	NA	NA	NA
WP_000488244.1|2296708_2298700_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	37.9	6.7e-14
WP_000535000.1|2299045_2300515_-	lysine-specific permease	NA	NA	NA	NA	NA
WP_000548316.1|2300704_2301568_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000137966.1|2301688_2302738_+	YeiH family protein	NA	NA	NA	NA	NA
WP_000873906.1|2302816_2303674_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	28.5	1.3e-22
WP_000854395.1|2303738_2305427_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000091249.1|2305443_2306382_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_000487287.1|2306381_2307512_-	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_000551937.1|2307879_2309061_+	sugar efflux transporter SetB	NA	NA	NA	NA	NA
WP_001213897.1|2309124_2309790_-	membrane protein	NA	NA	NA	NA	NA
WP_001519564.1|2309791_2309914_-	membrane protein	NA	NA	NA	NA	NA
WP_001523448.1|2310301_2310556_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001136822.1|2310879_2311452_+	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_000169346.1|2311664_2312651_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_000178095.1|2312680_2313400_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_000241015.1|2313813_2314386_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	8.1e-13
WP_000957755.1|2314711_2316268_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000561742.1|2316374_2318180_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000501626.1|2318189_2319284_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_001137747.1|2319283_2320309_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000222013.1|2320310_2321900_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.1	7.2e-19
WP_001094639.1|2321903_2322248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213347.1|2322638_2323829_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	22.2	2.4e-19
WP_001234834.1|2323856_2324552_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578130.1|2324703_2326464_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	1.4e-100
WP_000494192.1|2326588_2326873_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000033443.1|2326981_2327602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000050806.1|2327629_2328637_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	4.5e-83
WP_001135904.1|2328816_2329044_+	YejL family protein	NA	NA	NA	NA	NA
WP_000256150.1|2329075_2330836_+	cardiolipin transport protein PbgA	NA	NA	NA	NA	NA
WP_000806401.1|2331116_2331620_-	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
WP_000884778.1|2331647_2331938_+	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000022213.1|2334161_2334605_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_001215679.1|2334982_2335510_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000554739.1|2335512_2336754_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001120499.1|2337346_2337676_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000894638.1|2337972_2339304_+	NTPase	NA	R9TRQ8	Vibrio_phage	28.5	4.6e-19
WP_010989045.1|2339332_2339701_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_001202279.1|2339715_2340705_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_001115840.1|2341033_2343400_-	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001113462.1|2343568_2343772_-|tail	tail protein	tail	NA	NA	NA	NA
WP_000624225.1|2344068_2344860_-|tail	tail protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
>prophage 8
NZ_CP012930	Salmonella enterica subsp. enterica serovar Heidelberg strain N13-01290 chromosome, complete genome	4809628	2742805	2835691	4809628	tRNA,tail,portal,holin,capsid,head,terminase,integrase	Cronobacter_phage(52.5%)	79	2744518:2744533	2841703:2841718
WP_000083343.1|2742805_2743543_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219174.1|2743673_2745008_+	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
2744518:2744533	attL	TGGCGCAGATCAAACG	NA	NA	NA	NA
WP_001526875.1|2745025_2745925_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000188414.1|2746027_2746615_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627811.1|2746676_2747060_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000179978.1|2747378_2748068_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000997368.1|2748183_2749221_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098732.1|2749424_2749844_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	40.6	1.2e-16
WP_000183642.1|2749916_2750597_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082639.1|2750650_2753311_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949286.1|2753425_2754781_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001264473.1|2754825_2755149_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000807809.1|2755145_2756447_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.4	6.9e-44
WP_000985653.1|2756550_2757006_-	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	50.0	3.0e-34
WP_001235094.1|2762886_2765460_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.6	9.0e-128
WP_000992639.1|2765589_2766321_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079130.1|2766317_2767298_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197660.1|2767429_2768167_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178449.1|2768438_2768777_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001156921.1|2768934_2769321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000777801.1|2769456_2770929_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_001747522.1|2772046_2773747_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.3	1.7e-223
WP_000200791.1|2773749_2774295_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	71.4	3.5e-58
WP_000267954.1|2774266_2774992_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.4	3.8e-68
WP_001215677.1|2774981_2775512_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	32.4	4.4e-13
WP_060556247.1|2775514_2777527_-|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	80.9	4.0e-147
WP_001001824.1|2777536_2778124_-	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.1	1.1e-89
WP_000136927.1|2778116_2779301_-	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.6	5.1e-179
WP_001002797.1|2779297_2779627_-	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_000811100.1|2779623_2781591_-|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.7	1.9e-271
WP_000411500.1|2781778_2782036_-	hypothetical protein	NA	A5X9I7	Aeromonas_virus	61.0	2.3e-20
WP_000376378.1|2782182_2782515_-	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.0	4.4e-35
WP_000175558.1|2782514_2782856_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_001154426.1|2782852_2783149_-|holin	holin	holin	C7BGD7	Burkholderia_phage	48.2	2.4e-16
WP_000166745.1|2783161_2783617_-	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	71.5	1.7e-58
WP_000220184.1|2783613_2784741_-	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	82.9	8.1e-174
WP_000606933.1|2784737_2785442_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	59.5	4.0e-70
WP_000080871.1|2785438_2785921_-|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	48.7	2.3e-37
WP_000491223.1|2785917_2786370_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	64.7	1.2e-48
WP_001177276.1|2786468_2787167_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	52.6	3.6e-63
WP_001176503.1|2787178_2788207_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	71.6	3.7e-133
WP_000273112.1|2788241_2789231_-|capsid	phage capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	52.3	2.5e-46
WP_001151938.1|2789288_2791073_+	hypothetical protein	NA	F1BUM5	Cronobacter_phage	69.7	1.8e-247
WP_000746494.1|2791069_2792089_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	68.5	1.3e-135
WP_000088096.1|2792088_2792412_+	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	73.1	1.3e-36
WP_000994501.1|2792439_2795097_-	hypothetical protein	NA	A0A077K8T2	Ralstonia_phage	47.5	1.2e-244
WP_000922120.1|2795135_2795354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000681787.1|2795356_2795926_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	46.3	2.6e-43
WP_000645096.1|2795935_2796268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000661531.1|2796293_2796632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000185337.1|2796729_2797035_+	helix-turn-helix transcriptional regulator	NA	A0A0M5M1I9	Salmonella_phage	47.5	1.6e-15
WP_000615542.1|2797074_2798094_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	58.2	1.4e-108
WP_010989056.1|2798257_2798305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200080.1|2798404_2799565_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000210995.1|2799525_2800434_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000225191.1|2800491_2801613_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168062.1|2801622_2802693_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_001212379.1|2803132_2803651_+	YfiR family protein	NA	NA	NA	NA	NA
WP_001030983.1|2803643_2804864_+	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	4.4e-08
WP_000065257.1|2805020_2805368_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000469807.1|2805408_2806176_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043266.1|2806220_2806769_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256453.1|2806787_2807036_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460052.1|2807349_2808711_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001537507.1|2808876_2809668_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_127172650.1|2809687_2810974_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001287931.1|2811094_2811700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001518875.1|2811734_2812325_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059155.1|2812447_2813326_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880965.1|2813411_2815073_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203445.1|2815221_2815560_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001112990.1|2815725_2816016_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000242603.1|2816005_2816482_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001518569.1|2816631_2817114_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_001237690.1|2817729_2829204_+	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_000533858.1|2829268_2830678_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_000196159.1|2830674_2832855_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_010989057.1|2832862_2834026_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_001542208.1|2834626_2835691_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	62.5	1.6e-118
2841703:2841718	attR	TGGCGCAGATCAAACG	NA	NA	NA	NA
>prophage 9
NZ_CP012930	Salmonella enterica subsp. enterica serovar Heidelberg strain N13-01290 chromosome, complete genome	4809628	3345575	3385007	4809628	tRNA,tail,portal,holin,capsid,head,terminase,integrase	Cronobacter_phage(69.23%)	48	3343248:3343268	3390921:3390941
3343248:3343268	attL	CCTGATGGCGCTGCGCTTATC	NA	NA	NA	NA
WP_001264394.1|3345575_3346589_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	2.8e-109
WP_001144069.1|3346816_3347032_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918865.1|3347267_3349013_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	2.1e-72
WP_001519776.1|3349162_3351010_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_000237776.1|3351133_3351640_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_024132237.1|3352812_3354513_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.3	2.2e-223
WP_000200796.1|3354515_3355061_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.0	1.4e-59
WP_000267951.1|3355032_3355758_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.4	6.6e-68
WP_001215677.1|3355747_3356278_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	32.4	4.4e-13
WP_039514810.1|3356280_3358293_-|tail	tail protein	tail	F1BUK3	Cronobacter_phage	81.2	2.1e-148
WP_001001827.1|3358302_3358890_-	hypothetical protein	NA	F1BUK5	Cronobacter_phage	81.5	2.1e-88
WP_000136922.1|3358882_3360067_-	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.1	2.0e-178
WP_001002797.1|3360063_3360393_-	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_060556251.1|3360389_3362360_-|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	68.3	3.9e-264
WP_060556252.1|3362547_3362805_-	hypothetical protein	NA	A5X9I7	Aeromonas_virus	63.4	3.6e-21
WP_070801891.1|3362791_3362980_-	hypothetical protein	NA	F1BUL1	Cronobacter_phage	79.0	5.3e-22
WP_000376373.1|3362951_3363284_-	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.9	1.5e-35
WP_000175560.1|3363283_3363625_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_001154425.1|3363621_3363915_-|holin	holin	holin	C7BGD7	Burkholderia_phage	46.2	1.3e-14
WP_000166743.1|3363924_3364380_-	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	1.5e-57
WP_000220203.1|3364376_3365504_-	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	83.7	1.9e-175
WP_052929421.1|3365500_3366208_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	76.5	3.4e-101
WP_000084220.1|3366204_3366711_-|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.8	5.2e-64
WP_000447490.1|3366707_3367196_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	81.3	4.3e-63
WP_000398492.1|3367256_3367451_-	hypothetical protein	NA	Q8W634	Enterobacteria_phage	58.6	3.3e-11
WP_001218534.1|3367454_3368159_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	67.4	1.0e-86
WP_000550496.1|3368162_3369185_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.2	1.1e-158
WP_000018798.1|3369246_3370047_-|capsid	phage capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	54.8	3.2e-76
WP_001151944.1|3370207_3371983_+	hypothetical protein	NA	F1BUM5	Cronobacter_phage	83.1	2.2e-290
WP_000038207.1|3371979_3373041_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	77.1	5.1e-162
WP_001552031.1|3373037_3373361_+	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	92.3	8.0e-50
WP_000353141.1|3373334_3373541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060556253.1|3373660_3375682_-	replication endonuclease	NA	F1BUM9	Cronobacter_phage	74.9	2.5e-298
WP_052929424.1|3375678_3376539_-	DNA adenine methylase	NA	F1BUN1	Cronobacter_phage	82.7	1.3e-131
WP_000153512.1|3376528_3376858_-	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	45.2	3.0e-12
WP_052929425.1|3376854_3377262_-	hypothetical protein	NA	A0A076GCP4	Escherichia_phage	44.2	2.2e-12
WP_060556254.1|3377252_3377486_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_000974862.1|3377553_3377955_-	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.2	1.2e-47
WP_000704101.1|3377954_3378380_-	hypothetical protein	NA	F1BUN5	Cronobacter_phage	56.2	1.7e-28
WP_000643372.1|3378384_3378567_-	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_000460878.1|3378576_3379080_-	hypothetical protein	NA	F1BUN6	Cronobacter_phage	72.5	3.5e-60
WP_052929426.1|3379110_3379332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023213890.1|3379470_3380058_+	phage repressor protein CI	NA	F1BUS8	Erwinia_phage	40.3	1.9e-33
WP_010836040.1|3380065_3380554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023213888.1|3380550_3381588_+|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	64.1	2.8e-120
WP_000213760.1|3381798_3382566_-	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_000983441.1|3382797_3383445_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000478472.1|3383441_3385007_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.9	1.0e-12
3390921:3390941	attR	CCTGATGGCGCTGCGCTTATC	NA	NA	NA	NA
>prophage 10
NZ_CP012930	Salmonella enterica subsp. enterica serovar Heidelberg strain N13-01290 chromosome, complete genome	4809628	4392139	4413036	4809628	plate,tail	Burkholderia_phage(45.0%)	26	NA	NA
WP_000587739.1|4392139_4392781_-	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.9	4.6e-33
WP_024132246.1|4393359_4393776_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000084336.1|4394156_4394612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001151758.1|4394608_4395223_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000368193.1|4395229_4396888_-|tail	tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.7	1.8e-52
WP_000359509.1|4396890_4397523_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	8.6e-24
WP_000951734.1|4397515_4398631_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	3.1e-101
WP_001093501.1|4398621_4398981_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000632053.1|4399144_4400692_-	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	3.8e-49
WP_000703633.1|4400691_4401621_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	84.1	1.4e-150
WP_000593182.1|4401617_4401980_-	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000679398.1|4402307_4403030_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000818154.1|4403039_4404083_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_001269716.1|4404070_4404280_-	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000271420.1|4404279_4405233_-	chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001262499.1|4405232_4407587_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	9.0e-66
WP_001185654.1|4407683_4407812_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001003642.1|4407771_4408089_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907497.1|4408140_4408665_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.0	2.3e-67
WP_000729852.1|4408664_4410092_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000875314.1|4410081_4410279_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000449433.1|4410275_4410731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000777266.1|4410890_4411205_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_001270441.1|4411217_4411823_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_001226442.1|4411825_4412113_-	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_000615248.1|4412688_4413036_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
>prophage 1
NZ_CP012931	Salmonella enterica subsp. enterica serovar Heidelberg strain N13-01290 plasmid pN13-01290_23, complete sequence	236176	133125	177024	236176	integrase,protease,transposase	Escherichia_phage(30.77%)	44	163703:163718	179992:180007
WP_000795946.1|133125_134307_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001285422.1|134477_134690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001232449.1|135050_136133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001284313.1|136299_137799_-	kinase	NA	NA	NA	NA	NA
WP_000081622.1|137824_139462_-	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_001253653.1|139461_140502_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001253658.1|140587_141226_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_000116681.1|141225_141867_-	TerD family protein	NA	NA	NA	NA	NA
WP_001388628.1|141889_142528_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001176767.1|142990_143458_-	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_000506887.1|143475_144684_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_000797366.1|144694_145651_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_001182411.1|145650_146730_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	33.8	8.1e-38
WP_001040059.1|146731_147505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001285478.1|147497_148640_-	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	1.7e-30
WP_001035162.1|148649_149708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000254136.1|150030_150612_+	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.0	6.3e-13
WP_001054787.1|150611_151769_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_000007449.1|151791_152247_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_000255079.1|152269_153310_+	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000116678.1|153358_153937_+	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	4.3e-06
WP_000301242.1|154004_154580_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.6	8.7e-31
WP_001053338.1|155008_156250_+	tellurium resistance protein TerF	NA	NA	NA	NA	NA
WP_000077926.1|156812_157094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000398480.1|157143_157335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001371937.1|157426_157798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000341066.1|158140_158533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024136327.1|159136_159430_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000088046.1|159434_160760_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_000134171.1|160820_161027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985910.1|161128_161419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040110386.1|161460_162297_-	APH(6)-I family aminoglycoside O-phosphotransferase	NA	NA	NA	NA	NA
WP_001082319.1|162296_163100_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000904906.1|163165_163780_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	48.6	2.3e-37
163703:163718	attL	GGCGCGCAAGGCGTCG	NA	NA	NA	NA
WP_144429427.1|163898_165091_-|transposase	IS3-like element ISKpn18 family transposase	transposase	U5P429	Shigella_phage	43.5	3.5e-50
WP_001067855.1|169182_169887_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000454193.1|170074_170425_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845048.1|170627_171641_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001206316.1|171789_172581_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000679427.1|172744_173092_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|173085_173925_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_060556266.1|174052_174553_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001163403.1|174728_175511_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.0	2.5e-33
WP_001324342.1|175500_177024_-|transposase	IS21-like element IS1326 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	24.2	1.2e-15
179992:180007	attR	GGCGCGCAAGGCGTCG	NA	NA	NA	NA
