The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013025	Escherichia coli strain 2009C-3133 chromosome, complete genome	5155368	466083	511365	5155368	terminase,protease,tail,lysis,head,portal,transposase,capsid,integrase	Enterobacteria_phage(48.44%)	66	472750:472766	519311:519327
WP_001317842.1|466083_466665_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.2	4.7e-101
WP_001695591.1|466664_470066_-|tail	phage tail fiber protein	tail	X2KTY7	Enterobacteria_phage	38.2	8.2e-12
WP_001695589.1|470130_470730_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.5	4.1e-108
WP_041498248.1|470800_474298_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	98.0	0.0e+00
472750:472766	attL	CGGAAGATGGCAGCGTG	NA	NA	NA	NA
WP_050541368.1|474358_474961_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.1	4.7e-88
WP_001695586.1|474897_475641_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	8.6e-148
WP_001152632.1|475646_476345_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	9.5e-133
WP_000847345.1|476344_476674_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
WP_001695584.1|476670_479232_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	89.4	0.0e+00
WP_042193186.1|479224_479659_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	98.3	1.3e-63
WP_001695582.1|479640_480063_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	95.0	2.6e-69
WP_021539112.1|480078_480819_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	96.7	8.9e-129
WP_001695579.1|480826_481222_-	MFS transporter	NA	A0A0K2FIF4	Enterobacteria_phage	98.5	5.0e-70
WP_001695577.1|481218_481797_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.4	1.7e-79
WP_000752994.1|481808_482162_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_001695575.1|482173_482569_-	DNA packaging protein	NA	A0A2R9YJP4	Escherichia_phage	93.9	8.2e-57
WP_001695574.1|482610_483636_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.2	7.3e-190
WP_001338090.1|483691_484024_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	6.5e-55
WP_000123272.1|484033_485353_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	1.5e-232
WP_001695573.1|485333_486935_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.1	6.5e-310
WP_001695572.1|486931_487138_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027269.1|487134_489060_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000453587.1|489034_489580_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001368374.1|489968_490202_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_001537735.1|490259_490670_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	77.8	2.7e-55
WP_001059339.1|490970_491495_-	Rha family transcriptional regulator	NA	G8C7W4	Escherichia_phage	94.2	4.5e-87
WP_001139682.1|491697_491850_-	hypothetical protein	NA	Q716B2	Shigella_phage	100.0	2.1e-21
WP_001228698.1|491878_492085_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	92.6	6.4e-29
WP_001408741.1|492301_492799_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	95.8	3.9e-88
WP_000839597.1|492798_493014_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	2.6e-33
WP_000737275.1|493585_494668_+	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	76.3	8.9e-154
WP_001204780.1|494856_495240_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	84.2	4.0e-56
WP_032149629.1|495325_495466_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	72.1	7.7e-10
WP_001099698.1|495462_495825_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.6	1.5e-60
WP_000950954.1|495844_496039_-	protein ninF	NA	NA	NA	NA	NA
WP_000386643.1|496031_496373_-	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	96.5	1.6e-61
WP_001254223.1|496375_496552_-	NinE family protein	NA	K7PHE6	Enterobacteria_phage	98.3	1.4e-27
WP_000153270.1|496548_497076_-	phage N-6-adenine-methyltransferase	NA	K7PJZ4	Enterobacterial_phage	100.0	9.5e-101
WP_000736903.1|497072_497513_-	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.0e-81
WP_114078031.1|497766_498980_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	98.0	6.0e-167
WP_074435862.1|499031_499190_-	MarR family transcriptional regulator	NA	A0A1I9LJP5	Stx_converting_phage	100.0	8.4e-21
WP_000788910.1|499186_499888_-	hypothetical protein	NA	A0A0K2FIT1	Enterobacteria_phage	100.0	7.6e-130
WP_000185505.1|499884_500784_-	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	100.0	3.8e-174
WP_000442609.1|500816_501113_-	hypothetical protein	NA	G9L678	Escherichia_phage	94.9	2.2e-46
WP_000067727.1|501254_501470_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_096002361.1|501545_502241_+	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	99.6	3.3e-133
WP_001645093.1|502463_502688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000438342.1|503142_503325_+	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	98.3	1.1e-27
WP_000088203.1|503302_503575_+	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_024188395.1|503591_504173_-	superinfection exclusion protein B	NA	K7P6T7	Enterobacteria_phage	97.9	7.0e-97
WP_000213975.1|504386_504587_+	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	100.0	1.4e-33
WP_000065371.1|504769_505138_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	99.2	4.5e-65
WP_001198858.1|505210_505351_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	3.3e-21
WP_000358700.1|505343_505487_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	95.7	1.8e-17
WP_000995439.1|505561_505858_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_001317715.1|505863_506649_+	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	99.2	4.1e-148
WP_000186851.1|506645_507326_+	YqaJ viral recombinase family protein	NA	Q6H9Z0	Enterobacteria_phage	100.0	1.2e-132
WP_000149532.1|507322_507505_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	96.7	2.8e-28
WP_000548531.1|507477_507669_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_001395510.1|507679_507961_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	100.0	2.5e-47
WP_000763363.1|508059_508281_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_001289879.1|508277_508826_+	ead/Ea22-like family protein	NA	K7PKY4	Enterobacterial_phage	58.2	7.7e-45
WP_000789830.1|508956_509655_+	DUF1311 domain-containing protein	NA	J9Q6K3	Salmonella_phage	81.0	1.6e-100
WP_000545745.1|509891_510059_+	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.9e-27
WP_001303849.1|510098_510317_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533645.1|510294_511365_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.7	1.5e-201
519311:519327	attR	CACGCTGCCATCTTCCG	NA	NA	NA	NA
>prophage 2
NZ_CP013025	Escherichia coli strain 2009C-3133 chromosome, complete genome	5155368	957301	1048444	5155368	holin,protease,terminase,plate,tail,head,portal,capsid,integrase	Shigella_phage(51.56%)	96	1005899:1005946	1044540:1044587
WP_060564989.1|957301_959335_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001314510.1|959463_960051_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089090.1|960064_961537_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159121.1|961550_963239_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.1	6.2e-61
WP_001362381.1|964402_964966_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	52.7	1.8e-52
WP_001317642.1|965024_965819_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001695470.1|965972_966734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088435459.1|967873_969067_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_060564991.1|969248_969917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000370406.1|970157_970853_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_001295802.1|970845_972273_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102115.1|972283_973003_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339603.1|973530_974385_-	DNA-binding transcriptional regulator RclR	NA	NA	NA	NA	NA
WP_001046289.1|974610_975936_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	8.5e-114
WP_000474088.1|976044_976281_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001298546.1|976292_976886_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_001299025.1|977045_977915_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.7	9.3e-53
WP_000621016.1|978163_979021_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000092636.1|979145_983393_-	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
WP_001174468.1|983958_984810_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.1	8.8e-48
WP_001172276.1|984836_985826_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_000910706.1|985856_986750_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001317639.1|987109_987352_+	NADH-flavin oxidoreductase/NADH oxidase	NA	NA	NA	NA	NA
WP_000662258.1|987832_987934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803998.1|988297_988561_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|988560_988701_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_000389022.1|989784_990327_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730984.1|990401_990989_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716404.1|991045_991714_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_060564993.1|991739_994265_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001265664.1|994254_995898_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_021525526.1|995866_996577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032148604.1|996890_997220_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019923.1|997468_998083_-	YagU family protein	NA	NA	NA	NA	NA
WP_000146236.1|998297_998483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001034006.1|1000192_1004323_+	vacuolating autotransporter toxin Vat	NA	Q9LA54	Enterobacteria_phage	40.6	3.3e-281
WP_001298126.1|1004448_1004973_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000772639.1|1005407_1005746_-	DUF4102 domain-containing protein	NA	E5AGD0	Erwinia_phage	48.6	5.6e-22
1005899:1005946	attL	AATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001742131.1|1006386_1007331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021570686.1|1007747_1008521_+	hypothetical protein	NA	A0A289ZIY5	Serratia_phage	44.7	6.6e-50
WP_000904961.1|1008581_1009136_-	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	89.5	1.5e-88
WP_060564994.1|1009162_1009714_+|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	67.1	1.5e-56
WP_060564996.1|1009713_1010316_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	90.0	1.3e-98
WP_088435495.1|1010287_1010746_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	65.3	2.1e-48
WP_060564998.1|1010730_1011339_-	hypothetical protein	NA	U5P0I1	Shigella_phage	66.8	1.3e-61
WP_046076242.1|1011342_1011927_-	YmfQ family protein	NA	O22003	Shigella_phage	99.0	1.2e-112
WP_021527505.1|1011917_1012976_-|plate	baseplate J/gp47 family protein	plate	U5P424	Shigella_phage	99.1	5.6e-201
WP_060565000.1|1012962_1013388_-|tail	phage tail protein	tail	U5P0R9	Shigella_phage	97.9	4.8e-79
WP_001259084.1|1013387_1013936_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	98.9	5.1e-97
WP_046076244.1|1013935_1015015_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.7	2.0e-206
WP_060565002.1|1015011_1016340_-	DNA circularization protein	NA	Q8SBG8	Shigella_phage	98.4	1.2e-245
WP_060565004.1|1016400_1018236_-|tail	phage tail tape measure protein	tail	S5FM63	Shigella_phage	99.5	1.0e-306
WP_000661051.1|1018377_1018647_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	98.9	6.0e-43
WP_000090998.1|1018646_1019003_-	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_060565005.1|1019002_1020499_-|tail	phage tail protein	tail	M1FN90	Enterobacteria_phage	98.8	4.5e-273
WP_000497748.1|1020482_1020653_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	98.2	2.7e-25
WP_053894831.1|1020661_1021222_-	hypothetical protein	NA	U5P4H6	Shigella_phage	98.9	2.0e-104
WP_000213504.1|1021218_1021725_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	95.2	6.3e-86
WP_000702388.1|1021699_1022110_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	97.8	5.9e-74
WP_000927719.1|1022106_1022430_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_000601357.1|1022432_1022633_-	hypothetical protein	NA	S5FNU1	Shigella_phage	95.5	1.4e-25
WP_046076246.1|1022682_1023888_-|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	99.3	1.3e-222
WP_001193633.1|1023902_1024553_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	99.5	7.3e-119
WP_001492757.1|1024530_1025772_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.3	2.5e-240
WP_000605604.1|1025771_1025954_-	hypothetical protein	NA	M1FJ83	Enterobacteria_phage	100.0	1.7e-25
WP_072011717.1|1025965_1027462_-|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.8	7.4e-300
WP_000929184.1|1027695_1028190_-|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	100.0	2.3e-88
WP_001135101.1|1028315_1028666_-	HNH endonuclease	NA	Q8SBD7	Shigella_phage	96.6	2.3e-63
WP_001373738.1|1028716_1029049_-	hypothetical protein	NA	A0A192Y5Y1	Salmonella_phage	99.1	6.2e-58
WP_001373733.1|1029511_1029904_-	DUF2570 domain-containing protein	NA	U5P0U9	Shigella_phage	85.4	1.0e-51
WP_001197761.1|1029887_1030364_-	glycoside hydrolase family protein	NA	S5FV07	Shigella_phage	96.8	1.2e-86
WP_001120496.1|1030367_1030694_-|holin	phage holin, lambda family	holin	U5P0K7	Shigella_phage	99.1	1.2e-56
WP_060565007.1|1030990_1032322_+	NTPase	NA	R9TRQ8	Vibrio_phage	28.4	1.9e-20
WP_085948622.1|1032350_1032719_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	85.0	2.3e-53
WP_001360050.1|1032733_1033723_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	100.0	1.5e-195
WP_001061418.1|1033730_1034528_-	KilA-N domain-containing protein	NA	S5FM84	Shigella_phage	99.2	2.2e-149
WP_040074681.1|1034547_1034937_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A291AX14	Escherichia_phage	98.4	4.6e-68
WP_060565009.1|1034933_1035260_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	97.2	2.9e-52
WP_060565011.1|1035256_1035910_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	1.2e-126
WP_072280524.1|1035909_1036404_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.6e-86
WP_021528956.1|1036400_1037342_-	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	100.0	1.5e-144
WP_032141723.1|1037686_1038238_-	protein YmfL	NA	S5FXP0	Shigella_phage	98.9	3.4e-101
WP_000649477.1|1038281_1038482_-	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000848748.1|1038572_1039247_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000549623.1|1039481_1039688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016389.1|1039659_1040094_-	hypothetical protein	NA	U5P096	Shigella_phage	100.0	8.4e-79
WP_000135682.1|1040562_1040925_+	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_000081287.1|1040990_1041815_+	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_060565015.1|1041942_1042479_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	99.4	3.7e-100
WP_001242749.1|1042469_1042832_+	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000206732.1|1042831_1043137_+	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
WP_000433939.1|1043136_1043487_+	helix-turn-helix domain-containing protein	NA	U5P4J3	Shigella_phage	100.0	4.9e-61
WP_060565017.1|1043363_1044527_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	99.5	3.5e-228
WP_000893310.1|1044731_1045985_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.0	3.7e-95
1044540:1044587	attR	AATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285288.1|1045996_1047100_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749899.1|1047388_1048444_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.6	3.5e-118
>prophage 3
NZ_CP013025	Escherichia coli strain 2009C-3133 chromosome, complete genome	5155368	1082197	1119546	5155368	protease,transposase	Stx2-converting_phage(60.0%)	26	NA	NA
WP_001045652.1|1082197_1086313_+|protease	serine protease autotransporter toxin Pic	protease	Q9LA54	Enterobacteria_phage	45.8	0.0e+00
WP_001270785.1|1086559_1086832_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001291700.1|1088573_1088816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001672744.1|1089087_1089303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001313590.1|1089315_1089693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000602704.1|1089768_1090227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000099202.1|1092372_1093911_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.4	1.3e-294
WP_000612626.1|1093959_1094307_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000997962.1|1094454_1095993_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.0	1.6e-297
WP_000612591.1|1096042_1096390_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|1096386_1096767_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_148639022.1|1096855_1097158_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	99.0	5.7e-50
WP_001305333.1|1104788_1106561_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	A0A0R6PI85	Moraxella_phage	25.3	1.0e-21
WP_001313589.1|1106782_1107406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000416159.1|1108160_1109192_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.0	2.3e-18
WP_000916811.1|1109462_1109906_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_000705927.1|1109921_1110209_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_000345349.1|1110221_1111478_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_001327567.1|1111724_1111979_-|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	62.2	8.0e-21
WP_000107474.1|1112400_1113414_-	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_000998353.1|1113425_1114742_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_000350265.1|1114769_1115690_-	ribokinase	NA	NA	NA	NA	NA
WP_001305338.1|1115995_1116778_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001315617.1|1116779_1116878_-	acetolactate synthase	NA	NA	NA	NA	NA
WP_001529506.1|1118316_1118775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001305343.1|1119117_1119546_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 4
NZ_CP013025	Escherichia coli strain 2009C-3133 chromosome, complete genome	5155368	1948595	2021911	5155368	holin,protease,terminase,plate,tail,lysis,head,tRNA,portal,capsid,integrase	Enterobacteria_phage(33.33%)	84	1964530:1964576	1995341:1995387
WP_000208242.1|1948595_1949126_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001293344.1|1949135_1950467_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000139496.1|1950533_1951460_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872909.1|1951552_1952038_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001296623.1|1952122_1952368_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084268.1|1952793_1953639_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_000136788.1|1953661_1955170_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_001250644.1|1955340_1956351_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000796345.1|1956447_1957194_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_000323555.1|1957198_1957627_-	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000655986.1|1957653_1957953_-	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000155257.1|1958164_1958605_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000802221.1|1958705_1959305_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_001216325.1|1959412_1960180_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000708998.1|1960234_1960990_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001045701.1|1961096_1962086_-	sulfate/thiosulfate ABC transporter substrate-binding protein Sbp	NA	NA	NA	NA	NA
WP_001318165.1|1962405_1963368_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001076742.1|1963548_1964451_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
1964530:1964576	attL	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_000468308.1|1964687_1964906_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000882973.1|1964987_1966151_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.5	2.4e-205
WP_000978896.1|1966150_1966630_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	100.0	6.6e-85
WP_032252485.1|1966644_1969092_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	99.1	0.0e+00
WP_000785970.1|1969084_1969204_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031303.1|1969236_1969512_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001251408.1|1969568_1970087_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001286679.1|1970099_1971290_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.7	6.2e-225
WP_032142943.1|1971619_1972213_-	hypothetical protein	NA	Q858S7	Enterobacteria_phage	99.0	1.0e-106
WP_000972100.1|1972434_1972962_-|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	93.1	2.2e-89
WP_032252481.1|1972963_1975117_-	hypothetical protein	NA	A0A0A7NV63	Enterobacteria_phage	71.1	1.4e-267
WP_021568193.1|1975127_1975658_-|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	98.9	5.1e-102
WP_001121497.1|1975650_1976559_-|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	100.0	1.5e-162
WP_000127163.1|1976563_1976911_-|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_032252477.1|1976907_1977543_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	97.2	1.1e-111
WP_032252474.1|1977620_1978376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032252472.1|1978372_1978831_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	63.1	7.1e-44
WP_032252470.1|1978823_1979291_-|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	98.7	3.3e-81
WP_001440152.1|1979253_1979427_-	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
WP_032252469.1|1979398_1979824_-|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	98.6	2.5e-67
WP_032252467.1|1979811_1980237_-	hypothetical protein	NA	U5N096	Enterobacteria_phage	97.9	2.5e-59
WP_001144101.1|1980251_1980749_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123123.1|1980748_1981030_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_000846399.1|1981033_1981237_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000988633.1|1981236_1981746_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_032252464.1|1981845_1982589_-|terminase	terminase endonuclease subunit	terminase	Q94MH3	Enterobacteria_phage	99.2	1.2e-122
WP_001248553.1|1982592_1983666_-|capsid	phage major capsid protein, P2 family	capsid	Q94MH9	Enterobacteria_phage	99.4	6.7e-202
WP_032252463.1|1983724_1984579_-|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	99.6	1.0e-136
WP_032252460.1|1984752_1986525_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.5	0.0e+00
WP_032252458.1|1986524_1987559_+|portal	phage portal protein	portal	Q858W8	Yersinia_virus	99.1	1.2e-200
WP_021519103.1|1987965_1988559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024187708.1|1988989_1989442_-	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	96.0	7.9e-80
WP_032252454.1|1989441_1991727_-	replication endonuclease	NA	Q858T4	Yersinia_virus	97.1	0.0e+00
WP_000027667.1|1991716_1991992_-	DUF5405 family protein	NA	Q858T5	Yersinia_virus	100.0	3.8e-45
WP_001113273.1|1991988_1992213_-	TraR/DksA family transcriptional regulator	NA	A0A0F7LDI3	Escherichia_phage	97.3	6.5e-35
WP_001277891.1|1992215_1992515_-	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	100.0	8.4e-46
WP_032252449.1|1992514_1992739_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	97.3	6.8e-32
WP_001475191.1|1992801_1993302_-	hypothetical protein	NA	S4TTB7	Salmonella_phage	98.8	6.5e-91
WP_001308179.1|1993471_1993744_-	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
WP_000777029.1|1993880_1994174_+	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
WP_000985246.1|1994243_1995224_+|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	100.0	4.7e-186
WP_001223800.1|1995410_1995911_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
1995341:1995387	attR	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_001033720.1|1996060_1996759_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580417.1|1996755_1998129_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001270237.1|1998234_1998909_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_001166063.1|1999057_2000041_-	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001318164.1|2000300_2000921_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.3	1.4e-63
WP_000063508.1|2001206_2002241_+	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_001318163.1|2002237_2003176_-	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_000217148.1|2003159_2003996_-	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_000144044.1|2004283_2005753_+	rhamnulokinase	NA	NA	NA	NA	NA
WP_001318162.1|2005749_2007009_+	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_001179750.1|2007377_2008202_+	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_000619506.1|2008211_2008526_+	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_000749944.1|2008566_2009961_-	carbohydrate porin	NA	NA	NA	NA	NA
WP_000753582.1|2011096_2011930_-	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_077249483.1|2012123_2015174_+	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
WP_000331377.1|2015186_2016089_+	formate dehydrogenase O subunit beta	NA	NA	NA	NA	NA
WP_000829013.1|2016085_2016721_+	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000027720.1|2016717_2017647_+	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_001295676.1|2017861_2018080_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_000356397.1|2018684_2018975_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000897305.1|2018975_2019287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001318161.1|2019515_2020424_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001297068.1|2020487_2021429_-	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_000560983.1|2021473_2021911_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP013025	Escherichia coli strain 2009C-3133 chromosome, complete genome	5155368	2316776	2337139	5155368	transposase,integrase	Salmonella_phage(28.57%)	22	2316508:2316567	2337349:2338705
2316508:2316567	attL	CTCAGAAAACGGAATCTATGGTCACTCCCGTTTTTGCAACACCGATTTTGACGACAAGTT	NA	NA	NA	NA
WP_000427614.1|2316776_2317781_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_001138073.1|2317859_2320832_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
WP_001162012.1|2320834_2321392_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_000845048.1|2321697_2322711_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000777555.1|2322870_2323344_+	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	A0A140HLG8	Bacillus_phage	33.8	3.7e-19
WP_001206316.1|2323436_2324228_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000679427.1|2324391_2324739_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|2324732_2325572_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000376623.1|2325699_2326200_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001163403.1|2326375_2327158_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.0	2.5e-33
WP_001324342.1|2327147_2328671_-|transposase	IS21-like element IS1326 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	24.2	1.2e-15
WP_000344784.1|2328772_2329633_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000935451.1|2329635_2331351_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001300294.1|2331389_2332058_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000993386.1|2332093_2332330_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277456.1|2332326_2332689_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_021547793.1|2332706_2334401_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001340589.1|2334452_2334875_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732292.1|2334910_2335186_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294663.1|2335199_2335550_-	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000429836.1|2335621_2336056_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000427614.1|2336134_2337139_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
2337349:2338705	attR	AACTTGTCGTCAAAATCGGTGTTGCAAAAACGGGAGTGACCATAGATTCCGTTTTCTGAGACGACCCCATATAGGCCTTCCTGCCTGACGGTTATATATTAACAATTTCGCAACCGTCCGAAATGTTATAAATTATCAGACATAGTAAAACGGCTTCGTTTGAGTGTCCATTAAATCGTCATTTTGGCATAATAGACACATCGTGTCTGATATTCGATTTAAGGTACATTTTATGCGAATTTTTGGTTATGCGCGGGTCTCAACCAGCCAGCAGTCCCTCGATATTCAGATCAGAGCGCTCAAAGATGCAGGGGTAAAAGCTAACCGCATCTTTACCGACAAGGCATCCGGCAGTTCAACAGATCGGGAAGGGCTGGATTTGCTGAGGATGAAGGTGGAGGAAGGTGATGTCATTCTGGTGAAGAAGCTCGACCGTCTTGGCCGCGACACCGCCGACATGATCCAACTGATAAAAGAGTTTGATGCTCAGGGTGTCGCGGTTCGGTTTATTGACGACGGGATCAGTACCGACGGTGATATGGGGCAAATGGTGGTCACCATCCTGTCGGCTGTGGCACAAGCTGAACGCCGGAGGATCCTAGAGCGCACGAATGAGGGCCGACAGGAAGCAAAGCTGAAAGGAATCAAATTTGGCCGCAGGCGTACCGTGGACAGGAACGTCGTGCTGACGCTTCATCAGAAGGGCACTGGTGCAACGGAAATTGCTCATCAGCTCAGTATTGCCCGCTCCACGGTTTATAAAATTCTTGAAGACGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTTAATGTCATGATAATAATGGTTTCTTAGACGTCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGATACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAGCTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGTGCGGTATTATCCCGTGTTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTG	NA	NA	NA	NA
>prophage 6
NZ_CP013025	Escherichia coli strain 2009C-3133 chromosome, complete genome	5155368	3112339	3171378	5155368	transposase	Stx2-converting_phage(47.62%)	48	NA	NA
WP_085949305.1|3112339_3113613_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	98.0	6.3e-175
WP_025492118.1|3113760_3115809_+	TonB-dependent siderophore receptor IreA	NA	A0A0P0I887	Acinetobacter_phage	33.5	1.1e-11
WP_001126822.1|3119539_3120106_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_001593693.1|3120363_3120981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000958492.1|3121004_3121238_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001167444.1|3121515_3122064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114078034.1|3122081_3122342_-	osmoprotectant transport activator ProQ	NA	Q2A0A1	Sodalis_phage	37.1	3.3e-06
WP_000839181.1|3122407_3122812_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	99.3	1.1e-69
WP_000612626.1|3122808_3123156_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000099202.1|3123204_3124743_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.4	1.3e-294
WP_001366542.1|3124860_3125052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001018808.1|3125647_3126667_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	25.8	4.3e-17
WP_001317566.1|3126924_3127368_+	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_000699820.1|3127446_3127719_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_000470229.1|3127741_3129130_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_001101067.1|3129126_3129957_+	transketolase	NA	NA	NA	NA	NA
WP_000609007.1|3129949_3130903_+	transketolase family protein	NA	NA	NA	NA	NA
WP_131501864.1|3131165_3131279_+|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	71.4	3.4e-08
WP_000919997.1|3132129_3133488_+	immunoglobulin-binding protein	NA	Q9MCI8	Enterobacteria_phage	76.1	5.6e-20
WP_000884152.1|3133549_3134005_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_000760916.1|3134389_3134728_-	c-type lysozyme inhibitor	NA	NA	NA	NA	NA
WP_000859647.1|3135232_3135922_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_000983423.1|3135921_3137478_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_001293447.1|3137643_3138468_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000551919.1|3138624_3139968_-	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_000803221.1|3141462_3142779_-	sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB	NA	NA	NA	NA	NA
WP_089581225.1|3142949_3143135_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_001313273.1|3143143_3143251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001313270.1|3145122_3147093_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000977396.1|3147111_3147903_+	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
WP_001171554.1|3148482_3148863_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612556.1|3148859_3149207_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	99.1	4.8e-61
WP_000997962.1|3149256_3150795_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.0	1.6e-297
WP_000612591.1|3150844_3151192_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3151188_3151569_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_032252936.1|3151752_3153345_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.2	1.3e-180
WP_000624717.1|3153375_3153726_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	1.2e-40
WP_000422741.1|3153722_3154148_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_001360336.1|3156360_3159858_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	34.8	2.7e-98
WP_001283626.1|3160868_3161390_+	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_001068910.1|3161386_3162340_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_000188254.1|3162426_3164751_+	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_000879160.1|3164795_3165698_+	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_000125181.1|3165694_3166693_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_000684856.1|3166689_3167646_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000175457.1|3167646_3168414_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000177057.1|3168971_3169229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001254932.1|3170226_3171378_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
>prophage 7
NZ_CP013025	Escherichia coli strain 2009C-3133 chromosome, complete genome	5155368	3546576	3557989	5155368	integrase	Enterobacteria_phage(70.0%)	12	3546839:3546852	3563681:3563694
WP_025491910.1|3546576_3548910_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	99.1	0.0e+00
3546839:3546852	attL	ATGCCGCTGGTCTG	NA	NA	NA	NA
WP_000856729.1|3548924_3549245_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000459325.1|3549380_3549836_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	8.0e-64
WP_001244665.1|3549828_3550116_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_025491911.1|3550108_3550708_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	81.8	1.7e-50
WP_001149160.1|3550704_3550971_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_025491912.1|3551522_3552257_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.4	3.0e-129
WP_001583072.1|3552253_3552754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025491913.1|3552827_3553400_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	95.2	4.6e-93
WP_077697332.1|3553900_3554995_+	DUF262 domain-containing protein	NA	A0A0R6PKN1	Moraxella_phage	27.7	2.0e-12
WP_025491917.1|3555551_3556745_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	49.8	2.0e-106
WP_000162574.1|3557506_3557989_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
3563681:3563694	attR	CAGACCAGCGGCAT	NA	NA	NA	NA
>prophage 8
NZ_CP013025	Escherichia coli strain 2009C-3133 chromosome, complete genome	5155368	4071662	4081105	5155368		Enterobacteria_phage(85.71%)	10	NA	NA
WP_021539241.1|4071662_4072589_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.3e-23
WP_000783127.1|4072593_4073325_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|4073305_4073413_-	protein YohO	NA	NA	NA	NA	NA
WP_001240405.1|4073472_4074204_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.2e-111
WP_001309587.1|4074425_4076111_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.5	7.3e-304
WP_000598641.1|4076107_4076827_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|4076873_4077344_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001296231.1|4077385_4077847_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_021539240.1|4077971_4079972_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.4	0.0e+00
WP_021539239.1|4079968_4081105_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	98.4	5.9e-164
>prophage 9
NZ_CP013025	Escherichia coli strain 2009C-3133 chromosome, complete genome	5155368	4172655	4183182	5155368		Enterobacteria_phage(33.33%)	10	NA	NA
WP_021569455.1|4172655_4174050_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.0	2.2e-19
WP_021569454.1|4174224_4175118_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	41.7	1.1e-45
WP_021569453.1|4175490_4176576_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.5	4.2e-103
WP_021569452.1|4176575_4177475_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.5	9.7e-29
WP_021569451.1|4177532_4178408_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.0	4.0e-104
WP_032285339.1|4178501_4179305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021569449.1|4179334_4180420_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2K9L470	Tupanvirus	33.5	2.4e-29
WP_021569448.1|4180424_4181537_+	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A2K9L0G1	Tupanvirus	29.0	9.5e-26
WP_021569447.1|4181596_4182616_+	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	36.5	4.2e-44
WP_021569446.1|4182639_4183182_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	56.7	3.6e-55
>prophage 10
NZ_CP013025	Escherichia coli strain 2009C-3133 chromosome, complete genome	5155368	4288986	4332853	5155368	holin,terminase,protease,tail,head,portal,transposase,capsid,integrase	Escherichia_phage(39.53%)	54	4277506:4277520	4298687:4298701
4277506:4277520	attL	GCAGACGATGCAGGG	NA	NA	NA	NA
WP_000480162.1|4288986_4290249_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	38.8	2.6e-72
WP_001300801.1|4290586_4291384_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_021546102.1|4291619_4292645_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.9	3.4e-102
WP_000096344.1|4292644_4292848_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_047668586.1|4292906_4295348_-	exonuclease	NA	V5UQJ3	Shigella_phage	46.9	3.1e-114
WP_021579309.1|4295441_4295633_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000854558.1|4295629_4295818_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|4296217_4296382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171942.1|4296385_4296604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|4296763_4296919_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000362155.1|4297183_4297603_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_000391950.1|4297703_4297985_+	hypothetical protein	NA	K7PHA1	Enterobacteria_phage	72.6	6.5e-24
WP_000693835.1|4297968_4298394_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_047668587.1|4298465_4299536_+	phage replisome organizer	NA	A0A088CD36	Shigella_phage	65.7	6.5e-64
4298687:4298701	attR	GCAGACGATGCAGGG	NA	NA	NA	NA
WP_001151178.1|4299576_4300002_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	94.2	1.5e-64
WP_001546006.1|4299998_4300199_+	hypothetical protein	NA	A0A2R2Z315	Escherichia_phage	72.9	3.9e-15
WP_001224945.1|4300294_4300477_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	91.7	1.1e-24
WP_001289996.1|4300642_4301158_+	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	76.5	2.5e-37
WP_001176099.1|4301297_4301555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001013637.1|4301751_4301964_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	98.5	3.1e-26
WP_000737636.1|4302107_4302500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024168546.1|4302796_4303075_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.0	2.5e-12
WP_024188444.1|4303076_4304132_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.1	7.5e-89
WP_000139992.1|4304132_4304498_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	7.1e-39
WP_001064896.1|4304494_4305184_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	2.8e-60
WP_000839572.1|4305996_4306212_+|holin	holin	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
WP_000193289.1|4306216_4306567_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.4e-36
WP_000992100.1|4306630_4307164_+	lysozyme	NA	Q08J98	Stx2-converting_phage	94.4	3.6e-100
WP_001228685.1|4307380_4307566_+	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	80.3	6.4e-20
WP_001100260.1|4307783_4308050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000351660.1|4308055_4308595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001111090.1|4308733_4309084_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	98.3	4.3e-65
WP_001352368.1|4309369_4310578_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_064764399.1|4310599_4311052_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	97.3	2.0e-78
WP_001140892.1|4311051_4312809_+|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.3	0.0e+00
WP_000923129.1|4312956_4314183_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	83.1	1.1e-203
WP_000999828.1|4314175_4314775_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	81.0	1.9e-89
WP_000766109.1|4314789_4316007_+|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.6	5.9e-162
WP_000719066.1|4316083_4316401_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	50.5	6.2e-23
WP_001147814.1|4316409_4316748_+|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	90.2	7.5e-51
WP_042092541.1|4316744_4317194_+	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	79.9	8.7e-63
WP_001206306.1|4317190_4317535_+	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	97.4	1.4e-55
WP_000097524.1|4317594_4318299_+	hypothetical protein	NA	A0A1B5FP82	Escherichia_phage	93.6	1.7e-113
WP_077249358.1|4318298_4318685_+|tail	phage tail protein	tail	A0A1B5FP91	Escherichia_phage	99.2	2.6e-63
WP_077784206.1|4318726_4318987_+	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	95.3	5.1e-39
WP_053271052.1|4319033_4322261_+|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.6	0.0e+00
WP_001330090.1|4322238_4322595_+|tail	tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
WP_060565118.1|4322594_4323293_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.8	1.2e-132
WP_060565121.1|4323298_4324042_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	9.2e-150
WP_000741572.1|4323939_4324587_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.9	2.0e-108
WP_060565123.1|4324647_4328127_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.0	0.0e+00
WP_001619470.1|4328194_4328794_+	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	96.5	6.3e-109
WP_071887274.1|4328858_4332272_+	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	35.5	1.8e-11
WP_000885585.1|4332271_4332853_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.8	9.2e-105
>prophage 11
NZ_CP013025	Escherichia coli strain 2009C-3133 chromosome, complete genome	5155368	4692596	4822167	5155368	holin,bacteriocin,protease,terminase,tail,lysis,portal,capsid,integrase	Shigella_phage(48.03%)	155	4708939:4708958	4778679:4778698
WP_001254970.1|4692596_4693418_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|4693517_4693601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743943.1|4693693_4694029_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091847.1|4694426_4695680_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019561.1|4695786_4696680_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|4696814_4698035_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919226.1|4698159_4698855_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071586384.1|4698807_4700100_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148698.1|4700257_4700872_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	1.1e-28
WP_000526519.1|4700914_4701769_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000254426.1|4701770_4702325_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	57.7	1.4e-62
WP_001442247.1|4702362_4703526_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	99.5	4.2e-226
WP_124034985.1|4703381_4703828_-	helix-turn-helix domain-containing protein	NA	S5FM74	Shigella_phage	73.1	4.2e-41
WP_000497813.1|4703787_4704039_-	DUF4222 domain-containing protein	NA	A0A088CBN9	Shigella_phage	100.0	1.3e-39
WP_000187058.1|4704086_4704767_-	YqaJ viral recombinase family protein	NA	V5UT69	Shigella_phage	100.0	2.1e-132
WP_000100858.1|4704763_4705549_-	phage recombination protein Bet	NA	A0A088CBI3	Shigella_phage	99.6	1.8e-148
WP_000995035.1|4705554_4705851_-	hypothetical protein	NA	V5URU8	Shigella_phage	99.0	3.3e-50
WP_001271581.1|4705847_4707896_-	exodeoxyribonuclease VIII	NA	V5UQJ3	Shigella_phage	98.5	0.0e+00
WP_000660960.1|4708004_4708391_-	hypothetical protein	NA	A0A088CBP0	Shigella_phage	97.7	7.3e-66
WP_000560215.1|4708481_4708697_-	cell division protein FtsZ	NA	A0A088CE40	Shigella_phage	98.6	2.8e-35
4708939:4708958	attL	GTTGCAGCGGGGTTGTCACT	NA	NA	NA	NA
WP_001005965.1|4709028_4709385_-	hypothetical protein	NA	A0A088CBI5	Shigella_phage	100.0	1.3e-56
WP_060565127.1|4709416_4710130_-	hypothetical protein	NA	A0A088CC14	Shigella_phage	99.2	6.1e-127
WP_000088198.1|4710133_4710406_-	hypothetical protein	NA	A0A088CD31	Shigella_phage	100.0	3.3e-41
WP_000239215.1|4710800_4711571_-	helix-turn-helix transcriptional regulator	NA	A0A088CBP2	Shigella_phage	100.0	1.5e-147
WP_001068241.1|4711655_4711883_+	hypothetical protein	NA	A0A088CE43	Shigella_phage	100.0	5.4e-37
WP_000084292.1|4712026_4712323_+	hypothetical protein	NA	A0A088CBI6	Shigella_phage	100.0	2.3e-48
WP_000438870.1|4712337_4712556_+	hypothetical protein	NA	A0A088CC17	Shigella_phage	100.0	1.1e-21
WP_060565129.1|4712576_4713677_+	hypothetical protein	NA	V5URT9	Shigella_phage	97.8	1.2e-203
WP_000790395.1|4713683_4714424_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	100.0	7.2e-139
WP_000450880.1|4714449_4715220_+	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	100.0	6.6e-135
WP_001151119.1|4715234_4715666_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	100.0	2.5e-75
WP_000060692.1|4715698_4716373_-	DUF4145 domain-containing protein	NA	V5URE2	Shigella_phage	100.0	1.3e-123
WP_000354190.1|4716371_4716617_+	hypothetical protein	NA	A0A088CC19	Shigella_phage	100.0	6.2e-39
WP_001240641.1|4716664_4716970_-	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	100.0	3.4e-50
WP_042963326.1|4717059_4717257_-	hypothetical protein	NA	A0A0N7BYR2	Escherichia_phage	98.5	7.8e-32
WP_001260981.1|4717385_4717643_-	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	98.8	2.8e-37
WP_000211407.1|4717970_4718636_+	hypothetical protein	NA	A0A088CD42	Shigella_phage	80.4	3.9e-91
WP_000107185.1|4718892_4719537_+	hypothetical protein	NA	H6WRU8	Salmonella_phage	52.9	1.0e-56
WP_042963318.1|4719591_4720002_+	recombination protein NinB	NA	A0A088CBP6	Shigella_phage	97.8	1.4e-70
WP_042187504.1|4719998_4720190_+	NinE family protein	NA	Q9MCP2	Enterobacteria_phage	91.2	4.0e-25
WP_042963315.1|4720213_4720504_+	DUF1364 domain-containing protein	NA	A0A088CE53	Shigella_phage	99.0	1.9e-50
WP_001008117.1|4720500_4720863_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A088CBJ1	Shigella_phage	100.0	6.4e-64
WP_000992060.1|4720862_4721057_+	protein ninH	NA	A0A088CC23	Shigella_phage	100.0	1.4e-30
WP_001204860.1|4721049_4721430_+	antitermination protein	NA	A0A088CD47	Shigella_phage	99.2	4.0e-69
WP_000350576.1|4721561_4722155_+	hypothetical protein	NA	A0A088CBP8	Shigella_phage	99.5	4.8e-109
WP_000691354.1|4722729_4723677_+	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_000752026.1|4723686_4723956_+	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_000874412.1|4724459_4726400_+	SASA family carbohydrate esterase	NA	A0A088CD51	Shigella_phage	99.4	0.0e+00
WP_000143459.1|4726535_4726715_+	DUF1378 family protein	NA	A0A088CBQ0	Shigella_phage	100.0	2.2e-25
WP_001290208.1|4726755_4727001_+	DUF826 domain-containing protein	NA	A0A088CE63	Shigella_phage	100.0	8.5e-20
WP_000284510.1|4727078_4727294_+|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000087455.1|4727298_4727832_+	lysozyme	NA	A0A088CC28	Shigella_phage	100.0	6.0e-103
WP_001056878.1|4728106_4728679_+	hypothetical protein	NA	A0A088CD55	Shigella_phage	100.0	5.1e-108
WP_000455406.1|4728678_4728828_+	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
WP_001082567.1|4728835_4729273_+|lysis	lysis protein	lysis	A0A088CBQ1	Shigella_phage	100.0	6.9e-73
WP_001109015.1|4729475_4730018_+	Rha family transcriptional regulator	NA	A0A088CBJ5	Shigella_phage	100.0	1.1e-99
WP_001086073.1|4730541_4731348_+|terminase	terminase	terminase	A0A0P0ZG40	Escherichia_phage	100.0	1.3e-133
WP_000143989.1|4731328_4733035_+|terminase	terminase	terminase	A0A0H4IT14	Shigella_phage	99.6	0.0e+00
WP_000787518.1|4733034_4735179_+|portal	portal protein	portal	A0A0P0ZGR1	Escherichia_phage	100.0	0.0e+00
WP_032313361.1|4735336_4736341_+	hypothetical protein	NA	A0A2L1IV47	Escherichia_phage	94.3	9.7e-171
WP_032313362.1|4736363_4737578_+|capsid	N4-gp56 family major capsid protein	capsid	A0A088CC32	Shigella_phage	100.0	5.2e-235
WP_032313363.1|4737632_4738025_+	hypothetical protein	NA	A0A088CD63	Shigella_phage	100.0	1.2e-63
WP_032313364.1|4738075_4738537_+	hypothetical protein	NA	A0A088CBQ5	Shigella_phage	100.0	4.8e-64
WP_032313365.1|4738520_4739084_+	hypothetical protein	NA	A0A088CE76	Shigella_phage	100.0	9.8e-104
WP_032313366.1|4739083_4739734_+	hypothetical protein	NA	A0A088CBJ9	Shigella_phage	100.0	2.1e-121
WP_047199911.1|4739730_4741752_+|tail	tail fiber protein	tail	A0A088CC33	Shigella_phage	100.0	2.7e-87
WP_000537687.1|4741827_4742373_+	hypothetical protein	NA	A0A088CD67	Shigella_phage	100.0	6.8e-94
WP_000276175.1|4742385_4742613_+	hypothetical protein	NA	A0A088CBQ7	Shigella_phage	100.0	1.2e-39
WP_001146318.1|4742935_4744561_+	hypothetical protein	NA	A0A088CBK0	Shigella_phage	100.0	0.0e+00
WP_047199912.1|4744557_4745826_+	host specificity protein J	NA	A0A088CC36	Shigella_phage	100.0	4.9e-220
WP_000455635.1|4745840_4746119_+	hypothetical protein	NA	A0A088CD71	Shigella_phage	100.0	1.1e-50
WP_047199913.1|4746124_4746742_+	hypothetical protein	NA	A0A088CBQ8	Shigella_phage	100.0	6.7e-122
WP_047199914.1|4746859_4747594_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A088CE87	Shigella_phage	100.0	6.7e-137
WP_000078907.1|4747826_4747967_+	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000035557.1|4748023_4748425_+	hypothetical protein	NA	A0A088CC37	Shigella_phage	100.0	1.2e-71
WP_000509491.1|4748518_4749175_+	hypothetical protein	NA	A0A088CD74	Shigella_phage	100.0	5.1e-104
WP_000455647.1|4749177_4749624_+	hypothetical protein	NA	A0A088CBR0	Shigella_phage	100.0	8.1e-77
WP_000540391.1|4749634_4749886_+|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_000012453.1|4749896_4751162_+	hypothetical protein	NA	A0A088CBK4	Shigella_phage	100.0	6.4e-228
WP_060565130.1|4751231_4759613_+	hypothetical protein	NA	A0A088CC40	Shigella_phage	99.5	0.0e+00
WP_000481379.1|4759736_4759928_+	hypothetical protein	NA	A0A088CD78	Shigella_phage	95.2	8.0e-26
WP_060565132.1|4760014_4760941_-	DUF551 domain-containing protein	NA	A0A088CE95	Shigella_phage	99.7	4.8e-180
WP_071887269.1|4761558_4762149_-	ead/Ea22-like family protein	NA	A0A088CC42	Shigella_phage	64.0	9.5e-33
WP_060565136.1|4762145_4762367_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C094	Escherichia_phage	98.6	1.7e-35
WP_000211519.1|4762414_4763044_-	phage antirepressor Ant	NA	A0A0P0ZCA2	Stx2-converting_phage	86.6	4.5e-97
WP_000213043.1|4763459_4763573_-	4Fe-4S binding protein	NA	A0A077SL61	Escherichia_phage	72.0	2.1e-05
WP_001695753.1|4763583_4766007_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	9.8e-209
WP_000041658.1|4766067_4768494_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	3.8e-213
WP_001317855.1|4768692_4768998_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001445899.1|4769105_4769816_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138584.1|4769818_4770379_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705195.1|4770413_4770755_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001295395.1|4770889_4771216_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	7.6e-24
WP_001295394.1|4771421_4772636_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836040.1|4772647_4773667_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	3.3e-17
WP_001513307.1|4773724_4773835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060565138.1|4773854_4775135_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.1	5.6e-155
WP_001296941.1|4775169_4775406_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_032161814.1|4775493_4777965_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_001083280.1|4778058_4778250_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000854559.1|4778246_4778435_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_032161815.1|4778921_4779497_-	hypothetical protein	NA	NA	NA	NA	NA
4778679:4778698	attR	GTTGCAGCGGGGTTGTCACT	NA	NA	NA	NA
WP_000379589.1|4779498_4779654_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001003381.1|4779846_4780254_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	2.5e-24
WP_000476993.1|4780331_4780559_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705349.1|4780542_4781064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054506.1|4781044_4782010_+	hypothetical protein	NA	U5P0A0	Shigella_phage	61.2	1.7e-55
WP_023277787.1|4782050_4782506_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.9	5.2e-63
WP_000084874.1|4782797_4784573_+	AIPR family protein	NA	D0UIM0	Aggregatibacter_phage	30.7	2.4e-63
WP_122985418.1|4785042_4785150_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	2.5e-08
WP_000887486.1|4785194_4785407_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	3.9e-29
WP_000980994.1|4785623_4785875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032147304.1|4785941_4786220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060565140.1|4786221_4787271_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	57.0	2.4e-111
WP_001047133.1|4787284_4788037_+	antitermination protein	NA	Q8SBE4	Shigella_phage	94.8	1.3e-130
WP_120795389.1|4788314_4788404_-	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_000087756.1|4788458_4788671_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_000066484.1|4788971_4789187_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000839590.1|4789940_4790156_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_001309518.1|4790139_4790472_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	64.3	1.1e-25
WP_001092971.1|4790468_4791002_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_001071769.1|4790998_4791496_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_000066495.1|4791859_4792072_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071524604.1|4792082_4792271_+	cold-shock protein	NA	NA	NA	NA	NA
WP_122134696.1|4792273_4792339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001309517.1|4792418_4792574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019606.1|4792745_4792919_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_024212252.1|4793070_4793481_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	89.0	2.1e-63
WP_001031431.1|4793781_4793988_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	91.2	6.7e-26
WP_000421823.1|4794548_4795088_+	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	99.4	1.8e-94
WP_023277784.1|4795096_4797196_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	96.4	0.0e+00
WP_001072975.1|4797192_4797405_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000985929.1|4797404_4798913_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.6	4.5e-289
WP_023277783.1|4798857_4800885_+|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	99.4	0.0e+00
WP_023140705.1|4800971_4801295_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	99.1	8.5e-52
WP_001283153.1|4801287_4801563_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_023140704.1|4801574_4802153_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	1.2e-101
WP_001079419.1|4802149_4802551_+|tail	tail protein	tail	A5LH34	Enterobacteria_phage	99.2	1.9e-72
WP_021560209.1|4802561_4803305_+|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	99.2	2.3e-132
WP_060565178.1|4803365_4803752_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	99.2	3.0e-64
WP_001161009.1|4803760_4804090_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_060565141.1|4804061_4807127_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.2	0.0e+00
WP_000447248.1|4807126_4807456_+|tail	phage tail protein	tail	A0A291AWW9	Escherichia_phage	100.0	1.7e-60
WP_001152405.1|4807465_4808164_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	98.7	3.3e-133
WP_060565143.1|4808168_4808912_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.5	1.5e-144
WP_000741589.1|4808809_4809457_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.2	1.9e-111
WP_060565145.1|4809516_4812930_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.3	0.0e+00
WP_001230375.1|4812999_4813599_+	Ail/Lom family protein	NA	A0A291AWV3	Escherichia_phage	98.5	5.7e-110
WP_071887275.1|4813663_4816735_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	82.1	1.9e-68
WP_000885611.1|4816734_4817310_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_000086527.1|4817407_4817998_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836768.1|4818314_4818548_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|4818616_4818730_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000347482.1|4819334_4820618_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527790.1|4820706_4822167_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.7	5.1e-43
>prophage 12
NZ_CP013025	Escherichia coli strain 2009C-3133 chromosome, complete genome	5155368	4972539	5045310	5155368	protease,tail,lysis,tRNA,transposase,integrase	Escherichia_phage(52.63%)	75	4970086:4970102	5044443:5044459
4970086:4970102	attL	TTATCAGCGCAAAAAAC	NA	NA	NA	NA
WP_000526135.1|4972539_4972998_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	2.9e-13
WP_000097834.1|4973180_4974041_-	pyridoxine 4-dehydrogenase	NA	NA	NA	NA	NA
WP_001123437.1|4974271_4974862_-	phenylacetic acid degradation protein PaaY	NA	NA	NA	NA	NA
WP_001317799.1|4974843_4975026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072128249.1|4974990_4975203_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001296049.1|4975374_4975701_-	YdbL family protein	NA	NA	NA	NA	NA
WP_000698145.1|4975708_4975894_-	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_000900938.1|4975890_4978530_-	YdbH family protein	NA	NA	NA	NA	NA
WP_000762229.1|4978737_4979727_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
WP_001296048.1|4979837_4980260_+	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_001295715.1|4980256_4980523_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_000628257.1|4980796_4984321_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_000837933.1|4984686_4985820_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	54.1	1.5e-103
WP_001295593.1|4985960_4986395_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_001516440.1|4987408_4988362_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_060565149.1|4988546_4990031_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001516442.1|4990100_4990673_-	cytolethal distending toxin type IV subunit CdtC	NA	A5LH54	Enterobacteria_phage	85.7	3.7e-90
WP_000734594.1|4990669_4991491_-	cytolethal distending toxin type IV nuclease subunit CdtB	NA	A5LH53	Enterobacteria_phage	95.6	4.3e-148
WP_001531672.1|4991487_4992201_-	cytolethal distending toxin type I subunit CdtA	NA	A5LH52	Enterobacteria_phage	98.3	9.4e-136
WP_060565151.1|4993099_4993681_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.2	1.6e-101
WP_016233230.1|4993689_4994592_-	hypothetical protein	NA	A0A0M4QWS3	Salmonella_phage	64.3	1.1e-99
WP_060565153.1|4994588_4997564_-	hypothetical protein	NA	A0A0K2FIZ6	Escherichia_phage	93.2	1.2e-54
WP_060565155.1|4997628_4998228_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	96.0	2.7e-107
WP_021540949.1|4998295_5001691_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	89.5	0.0e+00
WP_000741589.1|5001751_5002399_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.2	1.9e-111
WP_060565157.1|5002296_5003040_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.9e-148
WP_060565159.1|5003045_5003744_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	93.1	2.3e-126
WP_032149819.1|5003743_5004082_-|tail	tail protein	tail	H6WZM2	Escherichia_phage	50.4	1.1e-28
WP_016233032.1|5004074_5007308_-|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	33.0	1.1e-101
WP_122988443.1|5007779_5008139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060565161.1|5008289_5009252_-	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	39.5	1.2e-56
WP_000144682.1|5009278_5009671_-	hypothetical protein	NA	A0A059VK45	Pseudomonas_phage	31.5	2.3e-11
WP_001029818.1|5009667_5010048_-	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	43.6	1.9e-18
WP_000524263.1|5010048_5010432_-	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	40.2	1.7e-14
WP_016233029.1|5010431_5010827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908083.1|5010830_5011055_-	hypothetical protein	NA	G8C7P8	Escherichia_phage	52.7	5.6e-10
WP_001526967.1|5011097_5012237_-	hypothetical protein	NA	G8C7P7	Escherichia_phage	75.0	4.4e-159
WP_000770040.1|5012335_5013100_-	hypothetical protein	NA	G8C7P6	Escherichia_phage	66.1	5.6e-86
WP_114078031.1|5013347_5014561_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	98.0	6.0e-167
WP_016233027.1|5015613_5017020_-	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	68.3	2.0e-185
WP_016233026.1|5017022_5018324_-	hypothetical protein	NA	A0A1B1P9C9	Acinetobacter_phage	59.8	2.1e-149
WP_016233025.1|5018304_5019399_-	hypothetical protein	NA	A0A0U2RXW9	Escherichia_phage	81.3	2.2e-115
WP_000126788.1|5019402_5019612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204031.1|5019589_5020522_-	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	1.9e-83
WP_016233024.1|5020514_5021306_-	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	40.7	5.7e-49
WP_024188596.1|5021443_5022901_-	potassium transporter TrkG	NA	NA	NA	NA	NA
WP_077637407.1|5023097_5023283_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	69.0	1.2e-13
WP_001135280.1|5023499_5023997_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.6	1.1e-90
WP_000839596.1|5023996_5024212_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000640127.1|5025501_5026038_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.0	3.0e-70
WP_016233021.1|5026034_5026325_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	86.5	8.2e-46
WP_000940322.1|5026324_5026924_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.5	5.9e-107
WP_000935258.1|5027390_5027603_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	6.6e-29
WP_016233020.1|5027783_5028449_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_001151236.1|5028633_5029050_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.2	8.1e-63
WP_000450696.1|5029065_5029827_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.5	5.5e-118
WP_060565164.1|5029849_5030596_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	79.3	3.4e-112
WP_001595662.1|5030602_5031460_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	74.1	1.5e-74
WP_000693801.1|5031472_5031895_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	97.1	8.2e-71
WP_001072343.1|5031891_5032146_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000233320.1|5032225_5032645_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
WP_001169150.1|5033080_5033233_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	3.5e-08
WP_000560211.1|5033643_5033865_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.0e-37
WP_000245522.1|5033858_5034035_+	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	91.4	1.1e-24
WP_001314664.1|5034109_5034385_+	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	93.4	1.3e-40
WP_060565168.1|5034486_5037087_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	62.7	2.6e-247
WP_000166313.1|5037079_5037889_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
WP_001317028.1|5037945_5038140_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_001595656.1|5038132_5038321_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	7.2e-27
WP_001684880.1|5038420_5038636_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	98.6	5.1e-37
WP_016233011.1|5038637_5039873_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	1.6e-239
WP_001157407.1|5039924_5040860_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_001272254.1|5040988_5042362_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.4	5.1e-53
WP_000387388.1|5042839_5043823_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_001306539.1|5044077_5045310_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
5044443:5044459	attR	TTATCAGCGCAAAAAAC	NA	NA	NA	NA
>prophage 1
NZ_CP013024	Escherichia coli strain 2009C-3133 plasmid unnamed1, complete sequence	120611	18746	56277	120611	transposase,integrase	Escherichia_phage(30.0%)	35	41764:41793	60978:61007
WP_000486835.1|18746_19916_-|integrase	site-specific integrase	integrase	W6MYA3	Pseudomonas_phage	43.3	5.5e-48
WP_001168072.1|20530_21895_-	shufflon system plasmid conjugative transfer pilus tip adhesin PilV	NA	K7P7Q7	Enterobacteria_phage	39.6	1.1e-23
WP_000478596.1|21899_22535_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_000870986.1|22553_23027_-	lytic transglycosylase domain-containing protein	NA	A0A0A8J856	Ralstonia_phage	36.3	2.9e-08
WP_001011156.1|23080_23617_-	cleavage protein	NA	NA	NA	NA	NA
WP_000670135.1|23690_24791_-	type II secretion protein F	NA	NA	NA	NA	NA
WP_060564965.1|24792_26301_-	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
WP_001112926.1|26385_26838_-	type IV pilus biogenesis protein PilP	NA	NA	NA	NA	NA
WP_000129889.1|26827_28123_-	type 4b pilus protein PilO2	NA	NA	NA	NA	NA
WP_001034998.1|28143_29763_-	PilN family type IVB pilus formation outer membrane protein	NA	NA	NA	NA	NA
WP_000539685.1|29793_30231_-	type IV pilus biogenesis protein PilM	NA	NA	NA	NA	NA
WP_001170192.1|30235_31306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024174020.1|31462_31798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001330559.1|31914_32232_-	PilI type IV pilus biogenesis protein	NA	NA	NA	NA	NA
WP_000482663.1|32237_33932_-	flotillin family protein	NA	NA	NA	NA	NA
WP_000176497.1|33958_34579_-	YqiJ family protein	NA	NA	NA	NA	NA
WP_000154143.1|34845_35511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000335846.1|35651_36293_-	transcription termination factor NusG	NA	NA	NA	NA	NA
WP_032144930.1|37004_37868_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_000841010.1|38562_38730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001139207.1|38816_39068_+	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_000222775.1|39064_39352_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	49.5	1.7e-19
WP_044162833.1|39610_39907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000517694.1|40558_41161_-	hypothetical protein	NA	NA	NA	NA	NA
41764:41793	attL	CTCAGAAAACGGAAAATAAAGCACGCTAAG	NA	NA	NA	NA
WP_001067855.1|44509_45214_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000027057.1|45798_46659_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001387387.1|46808_47210_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|47256_47961_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000240536.1|48716_49568_+	replication protein	NA	NA	NA	NA	NA
WP_001043265.1|49875_50691_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	3.5e-09
WP_001082319.1|50751_51555_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_009447875.1|51554_52322_+	APH(6)-I family aminoglycoside O-phosphotransferase	NA	NA	NA	NA	NA
WP_000018329.1|53216_54032_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067855.1|54221_54926_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000935452.1|54972_56277_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
60978:61007	attR	CTTAGCGTGCTTTATTTTCCGTTTTCTGAG	NA	NA	NA	NA
>prophage 1
NZ_CP013027	Escherichia coli strain 2009C-3133 plasmid unnamed3, complete sequence	174564	2047	66783	174564	integrase,protease,transposase	Stx2-converting_phage(23.81%)	46	20558:20574	44320:44336
WP_001034103.1|2047_5947_+|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.4	1.6e-237
WP_000993931.1|6481_7132_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	43.1	1.4e-16
WP_000624626.1|7131_7479_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	7.5e-46
WP_000381332.1|7498_9070_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	2.2e-169
WP_000624722.1|10382_10733_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422741.1|10729_11155_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_024177824.1|11562_11886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001366203.1|11912_12419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021512967.1|12485_13205_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_024187164.1|13222_15631_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_109963603.1|16135_16564_+|protease	serine protease	protease	Q9LA58	Enterobacterial_phage	41.7	1.1e-19
WP_049284325.1|16590_16908_-	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	89.3	2.4e-06
WP_029787345.1|17436_18945_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.4	2.8e-44
WP_000977395.1|20479_21271_-	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
20558:20574	attL	TTGGACTTTCGCCAGCC	NA	NA	NA	NA
WP_001298664.1|21277_23248_-	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
WP_001309734.1|23578_24013_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	1.5e-19
WP_021530374.1|24009_24360_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	8.1e-40
WP_071526560.1|26132_26405_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001072359.1|27251_28421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032141192.1|28787_28976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001066941.1|29096_29837_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
WP_000361612.1|30115_31093_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	59.2	3.9e-100
WP_000198533.1|32554_33763_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000019163.1|33743_34016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000949005.1|35773_36688_+	iron/manganese ABC transporter substrate-binding protein SitA	NA	NA	NA	NA	NA
WP_000983710.1|36687_37515_+	iron/manganese ABC transporter ATP-binding protein SitB	NA	A0A1M7XV31	Cedratvirus	27.0	3.6e-14
WP_001101723.1|37511_38369_+	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_000968139.1|38365_39223_+	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_085948620.1|39577_40791_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
WP_085948620.1|41746_42959_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
WP_001318207.1|43091_43472_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	55.0	1.9e-26
WP_000095526.1|43851_45045_-	MFS transporter	NA	NA	NA	NA	NA
44320:44336	attR	GGCTGGCGAAAGTCCAA	NA	NA	NA	NA
WP_000602863.1|45180_46905_+	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_000011908.1|46905_47853_+	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_001015721.1|47852_49595_+	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_000750130.1|49591_50869_+	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_000973517.1|50950_53152_+	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_000190053.1|55232_55712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000238252.1|55829_56279_+	hypothetical protein	NA	A0A222YWI5	Escherichia_phage	67.1	5.0e-42
WP_000715081.1|56913_58416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000925960.1|58641_58833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001238646.1|61437_62604_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	99.7	1.6e-228
WP_000817028.1|62603_63575_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	96.6	8.8e-169
WP_000343071.1|64750_65326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000092896.1|65338_65551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000082155.1|65811_66783_-|transposase	IS110-like element ISEc32 family transposase	transposase	Q75QL1	Wolbachia_phage	32.1	8.3e-26
>prophage 2
NZ_CP013027	Escherichia coli strain 2009C-3133 plasmid unnamed3, complete sequence	174564	105341	156734	174564	tRNA,transposase	Escherichia_phage(19.05%)	51	NA	NA
WP_000911313.1|105341_105740_-|tRNA	tRNA(fMet)-specific endonuclease VapC	tRNA	NA	NA	NA	NA
WP_000450520.1|105739_105967_-	toxin-antitoxin system antitoxin VapB	NA	NA	NA	NA	NA
WP_000986969.1|106048_111319_+	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_000205745.1|111338_112085_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	29.7	1.1e-06
WP_000704512.1|112143_113004_+	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.5	9.7e-10
WP_000139312.1|113106_113664_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_001327131.1|113818_114022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000760078.1|114764_115226_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	33.1	7.4e-17
WP_001300273.1|115990_116140_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_000083835.1|116423_116672_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001365705.1|116918_116993_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000131010.1|116985_117843_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_000079928.1|118756_119026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000969996.1|119022_119304_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001115718.1|119388_119736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194550.1|119753_120344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000343103.1|120343_120598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000198533.1|121029_122238_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000019163.1|122218_122491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001043260.1|122705_123521_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_000793307.1|124311_124656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|125241_125946_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001532073.1|126240_127455_+	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	2.1e-34
WP_001288435.1|127488_128922_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.9	1.4e-106
WP_000275181.1|129281_129644_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000428546.1|129731_130325_+	tetracyline resistance-associated transcriptional repressor TetC	NA	NA	NA	NA	NA
WP_001089064.1|130437_131643_-	tetracycline efflux MFS transporter Tet(B)	NA	NA	NA	NA	NA
WP_000088605.1|131724_132348_+	tetracycline resistance transcriptional repressor TetR(B)	NA	NA	NA	NA	NA
WP_001284954.1|132325_133012_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000460651.1|133019_133406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000562370.1|133398_133719_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_000599533.1|134162_135368_+	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_001352368.1|135733_136942_-|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_001082319.1|137227_138031_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000480968.1|138030_138867_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_072135329.1|138838_139066_-	hypothetical protein	NA	A0A1B0VFY5	Salmonella_phage	88.2	8.7e-11
WP_000018321.1|139202_140018_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.2	4.8e-160
WP_001201005.1|140171_141047_-	acyl-CoA--6-aminopenicillanic acid acyl-transferase	NA	NA	NA	NA	NA
WP_001138082.1|141116_144002_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	39.9	1.1e-190
WP_001067858.1|144287_144992_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000128596.1|145346_146342_+	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
WP_000731968.1|146341_146875_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	34.5	2.0e-21
WP_000027057.1|147603_148464_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001067858.1|148622_149327_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_077870412.1|149366_149669_+	hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	98.1	3.3e-21
WP_000624722.1|149665_150016_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000381332.1|151328_152900_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	2.2e-169
WP_000624626.1|152919_153267_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	7.5e-46
WP_000993931.1|153266_153917_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	43.1	1.4e-16
WP_071887289.1|155394_155469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114078031.1|155520_156734_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	98.0	6.0e-167
