The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013029	Escherichia coli strain 2012C-4227 chromosome, complete genome	5202850	126714	204181	5202850	transposase,tRNA,protease	Vibrio_phage(13.33%)	57	NA	NA
WP_000004476.1|126714_127662_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	39.5	3.2e-06
WP_000114986.1|127676_128186_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.1	1.1e-18
WP_000460680.1|129410_129884_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_032206968.1|129912_130455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001365384.1|130459_131032_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
WP_000451227.1|131036_131855_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_032206969.1|131851_132109_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_001286214.1|132084_132639_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_000078316.1|138520_139279_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.1	1.3e-29
WP_001364972.1|139286_140390_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_106888148.1|140442_141656_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.0	4.2e-168
WP_032208684.1|142898_152570_-	lymphostatin Efa1/LifA	NA	NA	NA	NA	NA
WP_032208683.1|154444_155119_-	type III secretion system effector cysteine methyltransferase NleE	NA	NA	NA	NA	NA
WP_000953023.1|155167_156157_-	type III secretion system effector arginine glycosyltransferase NleB	NA	Q8HAB2	Salmonella_phage	58.5	4.9e-98
WP_032208682.1|156764_158414_-	ShET2/EspL2 family type III secretion system effector toxin	NA	NA	NA	NA	NA
WP_106918773.1|159264_160538_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.3	9.8e-176
WP_000169527.1|160783_161083_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000878219.1|161079_161946_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_032208316.1|163051_163627_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_032208314.1|163663_165361_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_000883400.1|165336_165675_-	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_000961959.1|165790_167092_-	anaerobic C4-dicarboxylate transporter DcuA	NA	NA	NA	NA	NA
WP_000069437.1|167209_168646_-	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_001267448.1|168982_169459_+	membrane protein FxsA	NA	NA	NA	NA	NA
WP_032208312.1|169474_170731_-	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_001026276.1|171007_171301_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000729117.1|171344_172991_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_000558209.1|173128_173482_+	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_032208310.1|173684_174554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032208308.1|174943_175972_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_000257278.1|176013_176580_+	elongation factor P	NA	NA	NA	NA	NA
WP_000977757.1|176631_176757_+	lipoprotein antitoxin entericidin A	NA	NA	NA	NA	NA
WP_000239596.1|176867_177014_+	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
WP_000118482.1|177188_177506_+	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_001238369.1|177502_178036_-	lipocalin Blc	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
WP_001339477.1|178124_179258_-	BlaEC family class C beta-lactamase	NA	NA	NA	NA	NA
WP_001299198.1|179320_179680_-	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_000208757.1|179690_180086_-	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_000829498.1|180096_180831_-	fumarate reductase iron-sulfur protein	NA	NA	NA	NA	NA
WP_001192973.1|180823_182632_-	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
WP_000004771.1|182956_183934_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
WP_032208307.1|184152_185655_+	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_032208306.1|185805_189129_-	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_000934912.1|189150_190119_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_000041970.1|190215_191268_-	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_001295188.1|191362_191908_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
WP_010723271.1|192770_192824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001294219.1|192806_193946_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_072097076.1|193944_195492_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_000981977.1|195463_195925_+|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
WP_032208305.1|195943_197278_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_001122503.1|197287_199135_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	4.4e-60
WP_032208303.1|199127_200078_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051883.1|200163_200472_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000460360.1|200548_201829_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000312488.1|201914_203174_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|203176_204181_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
>prophage 2
NZ_CP013029	Escherichia coli strain 2012C-4227 chromosome, complete genome	5202850	399503	483431	5202850	tRNA,terminase,integrase,head,capsid,protease,holin,tail	Stx2-converting_phage(43.42%)	97	392129:392144	462289:462304
392129:392144	attL	GCGGCGAAAGCGGTGA	NA	NA	NA	NA
WP_001218294.1|399503_400727_+|integrase	site-specific integrase	integrase	A0A291AWU1	Escherichia_phage	98.0	1.3e-233
WP_001400035.1|403250_404069_-	hypothetical protein	NA	A0A0H4IU61	Shigella_phage	96.5	1.7e-120
WP_155701557.1|404065_404398_-	hypothetical protein	NA	A0A0P0ZBM8	Stx2-converting_phage	98.2	4.9e-63
WP_001289923.1|404582_405353_-	ead/Ea22-like family protein	NA	H6WZG2	Escherichia_phage	97.7	4.0e-140
WP_000763383.1|405349_405571_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001447688.1|405669_405951_-	hypothetical protein	NA	Q08J56	Stx2-converting_phage	100.0	6.5e-48
WP_000548528.1|405961_406153_-	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	100.0	5.6e-27
WP_000682304.1|406125_406308_-	DUF1317 domain-containing protein	NA	A0A0P0ZD61	Stx2-converting_phage	100.0	7.4e-29
WP_000186781.1|406304_406985_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCQ7	Stx2-converting_phage	99.1	6.0e-132
WP_000100847.1|406981_407767_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995407.1|407772_408069_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	5.2e-48
WP_000361826.1|408144_408288_-	host cell division inhibitory peptide Kil	NA	A0A0P0ZC96	Stx2-converting_phage	97.9	3.5e-18
WP_001198858.1|408280_408421_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	3.3e-21
WP_000065373.1|408493_408862_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	99.2	7.6e-65
WP_000095081.1|409042_409666_-	hypothetical protein	NA	A0A2D1GLY1	Escherichia_phage	96.6	2.8e-107
WP_000198445.1|409727_410111_-	hypothetical protein	NA	Q08J47	Stx2-converting_phage	100.0	3.9e-64
WP_000687675.1|410618_411023_-	hypothetical protein	NA	A0A0P0ZDD3	Stx2-converting_phage	100.0	1.6e-68
WP_001082382.1|411019_411676_-	transcriptional regulator	NA	A0A0P0ZCT8	Stx2-converting_phage	100.0	2.6e-116
WP_000866443.1|411672_411960_-	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	100.0	1.6e-49
WP_000428098.1|412096_412801_-	helix-turn-helix transcriptional regulator	NA	A0A0P0ZE37	Stx2-converting_phage	100.0	1.1e-133
WP_000064148.1|412914_413148_+	hypothetical protein	NA	A0A0P0ZDD7	Stx2-converting_phage	100.0	8.0e-36
WP_000438541.1|413286_413583_+	hypothetical protein	NA	C1JJ56	Enterobacteria_phage	100.0	8.9e-48
WP_032208536.1|414483_415185_+	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	98.7	6.4e-129
WP_000145907.1|415181_415472_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	99.0	1.6e-46
WP_001000127.1|415542_415821_+	hypothetical protein	NA	Q9ZWY1	Enterobacteria_phage	100.0	3.4e-49
WP_000103679.1|415953_416169_+	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
WP_001281772.1|416179_416416_+	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_000814576.1|416372_416819_+	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	100.0	2.4e-81
WP_000153280.1|416815_417343_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_001254256.1|417339_417522_+	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000211422.1|417796_418531_+	phage antirepressor Ant	NA	A0A0N7C203	Escherichia_phage	100.0	1.9e-123
WP_001004018.1|418605_419328_+	DNA-binding protein	NA	B6DZ83	Enterobacteria_phage	100.0	3.5e-130
WP_001107998.1|419327_419933_+	recombination protein NinG	NA	B6DZ84	Enterobacteria_phage	100.0	6.6e-98
WP_000144759.1|419929_420124_+	protein ninH	NA	Q6H9W6	Enterobacteria_phage	100.0	8.4e-31
WP_001204852.1|420116_420551_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	100.0	3.6e-82
WP_000691354.1|421057_422005_+	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_000752026.1|422014_422284_+	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_032362364.1|422783_424634_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.5	0.0e+00
WP_000411802.1|425081_425288_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000731236.1|425292_425637_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_000992166.1|425687_426221_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	97.7	5.6e-101
WP_001056806.1|426491_427061_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539794.1|427060_427207_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	95.8	1.7e-15
WP_012816791.1|427434_427620_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095749.1|428044_428272_-	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
WP_001303046.1|428313_428679_+	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_000958390.1|428967_429531_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	98.9	1.5e-88
WP_001365116.1|429527_431189_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.8	0.0e+00
WP_060552799.1|431252_433190_+|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	98.6	0.0e+00
WP_001063096.1|433234_433456_+	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
WP_000125988.1|435982_436309_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|436318_436669_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|436665_437112_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133391.1|437108_437453_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_001275510.1|437511_438228_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	1.1e-128
WP_001030063.1|438233_438608_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_122993099.1|438703_438913_+	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	98.6	3.3e-33
WP_032207138.1|438960_442203_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	92.7	0.0e+00
WP_000807944.1|442195_442537_+|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	98.2	1.2e-61
WP_001357740.1|442536_443235_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_000194767.1|443245_443989_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	3.8e-148
WP_122994371.1|443934_444567_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	98.1	2.5e-103
WP_060552800.1|444805_448219_+	host specificity protein J	NA	A0A0P0ZEQ8	Stx2-converting_phage	85.8	0.0e+00
WP_001230466.1|448288_448888_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.0	2.0e-110
WP_015740448.1|448952_450266_+|tail	tail fiber protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.9	2.7e-80
WP_001101699.1|450267_450537_+|tail	phage tail protein	tail	Q6H9S8	Enterobacteria_phage	98.9	1.9e-44
WP_001121225.1|450821_451472_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_001217548.1|452064_452325_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	95.3	8.1e-37
WP_000202564.1|452544_454131_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
WP_001295748.1|454523_455129_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|455255_455417_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001299799.1|455538_456612_+	patatin family protein	NA	NA	NA	NA	NA
WP_000563058.1|456608_457391_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_001088405.1|457503_458367_-	YjjW family glycine radical enzyme activase	NA	NA	NA	NA	NA
WP_001143257.1|458338_459889_-	YjjI family glycine radical enzyme	NA	NA	NA	NA	NA
WP_001295412.1|460146_460926_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_032205954.1|461052_462375_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
462289:462304	attR	GCGGCGAAAGCGGTGA	NA	NA	NA	NA
WP_032205953.1|462426_463650_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_000224877.1|463729_464449_+	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_000105889.1|464904_465921_-	lipoate--protein ligase LplA	NA	NA	NA	NA	NA
WP_000124615.1|465948_466593_-	YtjB family periplasmic protein	NA	NA	NA	NA	NA
WP_032205952.1|466698_467667_+	phosphoserine phosphatase	NA	NA	NA	NA	NA
WP_001029697.1|467715_469098_+	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_000093810.1|469118_470351_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	1.6e-82
WP_000046749.1|470657_472325_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000409459.1|472535_474473_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_000068679.1|474562_474889_+	trp operon repressor	NA	NA	NA	NA	NA
WP_032205957.1|475035_475548_-	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_032205951.1|475599_476247_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
WP_000371666.1|476243_477113_-	MDR efflux pump AcrAB transcriptional activator RobA	NA	NA	NA	NA	NA
WP_000875487.1|477323_477797_+	protein CreA	NA	NA	NA	NA	NA
WP_001188659.1|477809_478499_+	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
WP_001219614.1|478498_479923_+	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.4	1.6e-09
WP_032205950.1|479980_481333_+	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_001194358.1|481392_482109_-	two-component system response regulator ArcA	NA	NA	NA	NA	NA
WP_001303782.1|482204_482345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001223181.1|482744_483431_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP013029	Escherichia coli strain 2012C-4227 chromosome, complete genome	5202850	975433	1034227	5202850	transposase,tRNA,tail,protease	Escherichia_phage(30.43%)	51	NA	NA
WP_001344277.1|975433_976057_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_001110573.1|976027_976714_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_032208352.1|976710_979125_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001320180.1|983743_984004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001157976.1|985235_986330_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_032208349.1|986398_987325_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_000776388.1|987554_988037_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000141276.1|988114_988930_+	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_032208406.1|989019_990801_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	26.9	6.0e-38
WP_032206999.1|990813_991590_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_032208347.1|992736_994152_+	putative allantoin permease	NA	NA	NA	NA	NA
WP_001302767.1|995628_996930_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_000706344.1|996951_998097_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.9	1.8e-48
WP_000540946.1|998324_999110_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_032208342.1|1000376_1001426_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_032208341.1|1001740_1003408_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_032208340.1|1003417_1004677_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_001325209.1|1004687_1005503_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000855389.1|1005499_1006393_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000815537.1|1006529_1007597_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_032208338.1|1007593_1008103_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_032208336.1|1008220_1008943_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000256002.1|1008945_1009440_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_032208334.1|1009613_1010999_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143552.1|1011034_1011556_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|1011663_1011876_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|1011877_1012744_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|1013224_1013767_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988364.1|1013986_1014679_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_032208333.1|1014709_1017319_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_032208332.1|1018865_1019498_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
WP_000088311.1|1020547_1020850_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_060552805.1|1020885_1021704_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.5e-65
WP_106888148.1|1022012_1023225_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.0	4.2e-168
WP_071887448.1|1023228_1023345_-	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	84.4	1.0e-07
WP_060552806.1|1023335_1024016_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCQ7	Stx2-converting_phage	99.1	1.0e-131
WP_000100847.1|1024012_1024798_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995409.1|1024803_1025100_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
WP_000372937.1|1025175_1025319_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001198861.1|1025287_1025452_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_047088220.1|1025524_1025893_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	98.4	2.2e-64
WP_032207130.1|1026088_1026538_-	hypothetical protein	NA	I6RSN8	Salmonella_phage	88.6	1.3e-69
WP_032207131.1|1026596_1026869_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	98.9	9.7e-41
WP_032208417.1|1028508_1028970_-	hypothetical protein	NA	G9L674	Escherichia_phage	99.3	3.8e-77
WP_000885926.1|1029037_1029379_-	DUF3024 domain-containing protein	NA	G9L675	Escherichia_phage	99.1	2.5e-62
WP_001302016.1|1029388_1030084_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_000067727.1|1030158_1030374_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_032208418.1|1030515_1030818_+	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	97.8	3.3e-42
WP_078164212.1|1032779_1033118_+	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	41.9	3.7e-05
WP_129014751.1|1033197_1033857_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_032207501.1|1033921_1034227_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
>prophage 4
NZ_CP013029	Escherichia coli strain 2012C-4227 chromosome, complete genome	5202850	1260147	1270077	5202850	transposase,tail,holin,integrase	Enterobacteria_phage(50.0%)	9	1260060:1260074	1274167:1274181
1260060:1260074	attL	GCTTTTTTATACTAA	NA	NA	NA	NA
WP_064717027.1|1260147_1261029_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	99.7	9.5e-162
WP_001235472.1|1262282_1262906_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001302581.1|1263158_1263902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|1263987_1264146_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_032208531.1|1264768_1264984_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	5.5e-31
WP_000088311.1|1265394_1265697_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_060552815.1|1265732_1266551_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.9	5.9e-65
WP_060552816.1|1266578_1266734_+|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	100.0	1.1e-17
WP_085972493.1|1268803_1270077_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	1.5e-176
1274167:1274181	attR	GCTTTTTTATACTAA	NA	NA	NA	NA
>prophage 5
NZ_CP013029	Escherichia coli strain 2012C-4227 chromosome, complete genome	5202850	1389662	1469011	5202850	tRNA,integrase,portal,terminase,head,plate,transposase,protease,capsid,holin,lysis,tail	Escherichia_phage(36.21%)	80	1401978:1401994	1478508:1478524
WP_032208065.1|1389662_1390901_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	52.7	1.8e-126
WP_001206970.1|1391319_1391529_+	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	67.9	2.2e-16
WP_032208063.1|1391877_1392057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106918783.1|1392462_1392789_+	host cell division inhibitor Icd-like protein	NA	A0A1C9IHV9	Salmonella_phage	55.7	1.7e-07
WP_032208062.1|1392781_1393102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032208060.1|1393108_1393408_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001475690.1|1395505_1395751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032208058.1|1395747_1396158_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_024166342.1|1396168_1396441_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001475693.1|1396566_1396791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001475695.1|1397087_1398245_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	1.6e-137
WP_001475696.1|1398300_1398858_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	64.1	4.1e-62
WP_032208055.1|1398859_1400071_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	79.2	5.6e-189
WP_016241300.1|1400067_1400406_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	51.8	2.5e-30
WP_000134111.1|1400402_1400699_+	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	65.3	4.0e-32
WP_001145908.1|1400698_1401139_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	67.8	7.8e-56
WP_024166058.1|1401122_1401305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113648.1|1401427_1401784_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
1401978:1401994	attL	CCGTGGCAGCAGTTCGC	NA	NA	NA	NA
WP_032208053.1|1403441_1403723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000520781.1|1404617_1404938_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_032208047.1|1404968_1407245_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.4	2.1e-165
WP_001040187.1|1407989_1408208_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_032208045.1|1408492_1409197_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202188.1|1409238_1410960_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	1.9e-20
WP_032208042.1|1410960_1412727_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.0	1.6e-22
WP_000537418.1|1412849_1413815_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_000228473.1|1414358_1414853_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_032208039.1|1414987_1418821_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.1e-86
WP_001295343.1|1418975_1419587_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067756.1|1419597_1420941_+	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	3.6e-80
WP_032208036.1|1421031_1422324_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	8.6e-95
WP_000850303.1|1422561_1425006_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
WP_000213098.1|1425016_1425634_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_032208034.1|1426533_1427160_-	hydrolase	NA	NA	NA	NA	NA
WP_000109295.1|1427473_1428622_+	MFS transporter	NA	NA	NA	NA	NA
WP_000918506.1|1428831_1430262_+	amino acid permease	NA	NA	NA	NA	NA
WP_032208033.1|1430262_1431171_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001190367.1|1431270_1431861_+	NAD(P)H oxidoreductase	NA	NA	NA	NA	NA
WP_000067977.1|1431942_1432740_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	1.3e-21
WP_032208032.1|1432771_1433767_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	99.4	6.0e-189
WP_024182500.1|1433860_1434160_-	helix-turn-helix transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	79.8	3.8e-38
WP_032208031.1|1434628_1435225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032208029.1|1435227_1435434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129014754.1|1435505_1436778_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	97.3	5.4e-174
WP_032208026.1|1437036_1437537_+	hypothetical protein	NA	M1SV55	Escherichia_phage	98.8	3.8e-91
WP_032208023.1|1437600_1437825_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	97.3	8.8e-32
WP_001277958.1|1437824_1438127_+	DUF5405 family protein	NA	U5N0U2	Enterobacteria_phage	98.0	5.0e-46
WP_001113264.1|1438126_1438351_+	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_032208021.1|1438347_1438623_+	DUF5405 family protein	NA	M1TAP2	Escherichia_phage	97.8	2.5e-44
WP_032208018.1|1440905_1441349_+	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	93.9	3.1e-76
WP_085972493.1|1441482_1442756_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	1.5e-176
WP_001620979.1|1442964_1443906_-	hypothetical protein	NA	Q2P9W7	Enterobacteria_phage	81.5	5.4e-147
WP_032206254.1|1444332_1445367_-|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.4	9.3e-201
WP_032206253.1|1445366_1447139_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.2	0.0e+00
WP_032206252.1|1447312_1448167_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MI4	Enterobacteria_phage	95.1	2.4e-130
WP_032206251.1|1448225_1449299_+|capsid	phage major capsid protein, P2 family	capsid	Q94MK2	Enterobacteria_phage	99.4	2.8e-200
WP_032206249.1|1449302_1450046_+|terminase	terminase endonuclease subunit	terminase	Q94MK1	Enterobacteria_phage	99.6	3.6e-122
WP_032206247.1|1450145_1450652_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	99.4	1.0e-88
WP_032206246.1|1450651_1450855_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	98.5	4.4e-30
WP_000123123.1|1450858_1451140_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001530534.1|1451139_1451637_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	9.0e-93
WP_032206243.1|1451651_1452086_+	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	87.5	7.2e-54
WP_032206242.1|1452073_1452499_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7LDJ6	Escherichia_phage	95.7	3.0e-65
WP_001300730.1|1452470_1452644_+	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_032206241.1|1452606_1453074_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	99.4	3.0e-82
WP_032206240.1|1453066_1453519_+	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	97.3	3.8e-74
WP_024245775.1|1453590_1454376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001093707.1|1454459_1455095_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	99.5	4.1e-114
WP_032206239.1|1455091_1455439_+|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	98.3	5.5e-57
WP_032206238.1|1455443_1456352_+|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.7	7.5e-162
WP_032206237.1|1456344_1456875_+|tail	phage tail protein I	tail	A0A0F7LDF3	Escherichia_phage	98.9	1.9e-101
WP_032206236.1|1456885_1459204_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	67.1	3.7e-213
WP_032206234.1|1459207_1459735_+|tail	tail fiber assembly protein	tail	U5N0T1	Enterobacteria_phage	96.0	5.2e-91
WP_000257039.1|1460016_1461360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032206231.1|1461618_1462809_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	1.4e-224
WP_001251408.1|1462821_1463340_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|1463396_1463672_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|1463704_1463824_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_000468308.1|1466191_1466410_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001292815.1|1466728_1469011_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.4	1.3e-162
1478508:1478524	attR	CCGTGGCAGCAGTTCGC	NA	NA	NA	NA
>prophage 6
NZ_CP013029	Escherichia coli strain 2012C-4227 chromosome, complete genome	5202850	1532160	1597460	5202850	terminase,integrase,portal,head,protease,capsid,holin,tail	Enterobacteria_phage(36.96%)	77	1547242:1547301	1592723:1592787
WP_032206208.1|1532160_1533921_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877161.1|1534106_1534559_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000750416.1|1534634_1535675_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288710.1|1536031_1536541_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_000839153.1|1536759_1537389_+	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_074433556.1|1537351_1539514_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261235.1|1539523_1539970_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_032206206.1|1540092_1542147_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
WP_000424181.1|1542178_1542637_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847791.1|1542732_1543395_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_001343235.1|1543567_1543981_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001295356.1|1544025_1544343_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_032206204.1|1544400_1545591_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000048252.1|1545685_1545964_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904442.1|1545960_1546290_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375138.1|1546380_1547040_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	54.9	5.2e-48
1547242:1547301	attL	TTATTTGGCGGAAGCGCAGAGATTCGAACTCTGGAACCCTTTCGGGTCGCCGGTTTTCAA	NA	NA	NA	NA
WP_032206255.1|1547447_1548257_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	53.6	1.1e-76
WP_000273151.1|1548444_1548687_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_032206202.1|1548754_1551229_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	8.5e-59
WP_001098307.1|1551322_1551514_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000413705.1|1551510_1551699_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000373334.1|1552411_1552858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000367377.1|1552956_1553109_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	1.9e-06
WP_021568727.1|1553383_1553674_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000108762.1|1553673_1553865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021568728.1|1553882_1554383_-	helix-turn-helix transcriptional regulator	NA	A0A0U2QW76	Escherichia_phage	54.5	1.8e-16
WP_001048459.1|1554490_1554754_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000693918.1|1554750_1555176_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262367.1|1555247_1556318_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.7	3.8e-64
WP_032206198.1|1556358_1556781_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.9	5.7e-64
WP_032206196.1|1556838_1557198_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	8.0e-59
WP_032206194.1|1557243_1557456_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	88.6	1.7e-32
WP_032206192.1|1557491_1558325_+	hypothetical protein	NA	Q1MVF7	Enterobacteria_phage	65.7	5.5e-26
WP_001278459.1|1558434_1558539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000128514.1|1558726_1558939_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	9.6e-28
WP_001219082.1|1559183_1559543_+	helix-turn-helix transcriptional regulator	NA	L7TKV7	Pseudomonas_virus	50.9	7.1e-23
WP_000284536.1|1559545_1560022_+	ImmA/IrrE family metallo-endopeptidase	NA	L7THB5	Pseudomonas_virus	33.3	1.7e-16
WP_032207160.1|1560454_1560733_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	45.3	6.3e-11
WP_032207158.1|1560734_1561793_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.6	1.1e-90
WP_032207155.1|1561793_1562174_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	3.2e-34
WP_000762928.1|1562170_1562992_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
WP_001344632.1|1563588_1563720_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	85.7	5.2e-08
WP_053888468.1|1564162_1566013_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.0	0.0e+00
WP_000411804.1|1566458_1566665_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	5.3e-31
WP_000138558.1|1566920_1567193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003118.1|1567352_1567886_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000675931.1|1568106_1568220_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|1568441_1568627_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|1569154_1569469_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001300236.1|1569550_1569775_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
WP_000235436.1|1570177_1570687_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_032207005.1|1570658_1572587_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.0	6.1e-262
WP_000258991.1|1572570_1572777_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	60.0	4.2e-12
WP_001430223.1|1572773_1574366_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	1.1e-184
WP_001254039.1|1574355_1575861_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	1.6e-100
WP_000256818.1|1575897_1576245_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
WP_000522630.1|1576302_1577331_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.3	1.3e-114
WP_000201528.1|1577382_1577757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204544.1|1577749_1578103_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	2.5e-41
WP_032207006.1|1578117_1578693_+|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	58.3	6.4e-50
WP_032207007.1|1578689_1579085_+	hypothetical protein	NA	A0A2R9YJI2	Escherichia_phage	91.6	1.3e-65
WP_001342267.1|1579092_1579833_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	1.0e-129
WP_000479169.1|1579848_1580271_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	3.1e-70
WP_000459457.1|1580252_1580687_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000847347.1|1583237_1583567_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	3.6e-58
WP_032207009.1|1583566_1584265_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	1.2e-132
WP_032207010.1|1584270_1585014_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_071887464.1|1584950_1585583_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	98.6	7.2e-95
WP_032207011.1|1585643_1589039_+	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	88.8	0.0e+00
WP_047617645.1|1589106_1589706_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	99.0	6.3e-109
WP_060552821.1|1589770_1590976_+|tail	phage tail protein	tail	B6DZB7	Enterobacteria_phage	95.8	1.9e-80
WP_001023379.1|1590977_1591247_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	95.5	8.7e-42
WP_047618562.1|1591372_1592125_-	molecular chaperone Tir	NA	NA	NA	NA	NA
WP_001058323.1|1593241_1594360_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
1592723:1592787	attR	TTATTTGGCGGAAGCGCAGAGATTCGAACTCTGGAACCCTTTCGGGTCGCCGGTTTTCAAGACCG	NA	NA	NA	NA
WP_000107384.1|1594356_1596150_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001186424.1|1596168_1596876_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003671.1|1596872_1597460_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
>prophage 7
NZ_CP013029	Escherichia coli strain 2012C-4227 chromosome, complete genome	5202850	1755932	1836781	5202850	tRNA,terminase,portal,integrase,transposase,protease,holin,tail	Enterobacteria_phage(39.44%)	92	1783907:1783923	1837701:1837717
WP_001113310.1|1755932_1756400_+	DUF2335 domain-containing protein	NA	A0A1B0YZW3	Pseudomonas_phage	35.0	4.4e-09
WP_000948454.1|1757375_1757852_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_000711018.1|1757976_1758300_+	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000693928.1|1758283_1758709_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_032206333.1|1758780_1759851_+	phage replisome organizer	NA	A0A088CD36	Shigella_phage	65.7	1.3e-64
WP_032206334.1|1759857_1760604_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.2	1.1e-113
WP_032206335.1|1760625_1761351_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	63.2	2.0e-77
WP_001118161.1|1761366_1761762_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	1.0e-30
WP_001278450.1|1762519_1762624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|1762812_1763025_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_032206337.1|1763144_1763489_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	98.2	1.4e-55
WP_032206341.1|1763610_1763883_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	51.5	5.5e-12
WP_032207210.1|1764945_1765320_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.5	1.3e-35
WP_047619233.1|1765316_1766138_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	57.5	5.1e-77
WP_000143458.1|1769103_1769283_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_060552830.1|1769323_1769614_+	DUF826 domain-containing protein	NA	A0A0P0ZC09	Stx2-converting_phage	88.5	2.9e-19
WP_000284518.1|1769690_1769906_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_074433498.1|1769910_1770900_+	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	64.1	7.5e-107
WP_032207060.1|1770936_1771473_+	lysozyme	NA	G9L6J6	Escherichia_phage	94.9	4.5e-98
WP_012816791.1|1771990_1772176_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_032207063.1|1772261_1772486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000373407.1|1772905_1773382_+	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
WP_001077625.1|1773378_1775502_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000102414.1|1775498_1775711_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	97.1	1.1e-28
WP_060552831.1|1775710_1777213_+|portal	phage portal protein	portal	Q8VNN6	Enterobacteria_phage	99.4	6.5e-288
WP_129014764.1|1777202_1779182_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	98.9	0.0e+00
WP_001097065.1|1779269_1779596_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281350.1|1779588_1779870_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_000974966.1|1779872_1780496_+	hypothetical protein	NA	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_000682718.1|1780508_1780907_+	hypothetical protein	NA	Q9EYD7	Enterobacteria_phage	99.2	1.7e-70
WP_032208644.1|1780914_1781664_+|tail	phage tail protein	tail	S5M7Q5	Escherichia_phage	94.4	4.8e-130
WP_000479056.1|1781679_1782102_+|tail	phage minor tail protein G	tail	S5MQJ3	Escherichia_phage	98.6	4.3e-72
WP_000532075.1|1782128_1782437_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	99.0	3.0e-54
WP_060552832.1|1782480_1785126_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.2	0.0e+00
1783907:1783923	attL	AAGAGCTGACAGGTAAA	NA	NA	NA	NA
WP_000847304.1|1785122_1785452_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_060552833.1|1785451_1786150_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	8.9e-131
WP_096913390.1|1786635_1786770_-	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	84.4	1.3e-06
WP_106888148.1|1786735_1787949_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.0	4.2e-168
WP_123007084.1|1788162_1788795_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	93.3	1.0e-104
WP_060552835.1|1789040_1792520_+	host specificity protein J	NA	Q687E8	Enterobacteria_phage	95.0	0.0e+00
WP_060552836.1|1792586_1793186_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	95.5	2.9e-106
WP_071887548.1|1793250_1794366_+|tail	phage tail protein	tail	B6DZB7	Enterobacteria_phage	93.6	1.8e-80
WP_001023446.1|1794367_1794637_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	97.8	1.2e-43
WP_047088273.1|1795091_1796453_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	40.2	1.5e-49
WP_106888148.1|1796548_1797762_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.0	4.2e-168
WP_000799400.1|1798129_1798993_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_032206984.1|1798976_1800113_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
WP_000359446.1|1800362_1801589_+	peptidase T	NA	NA	NA	NA	NA
WP_060552838.1|1801637_1802759_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_032206982.1|1802834_1804295_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265481.1|1804294_1804966_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|1805134_1806505_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001297479.1|1806508_1807150_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_032206981.1|1807185_1808292_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|1808345_1808807_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_032206979.1|1808816_1809470_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_032206978.1|1809641_1810892_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	98.1	2.5e-22
WP_000741335.1|1810993_1812136_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	100.0	3.6e-206
WP_000088653.1|1812125_1812362_-	excisionase	NA	NA	NA	NA	NA
WP_106918786.1|1812559_1813790_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	98.0	1.7e-172
WP_032207484.1|1813878_1814079_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	98.5	4.2e-33
WP_000763385.1|1814126_1814345_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
WP_001386642.1|1814443_1814725_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_032207486.1|1814735_1815293_-	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	61.7	7.8e-61
WP_000682319.1|1815285_1815447_-	DUF1317 family protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	9.1e-23
WP_032207488.1|1815443_1816124_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.1	7.9e-132
WP_001438244.1|1816120_1816906_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.6	1.4e-148
WP_000995409.1|1816911_1817208_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
WP_000372937.1|1817283_1817427_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001198861.1|1817395_1817560_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_047088220.1|1817632_1818001_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	98.4	2.2e-64
WP_032207130.1|1818196_1818646_-	hypothetical protein	NA	I6RSN8	Salmonella_phage	88.6	1.3e-69
WP_032207131.1|1818704_1818977_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	98.9	9.7e-41
WP_001278657.1|1819418_1820039_-	hypothetical protein	NA	A4KWT4	Enterobacteria_phage	99.5	6.2e-51
WP_001207141.1|1820035_1820470_-	hypothetical protein	NA	A4KWT5	Enterobacteria_phage	99.3	6.0e-77
WP_096913377.1|1820520_1821216_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	99.6	4.3e-133
WP_000067727.1|1821290_1821506_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_106918787.1|1821629_1822842_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.6	3.5e-167
WP_071887470.1|1822923_1823343_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	92.0	1.7e-68
WP_032206875.1|1823462_1824353_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_032206874.1|1824371_1824878_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001546534.1|1824914_1825415_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000134810.1|1825493_1825676_-	general stress protein	NA	NA	NA	NA	NA
WP_129014756.1|1826173_1826842_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937500.1|1826898_1827204_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_060552842.1|1827387_1828872_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_032207030.1|1829058_1830012_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_000361110.1|1830510_1831095_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_074433656.1|1832036_1832189_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	98.0	2.4e-20
WP_001307134.1|1832291_1832615_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	8.0e-42
WP_032141808.1|1833147_1833258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106888170.1|1835567_1836781_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.6	1.6e-167
1837701:1837717	attR	AAGAGCTGACAGGTAAA	NA	NA	NA	NA
>prophage 8
NZ_CP013029	Escherichia coli strain 2012C-4227 chromosome, complete genome	5202850	1867966	1979486	5202850	tRNA,integrase,portal,head,transposase,protease,holin,tail	Escherichia_phage(23.91%)	114	1920504:1920563	1959776:1961086
WP_032208512.1|1867966_1868551_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000823885.1|1868828_1869107_+	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_001033352.1|1869161_1870841_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_001298109.1|1870965_1871913_-	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_001260333.1|1872063_1872915_-	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_001130692.1|1872914_1873538_-	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_000173200.1|1873751_1875008_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_024226915.1|1875049_1876132_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
WP_000456461.1|1876131_1876965_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000200378.1|1876961_1877354_+	SirB family protein	NA	NA	NA	NA	NA
WP_001257044.1|1877357_1878167_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000811065.1|1878202_1879057_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
WP_000170926.1|1879205_1879313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000170965.1|1879741_1879849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295620.1|1880253_1881354_-	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_001146440.1|1881623_1881854_+	putative cation transport regulator ChaB	NA	NA	NA	NA	NA
WP_001336325.1|1882011_1882707_+	glutathione-specific gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_001169669.1|1882750_1883104_-	DsrE/F sulfur relay family protein YchN	NA	NA	NA	NA	NA
WP_000086217.1|1883288_1884683_+	inverse autotransporter invasin YchO	NA	NA	NA	NA	NA
WP_000070491.1|1884683_1885334_-	two-component system response regulator NarL	NA	NA	NA	NA	NA
WP_000918073.1|1885326_1887123_-	nitrate/nitrite two-component system sensor histidine kinase NarX	NA	NA	NA	NA	NA
WP_000019827.1|1887461_1888853_+	nitrate transporter NarK	NA	NA	NA	NA	NA
WP_060552846.1|1889368_1893112_+	nitrate reductase subunit alpha	NA	NA	NA	NA	NA
WP_000702660.1|1893108_1894647_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
WP_000571699.1|1894643_1895354_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_001160110.1|1895353_1896031_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000555849.1|1896637_1897480_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_001307143.1|1897529_1897988_-	YchJ family protein	NA	NA	NA	NA	NA
WP_001295622.1|1898100_1899006_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_000193447.1|1899097_1900111_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_000718995.1|1900312_1901221_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_001287378.1|1901364_1901778_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000068079.1|1902382_1903000_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	1.3e-53
WP_000301651.1|1903301_1905977_-	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_000616554.1|1906453_1907101_+	NAAT family transporter YchE	NA	NA	NA	NA	NA
WP_001211521.1|1907258_1907555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032208522.1|1907838_1909470_+	oligopeptide ABC transporter substrate-binding protein OppA	NA	NA	NA	NA	NA
WP_000911112.1|1909555_1910476_+	oligopeptide ABC transporter permease OppB	NA	NA	NA	NA	NA
WP_000979648.1|1910490_1911399_+	oligopeptide ABC transporter permease OppC	NA	NA	NA	NA	NA
WP_032208507.1|1911410_1912424_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	9.0e-15
WP_000994905.1|1912420_1913425_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G9BWD6	Planktothrix_phage	35.6	8.0e-24
WP_000366959.1|1913477_1913807_-	YciU family protein	NA	NA	NA	NA	NA
WP_032208505.1|1913841_1915302_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_001309467.1|1915444_1915618_+	YciY family protein	NA	NA	NA	NA	NA
WP_001299682.1|1915672_1916926_-	voltage-gated potassium channel protein	NA	NA	NA	NA	NA
WP_000967595.1|1917225_1917522_-	YciI family protein	NA	NA	NA	NA	NA
WP_050439363.1|1918092_1918446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000447713.1|1919114_1919666_+	recombinase family protein	NA	G8I4U3	Mycobacterium_phage	39.0	4.7e-26
1920504:1920563	attL	TGAACCGCCCCGGGAATCCTGGAGACTAAACTTCCTGAGAAAGAGGTAAACAGGATGACT	NA	NA	NA	NA
WP_106888077.1|1920557_1921770_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
WP_032206800.1|1922225_1922945_+	TonB system transport protein TonB	NA	NA	NA	NA	NA
WP_032206794.1|1922984_1923383_-	acyl-CoA thioester hydrolase YciA	NA	NA	NA	NA	NA
WP_032206795.1|1923487_1924027_-	septation protein A	NA	NA	NA	NA	NA
WP_000028540.1|1924056_1924800_-	UPF0259 family protein	NA	NA	NA	NA	NA
WP_000737224.1|1925156_1925795_+	outer membrane protein OmpW	NA	NA	NA	NA	NA
WP_000336626.1|1926191_1927010_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	9.0e-66
WP_000088311.1|1927045_1927348_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_060552847.1|1927421_1927943_+|portal	portal protein	portal	A0A0P0ZCZ4	Stx2-converting_phage	96.4	1.5e-74
WP_000125990.1|1927939_1928266_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_001007905.1|1928275_1928626_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000878219.1|1928904_1929771_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_072097498.1|1929767_1929998_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_047619061.1|1931168_1931438_+|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	98.9	6.4e-45
WP_000767050.1|1931658_1932201_+	hypothetical protein	NA	Q9LA55	Enterobacteria_phage	68.6	8.4e-52
WP_106409363.1|1932145_1932340_+	hypothetical protein	NA	A0A2R2Z347	Escherichia_phage	87.2	1.1e-09
WP_032207133.1|1932682_1934005_-	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	83.9	4.6e-221
WP_000878219.1|1934756_1935623_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_000169527.1|1935619_1935919_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000935464.1|1936106_1936745_+	hypothetical protein	NA	A5LH48	Enterobacteria_phage	76.9	5.4e-82
WP_000938103.1|1936810_1937380_+	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_001303943.1|1938547_1938826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001414184.1|1940563_1940710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032207081.1|1940846_1941494_-	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_032207080.1|1941677_1942268_+	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_101967138.1|1945121_1945556_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	56.8	6.3e-42
WP_000088311.1|1945636_1945939_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000336626.1|1945974_1946793_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	9.0e-66
WP_000199475.1|1947991_1948180_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449175.1|1948176_1948365_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001331716.1|1948765_1948930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032208669.1|1948933_1949152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024182289.1|1949243_1949444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064765773.1|1949855_1950500_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	25.9	8.0e-09
WP_001261756.1|1950599_1950827_+	cell division protein	NA	NA	NA	NA	NA
WP_000917749.1|1951492_1951690_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	3.6e-29
WP_032208672.1|1951840_1952917_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	87.3	3.8e-181
WP_001443281.1|1953510_1953837_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	62.9	5.1e-36
WP_000143458.1|1956211_1956391_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|1956431_1956677_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_001072901.1|1956754_1956970_+|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_047618934.1|1956974_1957508_+	lysozyme	NA	A0A2R2Z343	Escherichia_phage	98.9	1.5e-101
WP_001056885.1|1957782_1958352_+	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	100.0	1.8e-105
WP_000455406.1|1958351_1958501_+	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
WP_106888077.1|1958567_1959781_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
WP_129014757.1|1960041_1960227_+	hypothetical protein	NA	A0A1U9AJA4	Stx1_converting_phage	78.7	4.9e-20
WP_001302717.1|1960752_1961067_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_032208325.1|1961148_1961373_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	5.0e-19
1959776:1961086	attR	AGTCATCCTGTTTACCTCTTTCTCAGGAAGTTTAGTCTCCAGGATTCCCGGGGCGGTTCAGTGTGTGGTGATTATTGTCCTGCTGGTAGCCTGTGGTGCGCTTAGTCTGGGGCTGAATCATTACCGCGATAACGCCATAACCTACAAAGAGCAGCGCGATAAAAAAGTCAGTGAGCTGGAGCTGGCAAATGCAACCATTACTGATATGCAGCAGCGCCAGCGTGATGTTGCTGCACTTGATGCCAGATACTCGAGGGAATTAGCCGATGCGAGAGCTGAAAATGAAACTCTGCGTGCTGATGTTGCCGCTGGTCGTAAGCGCCTGCGCATCAACGCCAACTGCCCAGGCTCCTTGCGTAAAGCCCCCATCACCTCCGGCGTGGATAATGCAACCGGTCCCCGACTGGCAGAAGCCGCTGAACGGGATTATTTCATCCTCAGAGAACGGCTGATGGCAATGCAGAAGCAACTGGAAGGAGCACAGGAATATATCCGTACCCAGTGTATACCGTGATGTTTTGTTACGAAGGTGTTACTGGTAACATTAAGGTAATTTAACAAAGAGTCAGTTCCGGACTTTATAGTGTGCTCAGTTCATGGCCAAAAACGATTTCTGTGATAAATATTTTGAATATTATTTACAGGTAAATGGAGTGGGGCGCATGGATAGAAATATTACAATAGAGTATGAAGTATATGCCCGTATTGTATGGGCAGAGAAGGCAAAAACATGGTAATTCCGTGTGTTGCCATGATACCTGATTGGCAGAATTGTTGTTTGGTTTTGAGTATATAGTCAGCGTCTTTTGTTCGGTAATTGCTCTTTCAATTAAAATGCCAGATATGATTTGCTTTTCTTTGTTGTTTAGTTTTTTTGTATATTATTTTTATTGTTTTTATATAATTAGTTTTTTATTGTTGTCTTATTAAGGACGGTAAATTCAGGATGGCAGTCTGTAGATAAACGGAGGTTACTTATGCTACATGATCACCTGGCAGAATGTCTGGAGAAAAAAGGACTGTACCGGAGAGCAGCTGAACGATGGGCAAAAGTGATGGTACAGCTAAGTGATGACCAGAAAAGAAAAGTGGCGGCACAGAAACGAGCAGAGTGTTTGCGTAAGGCGCGCCGGACTCCGGTTTCACCGGTGAACCTGACCGAAATAAAACAAGCGGTCAACAGACTACATTCTGAGTTGGGAATGGGATTTGAAGAGCGGCGGGTATTCCGACGATATAAAGGGACAGGAGAACAGAATACGTCCGGAAACGCGCGGTCAAAAAAATGCTAAAAAATATCTGAGAGCGTTA	NA	NA	NA	NA
WP_000336626.1|1961466_1962285_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	9.0e-66
WP_106918788.1|1962661_1962769_+	hypothetical protein	NA	A0A2R2Z352	Escherichia_phage	100.0	3.2e-08
WP_001023986.1|1962827_1963097_+|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	96.6	4.2e-44
WP_000692020.1|1964230_1964821_+	protein kinase	NA	NA	NA	NA	NA
WP_001079499.1|1965858_1966365_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|1966996_1967176_-	general stress protein	NA	NA	NA	NA	NA
WP_000443055.1|1967556_1968363_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209521.1|1968362_1969556_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_032206824.1|1969567_1970926_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	5.0e-37
WP_000763511.1|1970929_1972525_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_032206802.1|1972524_1974087_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|1974178_1974223_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_032206803.1|1974360_1975242_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|1975238_1975859_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001291216.1|1975959_1976832_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278904.1|1976871_1977462_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_032206806.1|1977458_1978217_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	5.2e-07
WP_032206807.1|1978436_1979486_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	32.0	6.0e-22
>prophage 9
NZ_CP013029	Escherichia coli strain 2012C-4227 chromosome, complete genome	5202850	2000931	2134395	5202850	integrase,terminase,portal,head,transposase,lysis,capsid,holin,tail	Escherichia_phage(51.72%)	157	2012221:2012244	2062182:2062205
WP_000573407.1|2000931_2001738_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
WP_001128858.1|2001739_2002732_-	peptide ABC transporter ATP-binding protein SapD	NA	NA	NA	NA	NA
WP_001146163.1|2002731_2003622_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_047087715.1|2003756_2004986_+|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	51.4	4.8e-119
WP_001563185.1|2004949_2005192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021351637.1|2005473_2005707_-	hypothetical protein	NA	G3CFG9	Escherichia_phage	100.0	2.3e-35
WP_000994793.1|2005850_2006231_-	DUF1627 domain-containing protein	NA	A0A0P0ZFT6	Escherichia_phage	100.0	1.2e-52
WP_001291843.1|2006266_2006479_-	DUF1382 family protein	NA	A0A0P0ZGA1	Escherichia_phage	100.0	7.1e-31
WP_032206818.1|2006438_2007065_-	adenine methylase	NA	A0A2R2Z304	Escherichia_phage	99.5	4.0e-122
WP_000809302.1|2007061_2007493_-	hypothetical protein	NA	A0A2R2Z303	Escherichia_phage	100.0	7.3e-75
WP_000211992.1|2007548_2008226_-	ORF6N domain-containing protein	NA	A0A2R2Z302	Escherichia_phage	100.0	1.3e-123
WP_001260979.1|2008550_2008808_+	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	100.0	4.2e-38
WP_001451755.1|2008936_2009134_+	hypothetical protein	NA	A0A0N7BYR2	Escherichia_phage	100.0	4.1e-33
WP_001302866.1|2009223_2009529_+	HigA family addiction module antidote protein	NA	A0A0N7BS23	Escherichia_phage	100.0	4.4e-50
WP_000206752.1|2010398_2011022_-	DUF551 domain-containing protein	NA	A0A1I9LJM0	Stx_converting_phage	100.0	3.1e-119
WP_000212746.1|2011025_2011313_-	hypothetical protein	NA	A0A1I9LJM1	Stx_converting_phage	100.0	9.2e-50
WP_001142590.1|2011314_2011533_-	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	100.0	3.5e-33
WP_032206820.1|2011534_2011750_-	hypothetical protein	NA	A0A0N7C076	Escherichia_phage	97.2	8.7e-37
WP_001301469.1|2011709_2012216_-	hypothetical protein	NA	A0A0N7C063	Escherichia_phage	100.0	4.2e-90
WP_001303141.1|2012217_2013165_-	ead/Ea22-like family protein	NA	A0A0N7BYR8	Escherichia_phage	100.0	1.6e-183
2012221:2012244	attL	CTCTCCTTTGATGCGAATGCCAGC	NA	NA	NA	NA
WP_000157000.1|2013388_2013592_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	100.0	4.7e-32
WP_000995345.1|2015768_2016050_-	host nuclease inhibitor GamL	NA	A0A0P0ZFG3	Escherichia_phage	100.0	1.1e-47
WP_000934197.1|2016070_2016352_-	hypothetical protein	NA	A0A0P0ZGC3	Escherichia_phage	100.0	3.0e-45
WP_000917252.1|2016363_2016576_-	cell division inhibitor protein	NA	A0A0P0ZGD1	Escherichia_phage	100.0	5.8e-33
WP_071887479.1|2016646_2017543_-	hypothetical protein	NA	A0A0P0ZG86	Escherichia_phage	72.0	5.2e-99
WP_032207145.1|2018045_2018999_-	restriction endonuclease BsuBI	NA	A0A0P0ZG22	Escherichia_phage	99.7	3.5e-186
WP_032207143.1|2018995_2020465_-	SAM-dependent methyltransferase	NA	A0A2L1IV91	Escherichia_phage	100.0	2.7e-286
WP_001056250.1|2020559_2021273_-	LexA family transcriptional regulator	NA	A0A2R2X2B0	Escherichia_phage	100.0	6.3e-132
WP_001240876.1|2021368_2021572_+	Cro/CI family transcriptional regulator	NA	A0A2R2Z333	Escherichia_phage	100.0	2.0e-30
WP_077744819.1|2021742_2021937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032207142.1|2022103_2022481_+	hypothetical protein	NA	A0A2R2Z329	Escherichia_phage	99.2	1.2e-60
WP_000913117.1|2022474_2023995_+	DEAD/DEAH box helicase	NA	A0A0N7KZV6	Escherichia_phage	98.2	4.0e-301
WP_060552848.1|2023984_2024926_+	DNA primase	NA	A0A0H4IPK0	Shigella_phage	96.7	1.8e-179
WP_000402090.1|2024954_2025404_+	DUF1367 family protein	NA	A0A2R2Z328	Escherichia_phage	98.0	1.0e-79
WP_001187434.1|2025411_2025975_+	bacteriophage lambda NinG family protein	NA	A0A2R2Z332	Escherichia_phage	100.0	4.7e-106
WP_000144764.1|2025971_2026166_+	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001204844.1|2026158_2026593_+	antitermination protein	NA	A0A2R2Z331	Escherichia_phage	100.0	5.6e-83
WP_001356551.1|2026841_2026994_+	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_000649753.1|2027376_2028336_+	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_000738068.1|2028347_2028617_+	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_000143458.1|2031176_2031356_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|2031396_2031642_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_001072901.1|2031719_2031935_+|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_047618934.1|2031939_2032473_+	lysozyme	NA	A0A2R2Z343	Escherichia_phage	98.9	1.5e-101
WP_001056885.1|2032747_2033317_+	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	100.0	1.8e-105
WP_000455406.1|2033316_2033466_+	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
WP_001082654.1|2033473_2033938_+|lysis	lysis protein	lysis	A0A2R2Z341	Escherichia_phage	100.0	5.8e-78
WP_000738505.1|2033969_2034263_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	100.0	6.8e-48
WP_001301714.1|2034412_2034616_+	hypothetical protein	NA	A0A2R2Z338	Escherichia_phage	100.0	7.7e-35
WP_106888077.1|2034890_2036104_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
WP_000479105.1|2036917_2037349_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	3.7e-42
WP_044861160.1|2037375_2037780_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	2.6e-42
WP_032206995.1|2040335_2040665_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	97.2	1.2e-56
WP_060552849.1|2040664_2041363_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	3.1e-131
WP_060552850.1|2041368_2042112_+|tail	phage tail protein	tail	A0A0P0ZDJ9	Stx2-converting_phage	99.2	2.1e-146
WP_123007084.1|2042057_2042690_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	93.3	1.0e-104
WP_060552852.1|2042935_2046412_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	95.9	0.0e+00
WP_001230532.1|2046478_2047078_+	Ail/Lom family outer membrane beta-barrel protein	NA	B6ETG5	Enterobacteria_phage	99.0	4.4e-110
WP_129014758.1|2047142_2048726_+|tail	phage tail protein	tail	Q9EYE8	Enterobacteria_phage	100.0	4.2e-59
WP_001131658.1|2048840_2049416_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_078164217.1|2049488_2050118_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	90.2	1.9e-76
WP_001143804.1|2050199_2050841_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.7	3.8e-104
WP_001206148.1|2051013_2052309_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	2.5e-155
WP_001368608.1|2052328_2052565_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_060552853.1|2052652_2055115_-	exonuclease	NA	V5UQJ3	Shigella_phage	47.4	8.9e-125
WP_000199475.1|2055207_2055396_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449175.1|2055392_2055581_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001133037.1|2056144_2056354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001473525.1|2056354_2056993_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_000379546.1|2057004_2057157_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	1.3e-07
WP_001444087.1|2057428_2057716_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001090455.1|2057719_2057908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001444086.1|2057937_2058345_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000548554.1|2058452_2058731_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPK9	Escherichia_phage	41.0	9.7e-12
WP_000705386.1|2058714_2059236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054521.1|2059216_2060194_+	hypothetical protein	NA	U5P0A0	Shigella_phage	61.2	3.8e-55
WP_000790460.1|2060200_2060941_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.1	4.7e-114
WP_009453174.1|2060970_2061741_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	66.0	1.4e-81
WP_001473635.1|2061756_2062152_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	52.1	1.3e-30
WP_162491415.1|2062152_2062566_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	97.5	1.0e-57
2062182:2062205	attR	GCTGGCATTCGCATCAAAGGAGAG	NA	NA	NA	NA
WP_000935420.1|2062616_2062829_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_044862496.1|2063058_2063247_+	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	93.5	7.7e-29
WP_000951710.1|2063248_2063458_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	94.2	8.8e-34
WP_001473452.1|2063454_2064090_+	DUF551 domain-containing protein	NA	G9L6G3	Escherichia_phage	91.4	3.5e-81
WP_001278454.1|2064205_2064310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000128514.1|2064499_2064712_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	9.6e-28
WP_000737636.1|2064855_2065248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001473246.1|2065544_2065823_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	2.2e-11
WP_001375683.1|2065824_2066874_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.6	4.6e-115
WP_001047111.1|2066887_2067640_+	antitermination protein	NA	K7PGU5	Enterobacteria_phage	98.8	2.6e-136
WP_000735807.1|2068484_2068709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000498121.1|2068761_2068971_+	hypothetical protein	NA	K7PJU3	Enterobacteria_phage	65.2	2.5e-20
WP_001299632.1|2069160_2069592_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	98.6	7.8e-69
WP_060552855.1|2070070_2071924_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.5	0.0e+00
WP_000284516.1|2072073_2072289_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	7.7e-33
WP_024231374.1|2072292_2072850_+	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	84.6	7.8e-53
WP_001092861.1|2072892_2073426_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	94.9	5.3e-99
WP_001082561.1|2073724_2074192_+|lysis	lysis protein	lysis	Q9ZXB6	Enterobacteria_phage	77.4	2.8e-56
WP_000347013.1|2074542_2074683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001329960.1|2074815_2075001_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.4	3.2e-19
WP_000453587.1|2075389_2075935_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001027330.1|2075909_2077835_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_000198153.1|2077831_2078038_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_024026143.1|2078034_2079636_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	2.1e-308
WP_000123254.1|2079616_2080936_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001365129.1|2080945_2081278_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	5.5e-54
WP_000063258.1|2081333_2082359_+|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
WP_022581670.1|2082400_2082796_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.2	5.3e-56
WP_000752994.1|2082807_2083161_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_000975098.1|2083172_2083751_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	98.4	5.0e-79
WP_000683137.1|2083747_2084143_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
WP_000235067.1|2084150_2084903_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
WP_000479045.1|2084916_2085339_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
WP_000533440.1|2085365_2085779_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_060552857.1|2085759_2088372_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	90.5	0.0e+00
WP_000847298.1|2088368_2088698_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_060552858.1|2088697_2089396_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	97.4	3.1e-131
WP_000194723.1|2089406_2090150_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	5.0e-148
WP_129014765.1|2090095_2090728_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	91.0	1.7e-96
WP_060552860.1|2090974_2094451_+	host specificity protein J	NA	Q687E8	Enterobacteria_phage	96.5	0.0e+00
WP_032325332.1|2094517_2095117_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
WP_000279047.1|2095181_2096495_+|tail	tail fiber protein	tail	H6WZM9	Escherichia_phage	97.7	2.4e-76
WP_001101700.1|2096496_2096766_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	97.8	1.9e-44
WP_122988840.1|2096876_2096954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122993102.1|2097168_2098182_+	peptidase M85	NA	NA	NA	NA	NA
WP_096846665.1|2098552_2098867_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000347482.1|2098926_2100210_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527756.1|2100298_2101759_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	30.1	8.6e-43
WP_000214712.1|2101794_2101998_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_032208665.1|2102175_2102862_-	DNA-binding transcriptional regulator YdfH	NA	NA	NA	NA	NA
WP_000636571.1|2102950_2103697_-	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_032208663.1|2103833_2105879_+	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_032208661.1|2105922_2106468_-	2-oxo-tetronate isomerase	NA	NA	NA	NA	NA
WP_060552861.1|2106478_2107297_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.9	1.5e-65
WP_000088311.1|2107332_2107635_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000671731.1|2107982_2108375_+	YdeI family stress tolerance OB fold protein	NA	NA	NA	NA	NA
WP_000592822.1|2108629_2109520_+	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	1.8e-19
WP_000901367.1|2109738_2109834_-	protein MgtS	NA	NA	NA	NA	NA
WP_071887482.1|2109960_2110149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000087214.1|2110343_2111243_+	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
WP_000803659.1|2111273_2111492_-	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000091199.1|2111523_2111907_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_000843419.1|2111926_2112361_-	multiple antibiotic resistance transcriptional regulator MarR	NA	NA	NA	NA	NA
WP_000885033.1|2112572_2113238_+	NAAT family transporter MarC	NA	NA	NA	NA	NA
WP_032206991.1|2113262_2114453_-	L-arabinose MFS transporter	NA	NA	NA	NA	NA
WP_032206990.1|2114602_2115718_-	putative protein YneK	NA	NA	NA	NA	NA
WP_032206989.1|2115794_2116676_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001364729.1|2116776_2118165_+	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_077744806.1|2118228_2120277_+	glutaminase B	NA	NA	NA	NA	NA
WP_000637082.1|2120483_2121398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001286590.1|2121401_2122160_-	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
WP_000774169.1|2122531_2123407_-	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_032206988.1|2123433_2124456_-	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_000911184.1|2125459_2126488_-	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_001194905.1|2126481_2128017_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	9.8e-21
WP_000154339.1|2128264_2129218_+	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_085972493.1|2133122_2134395_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	1.5e-176
>prophage 10
NZ_CP013029	Escherichia coli strain 2012C-4227 chromosome, complete genome	5202850	2236860	2344217	5202850	tRNA,terminase,portal,integrase,transposase,protease,holin,tail	Escherichia_phage(38.1%)	104	2293495:2293520	2338849:2338874
WP_000826403.1|2236860_2238069_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	92.5	1.5e-205
WP_000586732.1|2239571_2240165_-	tellurite resistance methyltransferase TehB	NA	NA	NA	NA	NA
WP_032206931.1|2241279_2242236_+	acetyltransferase	NA	NA	NA	NA	NA
WP_001296778.1|2242853_2243078_-	YdcH family protein	NA	NA	NA	NA	NA
WP_047087872.1|2243217_2244873_-	glucan biosynthesis protein OpgD	NA	NA	NA	NA	NA
WP_000169527.1|2246017_2246317_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000414564.1|2246981_2247905_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032206697.1|2247942_2249583_-	methyl-accepting chemotaxis protein Trg	NA	NA	NA	NA	NA
WP_001320773.1|2249981_2250131_+	type I toxin-antitoxin system toxin HokB	NA	NA	NA	NA	NA
WP_000731833.1|2250202_2250376_-	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_000428998.1|2250620_2251151_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_000048667.1|2251339_2252341_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_032206698.1|2253790_2257693_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	7.6e-54
WP_000048948.1|2257893_2258499_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_032206699.1|2259178_2259784_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_032206701.1|2259954_2262261_-	DUF2773 domain-containing bactofilin	NA	NA	NA	NA	NA
WP_024226022.1|2262324_2263185_-	pyridoxine 4-dehydrogenase	NA	NA	NA	NA	NA
WP_024226021.1|2263416_2264007_-	phenylacetic acid degradation protein PaaY	NA	NA	NA	NA	NA
WP_000039879.1|2263988_2264939_-	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_032206703.1|2265039_2266353_-	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_032206704.1|2266379_2267585_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_000018413.1|2267584_2268007_-	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
WP_032206706.1|2267996_2269424_-	3-hydroxyacyl-CoA dehydrogenase PaaC	NA	NA	NA	NA	NA
WP_000969780.1|2269425_2270214_-	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_001292357.1|2270213_2270981_-	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
WP_032206707.1|2270977_2272048_-	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	NA	NA	NA	NA
WP_001189193.1|2272055_2272553_-	phenylacetate degradation protein PaaD	NA	NA	NA	NA	NA
WP_024226016.1|2272567_2273314_-	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_000073393.1|2273322_2273610_-	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_000191073.1|2273621_2274551_-	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_032206709.1|2274835_2276881_+	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
WP_060552864.1|2277128_2279402_+	primary-amine oxidase	NA	NA	NA	NA	NA
WP_000138622.1|2279460_2280960_-	phenylacetaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_032206711.1|2281195_2282101_+	transcriptional regulator FeaR	NA	NA	NA	NA	NA
WP_001325798.1|2282272_2282602_-	YdbL family protein	NA	NA	NA	NA	NA
WP_000698141.1|2282606_2282792_-	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_032206712.1|2282788_2285428_-	YdbH family protein	NA	NA	NA	NA	NA
WP_032206713.1|2285635_2286625_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	6.6e-71
WP_001298828.1|2286735_2287158_+	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_032206714.1|2287154_2287421_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_032206716.1|2287694_2291219_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_032206718.1|2291586_2292720_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	4.8e-118
WP_032206719.1|2292860_2293295_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.1	3.0e-28
2293495:2293520	attL	AAGAAAGAACAATACAACCTGAACAA	NA	NA	NA	NA
WP_001143784.1|2293875_2294517_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001443810.1|2294598_2295228_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.2	1.3e-77
WP_001131659.1|2295300_2295876_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.4	5.3e-89
WP_001023406.1|2295988_2296258_-|tail	phage tail protein	tail	Q6H9S8	Enterobacteria_phage	97.8	2.4e-44
WP_000279065.1|2296259_2297582_-|tail	tail fiber protein	tail	Q687E6	Enterobacteria_phage	98.6	2.0e-75
WP_001228289.1|2297646_2298246_-	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	100.0	2.6e-110
WP_032208636.1|2298313_2301787_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	90.0	0.0e+00
WP_096851774.1|2302027_2302657_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.9	2.3e-101
WP_000194798.1|2302602_2303346_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_001356552.1|2303356_2304055_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	99.1	3.6e-132
WP_000847298.1|2304054_2304384_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000918276.1|2304380_2307026_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	99.4	0.0e+00
WP_000532073.1|2307069_2307378_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000479043.1|2307404_2307827_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000235090.1|2307840_2308593_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000682716.1|2308600_2308999_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000974966.1|2309011_2309635_-	hypothetical protein	NA	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_001281350.1|2309637_2309919_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_001097065.1|2309911_2310238_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_129014759.1|2310325_2312350_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.7	0.0e+00
WP_000974564.1|2312294_2313797_-|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_000102414.1|2313796_2314009_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	97.1	1.1e-28
WP_001077625.1|2314005_2316129_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000348565.1|2316125_2316602_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_001302882.1|2316634_2316907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012816791.1|2317118_2317304_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|2317531_2317678_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|2317677_2318247_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000087728.1|2318517_2319051_-	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_001072899.1|2319055_2319271_-|holin	holin	holin	A0A0P0ZFW5	Escherichia_phage	100.0	9.0e-34
WP_001290230.1|2319348_2319594_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143458.1|2319634_2319814_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000142970.1|2319950_2321897_-	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.5	0.0e+00
WP_000640110.1|2322598_2323141_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.3	3.9e-73
WP_000228017.1|2323137_2323428_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	8.2e-46
WP_000940305.1|2323427_2324027_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.5	1.0e-106
WP_071525388.1|2324098_2324350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000902698.1|2324586_2324799_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.2e-17
WP_000418464.1|2324921_2326043_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_001138877.1|2326029_2326680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014164.1|2326834_2327065_-	hypothetical protein	NA	A0A2R2Z315	Escherichia_phage	76.8	4.1e-16
WP_001151116.1|2327061_2327484_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	2.8e-63
WP_000450718.1|2327499_2328261_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	87.7	1.0e-116
WP_000788984.1|2328283_2329030_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	80.9	4.8e-114
WP_000702017.1|2329902_2330325_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	93.6	5.9e-69
WP_001033914.1|2330321_2330564_-	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	62.1	2.3e-17
WP_000410105.1|2330660_2331080_+	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	60.6	3.1e-14
WP_000379547.1|2331386_2331539_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000887681.1|2331950_2332799_+	hypothetical protein	NA	A0A0P0ZE80	Stx2-converting_phage	60.8	5.9e-60
WP_000560226.1|2332845_2333067_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	6.9e-37
WP_000245534.1|2333060_2333237_+	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	89.7	4.1e-24
WP_000102194.1|2333317_2335987_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	61.3	4.2e-205
WP_000166315.1|2335979_2336789_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_042853000.1|2336845_2337040_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	7.6e-32
WP_001356607.1|2337032_2337221_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	97.9	1.6e-18
WP_000079604.1|2337320_2337536_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040845.1|2337537_2338773_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.3	1.1e-237
WP_001157382.1|2338824_2339760_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	99.6	5.4e-147
2338849:2338874	attR	AAGAAAGAACAATACAACCTGAACAA	NA	NA	NA	NA
WP_000123758.1|2339888_2341262_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|2341746_2342730_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628065.1|2342984_2344217_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
>prophage 11
NZ_CP013029	Escherichia coli strain 2012C-4227 chromosome, complete genome	5202850	2360666	2427075	5202850	integrase,transposase,protease,holin	Escherichia_phage(34.78%)	55	2419118:2419133	2430618:2430633
WP_000088311.1|2360666_2360969_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_060552866.1|2361004_2361823_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.9	3.4e-65
WP_001365271.1|2362863_2364405_-	transcriptional regulator TyrR	NA	NA	NA	NA	NA
WP_032206830.1|2364552_2365614_-	TIGR01620 family protein	NA	NA	NA	NA	NA
WP_032206832.1|2365610_2367008_-	YcjX family protein	NA	NA	NA	NA	NA
WP_032206833.1|2367162_2368161_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_032206834.1|2368271_2369177_-	monomeric porin OmpG	NA	NA	NA	NA	NA
WP_032206836.1|2369221_2370304_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	5.6e-23
WP_000775790.1|2370317_2370977_-	beta-phosphoglucomutase	NA	NA	NA	NA	NA
WP_001299974.1|2373237_2374293_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_000690242.1|2374302_2375091_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_032206837.1|2375108_2376161_-	zinc-binding alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_032206838.1|2376191_2377034_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_032206839.1|2377020_2377902_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_000597447.1|2377922_2379215_-	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_032206840.1|2379228_2380908_-	glucosylglycerate phosphorylase	NA	NA	NA	NA	NA
WP_000473109.1|2381119_2381434_-	thiosulfate sulfurtransferase PspE	NA	NA	NA	NA	NA
WP_000907387.1|2381738_2382098_-	envelope stress response membrane protein PspC	NA	NA	NA	NA	NA
WP_001274963.1|2382097_2382322_-	envelope stress response membrane protein PspB	NA	NA	NA	NA	NA
WP_000511025.1|2382375_2383044_-	phage shock protein PspA	NA	NA	NA	NA	NA
WP_000852835.1|2383210_2384188_+	phage shock protein operon transcriptional activator	NA	NA	NA	NA	NA
WP_000069226.1|2384305_2385571_-	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.0	3.5e-24
WP_032206842.1|2385608_2386889_-	gamma-glutamylputrescine oxidase	NA	NA	NA	NA	NA
WP_032206843.1|2386890_2388369_-	aldehyde dehydrogenase PuuC	NA	NA	NA	NA	NA
WP_032206846.1|2388518_2389076_-	HTH-type transcriptional regulator PuuR	NA	NA	NA	NA	NA
WP_001300506.1|2389102_2389867_-	gamma-glutamyl-gamma-aminobutyrate hydrolase	NA	NA	NA	NA	NA
WP_120795382.1|2391644_2391809_+	protein YmjE	NA	NA	NA	NA	NA
WP_024225995.1|2391798_2393184_+	putrescine/proton symporter PuuP	NA	NA	NA	NA	NA
WP_001015110.1|2393317_2393563_+	YmjA family protein	NA	NA	NA	NA	NA
WP_001250213.1|2393875_2395519_+	peptide ABC transporter substrate-binding protein SapA	NA	NA	NA	NA	NA
WP_000583277.1|2395515_2396481_+	peptide ABC transporter permease SapB	NA	NA	NA	NA	NA
WP_060552867.1|2396622_2405004_-	hypothetical protein	NA	A0A0P0ZFK4	Escherichia_phage	98.4	0.0e+00
WP_106888148.1|2405864_2407077_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.0	4.2e-168
WP_106918794.1|2410307_2411021_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001303877.1|2411115_2411355_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.0	7.7e-18
WP_032206343.1|2411641_2412460_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_032206342.1|2412613_2412985_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	1.2e-52
WP_001217436.1|2412974_2413346_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_047618481.1|2413358_2414408_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	4.5e-110
WP_047088205.1|2414409_2414688_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001013632.1|2414855_2415068_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.4	2.0e-25
WP_122083109.1|2415112_2415220_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	100.0	3.8e-09
WP_096913359.1|2415226_2415436_-	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	69.0	1.6e-06
WP_106888170.1|2415401_2416615_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.6	1.6e-167
WP_000284518.1|2416978_2417194_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_001290231.1|2417270_2417543_-	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000143458.1|2417583_2417763_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
2419118:2419133	attL	CAGCACATTTTTCGGG	NA	NA	NA	NA
WP_000301787.1|2420645_2421359_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_074433665.1|2421493_2421691_-	TrmB family transcriptional regulator	NA	S5MQK8	Escherichia_phage	93.8	1.4e-25
WP_001452492.1|2421917_2422286_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	64.2	7.0e-34
WP_106888148.1|2422343_2423557_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.0	4.2e-168
WP_032207949.1|2423806_2424970_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	99.5	1.9e-226
WP_077744831.1|2425007_2425562_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	57.1	4.1e-62
WP_032207946.1|2425563_2426418_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148710.1|2426460_2427075_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
2430618:2430633	attR	CAGCACATTTTTCGGG	NA	NA	NA	NA
>prophage 12
NZ_CP013029	Escherichia coli strain 2012C-4227 chromosome, complete genome	5202850	2672181	2766583	5202850	tRNA,terminase,portal,integrase,protease,holin,tail	Enterobacteria_phage(40.0%)	107	2704703:2704718	2771107:2771122
WP_000984517.1|2672181_2673063_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001315679.1|2673254_2675303_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
WP_000431370.1|2675322_2676021_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001043882.1|2676117_2676615_-	L-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
WP_001207283.1|2676744_2678028_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_032207807.1|2677996_2680630_+	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_001295499.1|2682265_2682502_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_000929530.1|2682522_2682798_+	YebW family protein	NA	NA	NA	NA	NA
WP_000812724.1|2682798_2683455_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	3.1e-56
WP_000976472.1|2683850_2684192_-	YebY family protein	NA	NA	NA	NA	NA
WP_000168747.1|2685080_2685455_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|2685593_2685824_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_032207802.1|2685925_2686582_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944256.1|2686605_2687268_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_032207799.1|2687264_2689325_-	oligopeptidase B	NA	NA	NA	NA	NA
WP_000024745.1|2689533_2690193_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_001295500.1|2690519_2690876_-	protein YebF	NA	NA	NA	NA	NA
WP_000257738.1|2690942_2691233_-	DNA damage-inducible protein YebG	NA	NA	NA	NA	NA
WP_000173484.1|2691366_2692545_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_000800512.1|2692600_2693242_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_001069467.1|2693278_2695090_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_000301720.1|2695324_2696800_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.3	9.9e-79
WP_001056706.1|2697137_2698007_+	DNA-binding transcriptional regulator HexR	NA	NA	NA	NA	NA
WP_000091148.1|2698134_2699577_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_000448381.1|2699708_2700680_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_060552871.1|2700799_2702122_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_032207954.1|2702137_2703070_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202996.1|2703148_2703904_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_032207795.1|2703900_2704686_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
2704703:2704718	attL	TTTGTCGGATGCGGCG	NA	NA	NA	NA
WP_000568519.1|2704834_2705845_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580326.1|2705853_2706465_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_072095795.1|2706603_2706669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032207793.1|2706740_2707343_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|2707344_2707866_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_032207791.1|2707900_2708641_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_032207953.1|2708669_2709122_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_032207789.1|2709239_2711012_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001552993.1|2711321_2711888_+	hydrolase	NA	NA	NA	NA	NA
WP_001217551.1|2712241_2712490_+	DinI-like family protein	NA	K7PLW4	Enterobacteria_phage	93.9	3.8e-36
WP_099561169.1|2712626_2712749_+	zinc/iron-chelating domain-containing protein	NA	NA	NA	NA	NA
WP_001132098.1|2712735_2713326_-	bfpT-regulated chaperone	NA	NA	NA	NA	NA
WP_001144084.1|2713509_2714160_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	40.7	1.1e-37
WP_001434995.1|2714238_2715297_+	T3SS effector EspW	NA	NA	NA	NA	NA
WP_012816780.1|2715424_2716060_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.0	3.7e-75
WP_001101700.1|2716821_2717091_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	97.8	1.9e-44
WP_032362297.1|2717092_2718406_-|tail	tail fiber protein	tail	H6WZM9	Escherichia_phage	98.4	9.7e-78
WP_032162956.1|2718470_2719070_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	3.7e-109
WP_060552873.1|2719136_2722616_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.6	0.0e+00
WP_071887493.1|2722676_2723309_-|tail	tail assembly protein	tail	C6ZCZ4	Enterobacteria_phage	96.7	7.4e-92
WP_000140735.1|2723245_2723989_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.3	3.4e-144
WP_001152532.1|2723993_2724692_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	8.9e-131
WP_000847345.1|2724691_2725021_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
WP_000918276.1|2725017_2727663_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	99.4	0.0e+00
WP_000532073.1|2727706_2728015_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000479043.1|2728041_2728464_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000235090.1|2728477_2729230_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000682716.1|2729237_2729636_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000974966.1|2729648_2730272_-	hypothetical protein	NA	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_001281350.1|2730274_2730556_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_001097065.1|2730548_2730875_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_129014759.1|2730962_2732987_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.7	0.0e+00
WP_000974564.1|2732931_2734434_-|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_000102414.1|2734433_2734646_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	97.1	1.1e-28
WP_001077625.1|2734642_2736766_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000348565.1|2736762_2737239_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_001302882.1|2737271_2737544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012816791.1|2737755_2737941_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|2738168_2738315_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|2738314_2738884_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000087728.1|2739154_2739688_-	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_001072899.1|2739692_2739908_-|holin	holin	holin	A0A0P0ZFW5	Escherichia_phage	100.0	9.0e-34
WP_001290230.1|2739985_2740231_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143458.1|2740271_2740451_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000142970.1|2740587_2742534_-	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.5	0.0e+00
WP_000301787.1|2743337_2744051_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_047618655.1|2744186_2744384_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	95.4	1.3e-26
WP_000640037.1|2744606_2745161_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	66.9	3.0e-65
WP_001215507.1|2745169_2745529_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.3	4.3e-36
WP_001064806.1|2745528_2745786_-	hypothetical protein	NA	Q8W639	Enterobacteria_phage	97.5	2.2e-34
WP_000184331.1|2745782_2747183_-	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	94.8	5.4e-252
WP_000181080.1|2747179_2748070_-	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	63.3	2.6e-82
WP_001247847.1|2748087_2748981_-	hypothetical protein	NA	C5IHL2	Burkholderia_virus	45.9	2.1e-60
WP_060552874.1|2748967_2749201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060552913.1|2749197_2750046_-	peptidase	NA	Q8HA97	Salmonella_phage	63.6	1.1e-93
WP_001193680.1|2750063_2750273_-	restriction alleviation protein, Lar family	NA	NA	NA	NA	NA
WP_050437784.1|2750272_2751133_-	ORF6N domain-containing protein	NA	F1C5A3	Cronobacter_phage	42.2	1.4e-53
WP_064754158.1|2751209_2751509_-	Cro/Cl family transcriptional regulator	NA	A0A1B5FPK9	Escherichia_phage	90.9	1.8e-35
WP_000800135.1|2751642_2752332_+	LexA family transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	87.8	8.0e-116
WP_012816784.1|2752476_2753169_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPB8	Escherichia_phage	69.2	1.1e-40
WP_000147365.1|2753174_2753375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000312938.1|2753574_2753934_+	hypothetical protein	NA	A0A1B5FPB3	Escherichia_phage	73.1	1.4e-42
WP_000002321.1|2753933_2754149_+	hypothetical protein	NA	A0A1B5FPB7	Escherichia_phage	63.4	1.2e-17
WP_162137203.1|2754216_2754339_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	80.0	7.9e-11
WP_000566773.1|2754335_2754728_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	57.9	4.7e-36
WP_001091864.1|2755345_2755717_+	DUF5406 family protein	NA	Q8W655	Enterobacteria_phage	98.4	3.8e-64
WP_000492057.1|2755748_2755991_+	DUF4222 domain-containing protein	NA	Q8W656	Enterobacteria_phage	92.5	2.4e-35
WP_001030139.1|2755994_2756141_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	95.8	3.1e-22
WP_000073102.1|2756149_2756386_+	excisionase family protein	NA	Q8W657	Enterobacteria_phage	98.7	8.4e-41
WP_000362001.1|2756441_2757755_+|integrase	site-specific integrase	integrase	Q8W658	Enterobacteria_phage	97.0	2.8e-250
WP_049768377.1|2757736_2758507_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.1e-72
WP_000252980.1|2758559_2758955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019588.1|2758995_2759739_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000564746.1|2759735_2760707_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_074433494.1|2760871_2762920_-	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	NA	NA	NA	NA
WP_032206488.1|2763307_2764054_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001300190.1|2764067_2764634_-	VOC family protein	NA	NA	NA	NA	NA
WP_001025342.1|2764849_2766583_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
2771107:2771122	attR	TTTGTCGGATGCGGCG	NA	NA	NA	NA
>prophage 13
NZ_CP013029	Escherichia coli strain 2012C-4227 chromosome, complete genome	5202850	2795844	2834740	5202850	terminase,portal,integrase,head,plate,transposase,capsid,holin,tail	Enterobacteria_phage(80.95%)	50	2795615:2795674	2835679:2835802
2795615:2795674	attL	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTA	NA	NA	NA	NA
WP_032206500.1|2795844_2796846_-|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.2	2.1e-104
WP_000865208.1|2796851_2797199_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_000290355.1|2797228_2797879_-	membrane protein	NA	NA	NA	NA	NA
WP_000786769.1|2797894_2798299_-	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	1.6e-23
WP_001673482.1|2798388_2798526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014504.1|2798597_2798801_+	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_000739029.1|2798822_2799173_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000159462.1|2799183_2799462_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	81.5	3.6e-35
WP_000514281.1|2799473_2799716_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	4.4e-37
WP_000021668.1|2799712_2799826_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	91.9	1.2e-08
WP_000985145.1|2799912_2800116_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	86.6	2.3e-26
WP_000153684.1|2800112_2800358_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	91.4	3.4e-37
WP_032206502.1|2800499_2800865_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	95.0	2.4e-58
WP_032206503.1|2800871_2803694_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	96.8	0.0e+00
WP_000686557.1|2803770_2804730_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.4	8.4e-180
WP_000211293.1|2804734_2805049_+	peptide transporter	NA	A0A0A7NPT5	Enterobacteria_phage	51.9	3.5e-18
WP_032206504.1|2805068_2805488_+	hypothetical protein	NA	A0A0A7NRY2	Enterobacteria_phage	42.6	4.2e-19
WP_000224220.1|2805489_2805753_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	73.6	6.7e-31
WP_000236495.1|2806338_2806863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032206507.1|2806877_2807924_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.4	1.9e-201
WP_050439336.1|2807923_2809225_-|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	97.6	2.0e-229
WP_000088311.1|2809240_2809543_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000336626.1|2809578_2810397_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	9.0e-66
WP_050439337.1|2810393_2810942_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	97.0	1.4e-91
WP_001262679.1|2811096_2811933_+|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	98.9	5.1e-149
WP_000632313.1|2813055_2813856_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	89.5	6.9e-127
WP_000063100.1|2813957_2814452_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	97.0	1.9e-87
WP_000864901.1|2814451_2814652_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_001342221.1|2814654_2814978_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	93.5	1.7e-47
WP_000072343.1|2814974_2815367_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	98.5	2.9e-70
WP_000780555.1|2815363_2815771_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	95.6	4.2e-64
WP_001342220.1|2817811_2818279_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	94.8	6.7e-82
WP_000356339.1|2818271_2818907_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	100.0	1.1e-114
WP_001271917.1|2818903_2819485_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.4	2.8e-101
WP_000127182.1|2819481_2819832_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	98.3	7.8e-59
WP_032206508.1|2820723_2821332_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	73.9	6.5e-85
WP_032206510.1|2821328_2823332_+|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	42.6	9.2e-96
WP_032206512.1|2823331_2823910_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	89.5	7.7e-96
WP_000954200.1|2823953_2824526_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000979946.1|2824682_2825171_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	8.8e-85
WP_106888148.1|2826645_2827858_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.0	4.2e-168
WP_001391627.1|2829290_2829419_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	95.2	1.5e-15
WP_000665305.1|2829454_2829820_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	96.7	1.4e-55
WP_000290443.1|2829874_2830387_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	98.8	2.7e-92
WP_032206883.1|2830386_2831571_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	97.7	1.1e-221
WP_032206881.1|2831728_2832838_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	9.0e-202
WP_050439343.1|2832880_2833141_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000336626.1|2833137_2833956_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	9.0e-66
WP_000088311.1|2833991_2834294_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000078920.1|2834599_2834740_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
2835679:2835802	attR	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTATCTTTCCCATGGTACCCGGAGCGGGACTTGAACCCGCACAGCGCGAACGCCGAGGGATTTTAAA	NA	NA	NA	NA
>prophage 14
NZ_CP013029	Escherichia coli strain 2012C-4227 chromosome, complete genome	5202850	2876464	2948196	5202850	terminase,integrase,head,transposase,capsid,lysis,holin,tail	Enterobacteria_phage(35.14%)	51	2875418:2875434	2953038:2953054
2875418:2875434	attL	TTTTTTGATTTCTGTGT	NA	NA	NA	NA
WP_000169527.1|2876464_2876764_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000878219.1|2876760_2877627_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_000218207.1|2878833_2879685_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_032207117.1|2879792_2881151_-	two-component system sensor histidine kinase HprS	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.2	8.7e-05
WP_001339045.1|2881150_2881822_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_032205316.1|2881954_2882368_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_000740103.1|2882476_2883481_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_001240105.1|2883481_2884117_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_001007759.1|2884373_2885024_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_085972493.1|2885494_2886767_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	1.5e-176
WP_032207191.1|2888231_2888885_+	type III secretion system effector ADP-ribosyltransferase EspJ	NA	NA	NA	NA	NA
WP_071887496.1|2889209_2889941_+	molecular chaperone Tir	NA	NA	NA	NA	NA
WP_129014760.1|2890066_2891650_-|tail	phage tail protein	tail	Q9EYE8	Enterobacteria_phage	100.0	4.2e-59
WP_001230532.1|2891714_2892314_-	Ail/Lom family outer membrane beta-barrel protein	NA	B6ETG5	Enterobacteria_phage	99.0	4.4e-110
WP_106888148.1|2893109_2894322_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.0	4.2e-168
WP_001370486.1|2896706_2900108_-	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.3	1.3e-219
WP_032206908.1|2900699_2903048_-	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_115801847.1|2903067_2903157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129014760.1|2903263_2904847_-|tail	phage tail protein	tail	Q9EYE8	Enterobacteria_phage	100.0	4.2e-59
WP_001230532.1|2904911_2905511_-	Ail/Lom family outer membrane beta-barrel protein	NA	B6ETG5	Enterobacteria_phage	99.0	4.4e-110
WP_060552875.1|2905577_2909054_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.1	0.0e+00
WP_000649829.1|2909187_2909715_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_122993101.1|2909905_2910538_-|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	98.6	7.6e-105
WP_060552876.1|2910483_2911227_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.0	1.8e-145
WP_032207182.1|2911232_2911931_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	4.7e-132
WP_000807944.1|2911930_2912272_-|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	98.2	1.2e-61
WP_001513217.1|2915578_2915788_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_001030063.1|2915883_2916258_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_047619258.1|2916263_2916980_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.2	4.3e-128
WP_000133391.1|2917046_2917391_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_000573374.1|2917387_2917834_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_060552877.1|2917830_2918181_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	99.1	2.7e-59
WP_000125990.1|2918190_2918517_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_001063096.1|2920878_2921100_-	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
WP_060552881.1|2921144_2923082_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	99.5	0.0e+00
WP_032207769.1|2924803_2925367_-|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	79.5	1.6e-58
WP_032207766.1|2925655_2926021_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	97.5	1.3e-64
WP_085972493.1|2926193_2927467_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	1.5e-176
WP_000736096.1|2927994_2928219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047618419.1|2928215_2928710_-|lysis	lysis protein	lysis	Q9ZXB6	Enterobacteria_phage	98.8	1.1e-82
WP_047087679.1|2929007_2929541_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.9	1.6e-100
WP_000731236.1|2929591_2929936_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_000411811.1|2929940_2930147_-|holin	holin	holin	O48430	Enterobacteria_phage	100.0	1.8e-31
WP_060552882.1|2930590_2932441_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.7	0.0e+00
WP_001344632.1|2932884_2933016_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	85.7	5.2e-08
WP_106888148.1|2935111_2936324_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.0	4.2e-168
WP_000096346.1|2937654_2937858_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533619.1|2937857_2938883_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.9	2.0e-102
WP_001515476.1|2939118_2939916_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_064734930.1|2940378_2946978_+	inverse autotransporter adhesin YeeJ	NA	NA	NA	NA	NA
WP_106888148.1|2946983_2948196_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.0	4.2e-168
2953038:2953054	attR	ACACAGAAATCAAAAAA	NA	NA	NA	NA
>prophage 15
NZ_CP013029	Escherichia coli strain 2012C-4227 chromosome, complete genome	5202850	3081750	3154085	5202850	transposase,tRNA,tail,lysis	Enterobacteria_phage(40.0%)	60	NA	NA
WP_085972493.1|3081750_3083024_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	1.5e-176
WP_000289788.1|3084661_3085516_-	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000129551.1|3085823_3086876_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_032206398.1|3087132_3088410_+	MFS transporter	NA	NA	NA	NA	NA
WP_000846217.1|3088406_3089411_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
WP_032206397.1|3089407_3090373_+	sugar kinase	NA	NA	NA	NA	NA
WP_000434038.1|3090346_3091093_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001351455.1|3091144_3091963_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.5	1.7e-24
WP_000822286.1|3092027_3092828_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_032206395.1|3092824_3093613_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000019944.1|3093835_3094108_-	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000134582.1|3094227_3095052_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_032206009.1|3095270_3095609_+	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_032206010.1|3095690_3096725_-	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_000677393.1|3099235_3099910_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_032206011.1|3099989_3100532_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001324851.1|3100822_3101104_-	YehE family protein	NA	NA	NA	NA	NA
WP_001005448.1|3101366_3102476_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001295427.1|3102607_3104641_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
WP_032206012.1|3104781_3108576_+	WGR and DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_000636939.1|3112279_3112597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032206972.1|3112903_3113992_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_032206971.1|3114002_3116282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001292764.1|3116274_3117411_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	8.5e-163
WP_000088311.1|3118930_3119233_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_060552884.1|3119268_3120087_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.9	7.7e-65
WP_032207041.1|3120799_3121261_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	9.2e-76
WP_032207043.1|3121300_3121771_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	1.1e-81
WP_000598641.1|3121817_3122537_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_032207044.1|3124732_3124981_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	82.9	3.4e-32
WP_001121225.1|3125575_3126226_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_000491544.1|3126450_3127326_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	97.9	9.7e-159
WP_047087983.1|3127465_3127735_-|tail	phage tail protein	tail	Q6H9S8	Enterobacteria_phage	95.5	1.6e-43
WP_106918807.1|3128259_3129416_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	4.7e-68
WP_000499454.1|3129849_3130008_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_122998106.1|3130093_3130837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032160865.1|3131724_3131847_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|3132183_3133143_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028854.1|3133354_3134020_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_032208532.1|3134016_3134628_-	recombination protein NinG	NA	Q716C3	Shigella_phage	96.6	3.7e-96
WP_032208534.1|3134620_3134791_-	protein ninF	NA	K7PMD9	Enterobacterial_phage	96.4	1.6e-25
WP_001254257.1|3134787_3134970_-	NinE family protein	NA	A0A0P0ZC71	Stx2-converting_phage	100.0	4.3e-29
WP_064756364.1|3134966_3135464_-	phage N-6-adenine-methyltransferase	NA	K7PJZ4	Enterobacterial_phage	100.0	5.4e-90
WP_029208472.1|3137246_3137948_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	3.9e-102
WP_001216963.1|3138007_3138115_+	protein YohO	NA	NA	NA	NA	NA
WP_032206266.1|3138095_3138827_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_032206267.1|3138831_3139758_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G9BWD6	Planktothrix_phage	34.6	9.7e-24
WP_032206269.1|3139750_3140908_-	glycine betaine ABC transporter permease YehY	NA	NA	NA	NA	NA
WP_001130307.1|3140914_3141832_-	glycine betaine ABC transporter substrate-binding protein OsmF	NA	NA	NA	NA	NA
WP_032206270.1|3142042_3144340_-	beta-glucosidase BglX	NA	NA	NA	NA	NA
WP_032206271.1|3144535_3146251_+	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_032206272.1|3146289_3147222_-	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_001295454.1|3147395_3147983_-	YIP1 family protein	NA	NA	NA	NA	NA
WP_001307896.1|3148152_3148731_+	DedA family protein	NA	NA	NA	NA	NA
WP_000079520.1|3148860_3149622_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_122993082.1|3149674_3151201_-	multidrug resistance outer membrane protein MdtQ	NA	NA	NA	NA	NA
WP_000691708.1|3151334_3151418_+	protein YohP	NA	NA	NA	NA	NA
WP_032206306.1|3151805_3152756_-|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
WP_032206274.1|3152994_3153393_+	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_000968208.1|3153389_3154085_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
>prophage 16
NZ_CP013029	Escherichia coli strain 2012C-4227 chromosome, complete genome	5202850	3979447	4038965	5202850	transposase,tRNA,protease	Enterobacteria_phage(37.5%)	58	NA	NA
WP_000786911.1|3979447_3980167_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_032207716.1|3980327_3981380_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_032207717.1|3981407_3981683_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_032207718.1|3981747_3982827_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_032207719.1|3983028_3984285_+	nucleoside permease NupG	NA	NA	NA	NA	NA
WP_032207721.1|3984334_3986470_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_032207724.1|3986867_3987557_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_106888188.1|3989223_3990496_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	98.0	4.9e-175
WP_001145628.1|3991802_3992441_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	42.7	9.0e-45
WP_032208610.1|3992638_3993223_+	bfpT-regulated chaperone	NA	NA	NA	NA	NA
WP_032208608.1|3993467_3994211_-	type III secretion system LEE effector EspF	NA	NA	NA	NA	NA
WP_000245867.1|3994426_3994705_-	EscG/YscG/SsaH family type III secretion system needle protein co-chaperone	NA	NA	NA	NA	NA
WP_001053840.1|3994710_3994932_-	type III secretion system LEE needle filament protein EscF	NA	NA	NA	NA	NA
WP_000228587.1|3994968_3995376_-	type III secretion system LEE chaperone CesD2	NA	NA	NA	NA	NA
WP_001092012.1|3995382_3996327_-	type III secretion system LEE translocon pore-forming subunit EspB	NA	NA	NA	NA	NA
WP_032208606.1|3996347_3997490_-	type III secretion system translocon subunit SctE	NA	NA	NA	NA	NA
WP_032208605.1|3997502_3998081_-	type III secretion system LEE translocon filament protein EspA	NA	NA	NA	NA	NA
WP_032208604.1|3998138_3999194_-	type III secretion system LEE gatekeeper SepL	NA	NA	NA	NA	NA
WP_000953242.1|3999336_4000557_+	type III secretion system LEE inner membrane ring protein EscD	NA	NA	NA	NA	NA
WP_032208603.1|4000936_4003783_-	intimin type epsilon	NA	NA	NA	NA	NA
WP_000098791.1|4003843_4004314_-	type III secretion system LEE chaperone CesT	NA	NA	NA	NA	NA
WP_032208600.1|4004445_4006062_-	type III secretion system LEE translocated intimin receptor Tir	NA	NA	NA	NA	NA
WP_032208599.1|4006510_4007122_-	T3SS effector protein Map	NA	NA	NA	NA	NA
WP_001005228.1|4007390_4007750_+	Tir chaperone family protein	NA	NA	NA	NA	NA
WP_001374266.1|4007968_4008484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032208598.1|4008514_4009432_-	type III secretion system protein SepQ	NA	NA	NA	NA	NA
WP_001443671.1|4009394_4009811_-	DUF1106 domain-containing protein	NA	NA	NA	NA	NA
WP_001062953.1|4009803_4010124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000622550.1|4010183_4011524_-	type III secretion system LEE ATPase EscN	NA	NA	NA	NA	NA
WP_032208597.1|4011507_4013535_-	type III secretion system LEE export apparatus protein EscV	NA	NA	NA	NA	NA
WP_001050414.1|4013531_4013885_-	type III secretion system LEE chaperone CesL	NA	NA	NA	NA	NA
WP_032208595.1|4014069_4014366_+	type III secretion system protein SepZ	NA	NA	NA	NA	NA
WP_001059795.1|4014449_4014827_+	type III secretion system inner rod subunit SctI	NA	NA	NA	NA	NA
WP_001233824.1|4014828_4015401_+	type III secretion system LEE inner membrane ring protein EscJ	NA	NA	NA	NA	NA
WP_001063688.1|4015406_4015862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000723928.1|4015861_4017400_+	type III secretion system LEE outer membrane ring protein EscC	NA	D0U184	Enterobacteria_phage	28.9	2.0e-10
WP_000087469.1|4017413_4017869_+	type III secretion system LEE chaperone CesD	NA	NA	NA	NA	NA
WP_000444181.1|4018254_4018668_-	type III secretion system LEE transcriptional regulator GrlA	NA	NA	NA	NA	NA
WP_032208593.1|4018742_4019099_-	negative regulator GrlR	NA	NA	NA	NA	NA
WP_032208616.1|4019295_4019754_+	type III secretion system LEE muramidase EtgA	NA	NA	NA	NA	NA
WP_001291686.1|4019750_4020788_-	type III secretion system LEE export apparatus switch protein EscU	NA	NA	NA	NA	NA
WP_001002808.1|4020780_4021557_-	type III secretion system LEE export apparatus protein EscT	NA	NA	NA	NA	NA
WP_000447503.1|4021556_4021826_-	type III secretion system LEE export apparatus protein EscS	NA	NA	NA	NA	NA
WP_001299990.1|4021825_4022479_-	type III secretion system LEE export apparatus protein EscR	NA	NA	NA	NA	NA
WP_032208591.1|4022483_4023137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000153999.1|4023123_4023723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000084152.1|4023719_4024034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000628726.1|4024046_4024265_-	type III secretion system LEE co-chaperone EscE	NA	NA	NA	NA	NA
WP_001365456.1|4024279_4024651_-	type III secretion system LEE master regulator Ler	NA	NA	NA	NA	NA
WP_122993095.1|4025858_4027004_+	secretion protein EspG	NA	NA	NA	NA	NA
WP_050439365.1|4027185_4027968_+	YjiK family protein	NA	NA	NA	NA	NA
WP_077744848.1|4028173_4028791_+	T3SS effector protein EspS	NA	A0A0P0ZCT1	Stx2-converting_phage	77.2	4.5e-78
WP_129014762.1|4028795_4030068_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	98.0	1.1e-174
WP_032207120.1|4031110_4035202_+|protease	serine protease autotransporter EspI	protease	Q9LA58	Enterobacterial_phage	44.6	6.8e-311
WP_000088311.1|4035748_4036051_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_060552861.1|4036086_4036905_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.9	1.5e-65
WP_000854916.1|4037063_4037441_+	toxin	NA	NA	NA	NA	NA
WP_106888148.1|4037752_4038965_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.0	4.2e-168
>prophage 17
NZ_CP013029	Escherichia coli strain 2012C-4227 chromosome, complete genome	5202850	4307536	4371480	5202850	transposase,tRNA,protease	uncultured_Mediterranean_phage(18.18%)	57	NA	NA
WP_000639208.1|4307536_4307842_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000979880.1|4307917_4308382_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_000209007.1|4308378_4309254_-	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_000054239.1|4309250_4309940_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_000108473.1|4309987_4311478_-	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.9	4.9e-09
WP_000224714.1|4311587_4312481_-	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_032208179.1|4312602_4313394_-	transcriptional regulator NanR	NA	NA	NA	NA	NA
WP_032208181.1|4313773_4315141_+	anaerobic C4-dicarboxylate transporter DcuC	NA	NA	NA	NA	NA
WP_000366129.1|4315183_4315681_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	42.9	3.3e-26
WP_032208183.1|4315686_4316325_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_000829818.1|4316719_4317112_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_000847559.1|4317127_4317556_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_001192305.1|4317774_4318902_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_001295270.1|4319095_4319494_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_001295271.1|4319647_4321015_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
WP_000497723.1|4321104_4322172_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
WP_012565174.1|4322234_4323173_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_032208186.1|4323607_4324078_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_000695690.1|4324442_4324706_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_001029013.1|4324761_4325034_-	barnase inhibitor	NA	NA	NA	NA	NA
WP_032208188.1|4325125_4327093_-	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_000854021.1|4327098_4328031_-	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_000051841.1|4328038_4328242_-	AaeX family protein	NA	NA	NA	NA	NA
WP_000440317.1|4328424_4329354_+	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_000055909.1|4329481_4330927_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_032208189.1|4331082_4334883_-	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
WP_000123197.1|4334950_4336420_-	ribonuclease G	NA	NA	NA	NA	NA
WP_000203096.1|4336409_4337003_-	nucleoside triphosphate pyrophosphatase YhdE	NA	NA	NA	NA	NA
WP_000179409.1|4337011_4337500_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_000802516.1|4337499_4338603_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_000913396.1|4338668_4339712_-	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
WP_001241456.1|4340016_4341957_-	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_032208190.1|4342108_4343083_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000354622.1|4344815_4345286_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_000884639.1|4345296_4346646_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_000787051.1|4346737_4347784_-	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_000048610.1|4347780_4348743_-	sugar kinase	NA	NA	NA	NA	NA
WP_050439359.1|4348739_4349753_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000132908.1|4349753_4351253_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.8	5.8e-18
WP_032208192.1|4351313_4352204_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_060552893.1|4352239_4353094_-	tagatose bisphosphate family class II aldolase	NA	NA	NA	NA	NA
WP_000843960.1|4353435_4354266_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.0	1.2e-09
WP_001446002.1|4354297_4355233_+	sugar kinase	NA	NA	NA	NA	NA
WP_001446003.1|4355325_4355568_+	YhdT family protein	NA	NA	NA	NA	NA
WP_032208194.1|4355557_4357009_+	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_032208195.1|4357020_4357902_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_001219652.1|4358230_4359196_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_000462905.1|4359221_4359518_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_032208196.1|4359603_4360488_+	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.2	5.4e-24
WP_001355779.1|4360571_4360751_+	DUF2556 family protein	NA	NA	NA	NA	NA
WP_001129518.1|4360753_4361416_-	multidrug efflux transporter transcriptional repressor AcrS	NA	NA	NA	NA	NA
WP_000160337.1|4361814_4362972_+	multidrug efflux RND transporter periplasmic adaptor subunit AcrE	NA	NA	NA	NA	NA
WP_000825639.1|4366339_4366561_+	membrane protein	NA	NA	NA	NA	NA
WP_000738579.1|4366991_4368017_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	2.4e-71
WP_032208197.1|4368084_4369266_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_106888148.1|4369322_4370535_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.0	4.2e-168
WP_060552885.1|4370661_4371480_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	2.0e-65
>prophage 18
NZ_CP013029	Escherichia coli strain 2012C-4227 chromosome, complete genome	5202850	4454544	4497721	5202850	tRNA,integrase,terminase,head,transposase,capsid,holin,tail	Stx2-converting_phage(43.9%)	49	4456676:4456692	4490455:4490471
WP_000918363.1|4454544_4455960_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
WP_000235516.1|4456042_4457026_+	quinone oxidoreductase	NA	NA	NA	NA	NA
4456676:4456692	attL	GTGGTGTACGATTCCGT	NA	NA	NA	NA
WP_000891404.1|4457191_4457434_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000543841.1|4457567_4458605_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332258.1|4458693_4459791_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.2	8.1e-211
WP_047618033.1|4459852_4460101_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	96.3	5.0e-36
WP_001143783.1|4460261_4460903_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.5	1.3e-107
WP_072140863.1|4460984_4461614_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001118085.1|4461681_4462263_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	54.8	2.7e-48
WP_047619066.1|4462373_4462643_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	94.4	3.9e-42
WP_060552894.1|4462644_4463958_-|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.2	3.1e-76
WP_060552836.1|4464022_4464622_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	95.5	2.9e-106
WP_060552895.1|4464688_4468168_-	host specificity protein J	NA	Q687E8	Enterobacteria_phage	94.8	0.0e+00
WP_122993104.1|4468413_4469046_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	93.8	3.4e-105
WP_060552896.1|4468991_4469735_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.2	3.3e-147
WP_001357740.1|4469740_4470439_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_000807944.1|4470438_4470780_-|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	98.2	1.2e-61
WP_060552897.1|4470772_4474015_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	92.6	0.0e+00
WP_122993099.1|4474062_4474272_-	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	98.6	3.3e-33
WP_001030063.1|4474367_4474742_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275477.1|4474747_4475464_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.2	1.9e-128
WP_000133391.1|4475530_4475875_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_000573374.1|4475871_4476318_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007905.1|4476314_4476665_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_047619202.1|4476674_4477001_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	99.1	3.5e-53
WP_032274028.1|4479041_4479263_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	9.9e-36
WP_047619207.1|4479307_4481245_-|capsid	phage major capsid protein	capsid	A0A0P0ZAJ3	Stx2-converting_phage	96.7	0.0e+00
WP_060552898.1|4481308_4482970_-|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.7	0.0e+00
WP_000958416.1|4482966_4483530_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_024224188.1|4483817_4484183_-	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	97.5	5.4e-63
WP_000095741.1|4484224_4484425_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	98.5	4.3e-30
WP_001283921.1|4484717_4484975_-	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000839224.1|4484971_4485469_-	DNA-binding protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_001135289.1|4486105_4486603_-	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	97.0	2.4e-90
WP_000411802.1|4486602_4486809_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_060552899.1|4487101_4488952_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.5	0.0e+00
WP_060552900.1|4489522_4489954_-	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	98.6	8.7e-68
WP_047619196.1|4490143_4490353_-	hypothetical protein	NA	K7PJU3	Enterobacteria_phage	65.2	2.7e-19
WP_047619199.1|4490405_4490630_-	hypothetical protein	NA	NA	NA	NA	NA
4490455:4490471	attR	ACGGAATCGTACACCAC	NA	NA	NA	NA
WP_047619201.1|4491043_4491532_-	antiterminator	NA	H6WZJ5	Escherichia_phage	99.4	1.6e-89
WP_106888148.1|4492250_4493463_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.0	4.2e-168
WP_000088311.1|4493941_4494244_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001014286.1|4494364_4494553_+	hypothetical protein	NA	G9L660	Escherichia_phage	92.1	2.2e-23
WP_047087994.1|4494555_4495224_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	49.6	5.5e-61
WP_001061348.1|4495223_4495796_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	99.5	1.2e-109
WP_001093921.1|4495832_4496114_+	hypothetical protein	NA	K7PGU0	Enterobacteria_phage	95.7	4.1e-42
WP_014640052.1|4496374_4496761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077249875.1|4496790_4497336_-	SocA family protein	NA	NA	NA	NA	NA
WP_071887528.1|4497586_4497721_-|tRNA	tRNA-dihydrouridine synthase	tRNA	NA	NA	NA	NA
>prophage 1
NZ_CP013028	Escherichia coli strain 2012C-4227 plasmid unnamed1, complete sequence	74656	52492	61973	74656	transposase,protease	Acinetobacter_phage(28.57%)	7	NA	NA
WP_000336626.1|52492_53311_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	9.0e-66
WP_077744811.1|53216_53723_+	chromosome partitioning protein ParB	NA	Q1MVJ4	Enterobacteria_phage	52.9	3.3e-26
WP_010375835.1|53861_54044_-	DUF4113 domain-containing protein	NA	A0A1W6JNT0	Morganella_phage	55.4	8.2e-12
WP_047618801.1|54451_58351_-|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.3	3.2e-238
WP_106888148.1|59299_60513_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.0	4.2e-168
WP_000088311.1|60816_61119_+|transposase	transposase	transposase	Q716C1	Shigella_phage	31.3	1.1e-05
WP_060552797.1|61154_61973_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.9	4.5e-65
>prophage 1
NZ_CP013030	Escherichia coli strain 2012C-4227 plasmid unnamed2, complete sequence	97704	0	34440	97704	tail,holin	Escherichia_phage(54.55%)	35	NA	NA
WP_001187870.1|510_1311_-	protein kilA	NA	Q1MVK4	Enterobacteria_phage	99.2	2.1e-147
WP_001749377.1|1474_2512_-	hypothetical protein	NA	Q71TN2	Escherichia_phage	92.8	7.0e-172
WP_071887565.1|2508_2730_-	host cell division inhibitor Icd-like protein	NA	A0A077SLM6	Escherichia_phage	97.3	2.4e-37
WP_000120523.1|3130_3805_+	hypothetical protein	NA	Q71TC4	Escherichia_phage	94.0	6.8e-19
WP_000846124.1|4076_4346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060552916.1|4404_4971_+	hypothetical protein	NA	Q1MVL0	Enterobacteria_phage	98.4	6.2e-98
WP_000523980.1|4981_5593_+	hypothetical protein	NA	Q71TN8	Escherichia_phage	99.5	2.9e-109
WP_000926345.1|5607_6489_+	hypothetical protein	NA	A0A1B0VBL3	Salmonella_phage	99.7	3.7e-174
WP_000440158.1|6570_9903_+	lytic transglycosylase domain-containing protein	NA	A0A077SK38	Escherichia_phage	89.9	0.0e+00
WP_000002800.1|9902_10259_+	hypothetical protein	NA	Q71TP1	Escherichia_phage	100.0	1.0e-61
WP_001561130.1|10255_11689_+	hypothetical protein	NA	A0A1B0VAD6	Salmonella_phage	99.8	1.4e-271
WP_001189831.1|11688_12525_+	hypothetical protein	NA	A0A077SLH5	Escherichia_phage	98.9	1.7e-152
WP_001286326.1|12603_13038_+	hypothetical protein	NA	A0A077SLL3	Escherichia_phage	100.0	3.3e-75
WP_060552917.1|13049_15899_+|tail	phage tail protein	tail	Q71TP5	Escherichia_phage	89.5	0.0e+00
WP_000144016.1|15898_16477_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	89.0	7.7e-96
WP_001369353.1|16520_17093_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_024177048.1|17583_17958_-	hypothetical protein	NA	A0A077SL44	Escherichia_phage	63.1	1.0e-24
WP_000887652.1|17848_18178_+|holin	holin	holin	Q37876	Escherichia_phage	100.0	1.3e-52
WP_000580770.1|18174_18618_+	hypothetical protein	NA	A0A077SK09	Escherichia_phage	99.3	2.9e-82
WP_001345482.1|18604_19207_+	hypothetical protein	NA	Q1MVM6	Enterobacteria_phage	100.0	5.4e-100
WP_000434673.1|19208_21128_+	hypothetical protein	NA	A0A1B0V7H1	Salmonella_phage	95.1	0.0e+00
WP_000175481.1|21124_21490_+	hypothetical protein	NA	Q1MVM8	Enterobacteria_phage	98.3	6.7e-45
WP_060552918.1|21502_24490_+	hypothetical protein	NA	A0A1B0VFX4	Salmonella_phage	99.3	0.0e+00
WP_001165936.1|24479_24788_+	hypothetical protein	NA	O21974	Escherichia_phage	97.1	5.4e-48
WP_032283206.1|24819_25914_-	hypothetical protein	NA	Q5QBP2	Enterobacteria_phage	36.3	1.3e-40
WP_000432105.1|25906_26689_-	hypothetical protein	NA	A0A1B0VDP8	Salmonella_phage	100.0	1.9e-145
WP_032283208.1|26695_27373_-	DUF2829 domain-containing protein	NA	A0A1B0VBT1	Salmonella_phage	97.8	1.9e-125
WP_000068870.1|27570_28059_-	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	90.1	2.3e-77
WP_001345478.1|28228_28786_+	lysozyme	NA	Q71TF3	Escherichia_phage	100.0	4.2e-107
WP_001038141.1|28778_29030_+	hypothetical protein	NA	Q71TF4	Escherichia_phage	100.0	6.0e-37
WP_071802376.1|29373_29595_+	host cell division inhibitor Icd-like protein	NA	Q38557	Escherichia_phage	83.6	3.3e-31
WP_060552919.1|29591_30704_+	antirepressor	NA	A0A077SLR9	Escherichia_phage	86.0	4.7e-174
WP_060552920.1|30779_31799_-	hypothetical protein	NA	Q71TR6	Escherichia_phage	99.4	7.8e-184
WP_060552921.1|31791_33501_-	hypothetical protein	NA	Q1MVN6	Enterobacteria_phage	99.6	0.0e+00
WP_158414313.1|33678_34440_+	N-6 DNA methylase	NA	A0A1B0VCE3	Salmonella_phage	98.8	8.8e-140
>prophage 2
NZ_CP013030	Escherichia coli strain 2012C-4227 plasmid unnamed2, complete sequence	97704	38378	97289	97704	terminase,integrase	Escherichia_phage(75.0%)	74	29040:29057	79588:79605
29040:29057	attL	TATTGCTCTAATAAATTT	NA	NA	NA	NA
WP_024220496.1|38378_38819_+	hypothetical protein	NA	A0A077SLF0	Escherichia_phage	99.3	8.5e-79
WP_000747846.1|38815_39064_+	hypothetical protein	NA	Q71TG0	Escherichia_phage	100.0	1.8e-41
WP_001100381.1|39125_40076_+	DUF4935 domain-containing protein	NA	NA	NA	NA	NA
WP_072096992.1|40108_40861_-	hypothetical protein	NA	Q71TG2	Escherichia_phage	92.0	6.5e-119
WP_024222310.1|40939_41500_-	Ref family protein	NA	Q5QBN4	Enterobacteria_phage	94.6	2.8e-95
WP_001224234.1|41745_42057_-	hypothetical protein	NA	A0A077SK03	Escherichia_phage	100.0	1.0e-46
WP_032326486.1|42107_43139_-|integrase	site-specific integrase	integrase	A0A077SLE7	Escherichia_phage	98.5	2.1e-192
WP_000481733.1|43135_43531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000542341.1|43550_43772_-	hypothetical protein	NA	Q5QBN7	Enterobacteria_phage	94.5	1.0e-32
WP_000874157.1|44376_44586_+	hypothetical protein	NA	Q5XLQ8	Enterobacteria_phage	98.6	3.1e-31
WP_000611655.1|44696_45548_+	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	99.3	2.3e-157
WP_060552922.1|45580_46699_-	antirepressor	NA	A0A077SLR9	Escherichia_phage	88.2	2.4e-178
WP_000908421.1|46695_47172_-	host cell division inhibitor Icd-like protein	NA	Q38557	Escherichia_phage	80.3	3.4e-25
WP_000124150.1|47255_48740_-|terminase	terminase	terminase	Q71T61	Escherichia_phage	100.0	1.5e-292
WP_000219616.1|48739_49933_-	hypothetical protein	NA	Q71T62	Escherichia_phage	99.5	5.7e-178
WP_001326849.1|50018_50471_-	late promoter-activating protein	NA	Q71T63	Escherichia_phage	100.0	3.0e-79
WP_032326523.1|50559_51603_-	DUF968 domain-containing protein	NA	A0A077SLM1	Escherichia_phage	98.8	8.2e-205
WP_000113018.1|51630_51810_-	hypothetical protein	NA	Q71TH5	Escherichia_phage	98.3	1.2e-23
WP_001216034.1|51814_52195_-	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A077SK56	Escherichia_phage	100.0	1.1e-63
WP_001190712.1|52194_52416_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_032326524.1|52488_52878_-	DNA repair protein	NA	A0A077SK24	Escherichia_phage	97.7	4.1e-69
WP_001133670.1|53052_53625_+	hypothetical protein	NA	Q71TH9	Escherichia_phage	100.0	6.7e-108
WP_001667237.1|53631_53883_-	DNA polymerase III subunit theta	NA	Q71T70	Escherichia_phage	100.0	7.6e-40
WP_001261545.1|54544_54907_-	hypothetical protein	NA	Q71TI4	Escherichia_phage	99.2	4.9e-56
WP_000057458.1|54903_55578_-	hypothetical protein	NA	A0A077SK55	Escherichia_phage	98.6	1.2e-116
WP_032326525.1|55559_55934_-	hypothetical protein	NA	A0A077SL57	Escherichia_phage	97.6	6.4e-67
WP_000269004.1|55940_56234_-	hypothetical protein	NA	A0A077SK23	Escherichia_phage	92.8	3.1e-45
WP_032326596.1|56412_56646_-	hypothetical protein	NA	A0A1B0V7L5	Salmonella_phage	97.4	3.6e-36
WP_000426669.1|56728_57124_-	hypothetical protein	NA	A0A1I9LJU8	Stx_converting_phage	98.5	4.4e-66
WP_060552923.1|57123_57963_-	DUF551 domain-containing protein	NA	A0A077SK54	Escherichia_phage	64.1	4.0e-93
WP_000951706.1|57959_58169_-	hypothetical protein	NA	A0A077SL56	Escherichia_phage	100.0	4.2e-36
WP_000935430.1|58424_58637_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	88.6	2.2e-32
WP_000403776.1|58682_59042_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	8.0e-59
WP_001018057.1|59708_59999_-	DUF4752 family protein	NA	A0A2I6TCB0	Escherichia_phage	82.3	1.2e-36
WP_023442322.1|59995_60697_-	ead/Ea22-like family protein	NA	A0A0U2QW67	Escherichia_phage	55.8	7.0e-51
WP_023442323.1|60683_60950_-	hypothetical protein	NA	Q1MVG1	Enterobacteria_phage	98.8	4.5e-43
WP_000675643.1|60942_61524_-	hypothetical protein	NA	A0A077SLQ8	Escherichia_phage	100.0	2.0e-112
WP_000021752.1|61718_62225_-	hypothetical protein	NA	Q71T77	Escherichia_phage	97.0	5.0e-91
WP_000107685.1|62298_63561_-	hypothetical protein	NA	A0A1B0V7L1	Salmonella_phage	97.6	4.0e-230
WP_024222347.1|63862_64564_-	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	98.7	2.3e-142
WP_024222346.1|64560_65238_-	serine/threonine protein phosphatase	NA	Q71TJ1	Escherichia_phage	98.7	1.9e-133
WP_029365172.1|65234_65861_-	norphogenetic protein	NA	Q1MVG8	Enterobacteria_phage	99.5	6.1e-123
WP_012817939.1|65758_66421_-	hypothetical protein	NA	Q71T83	Escherichia_phage	100.0	4.5e-124
WP_001561105.1|66362_66518_-	hypothetical protein	NA	Q71TJ4	Escherichia_phage	98.0	2.0e-19
WP_024224109.1|66584_67163_-	norphogenetic protein	NA	Q71T85	Escherichia_phage	92.2	9.8e-99
WP_000840930.1|67165_67411_-	hypothetical protein	NA	A0A1B0VDU5	Salmonella_phage	100.0	1.5e-40
WP_000235786.1|67557_67935_+	hypothetical protein	NA	Q38620	Escherichia_phage	100.0	2.2e-67
WP_001141901.1|67944_69162_+	hypothetical protein	NA	A0A077SL53	Escherichia_phage	99.8	1.9e-224
WP_000896808.1|69165_69894_+	hypothetical protein	NA	Q71TJ9	Escherichia_phage	99.6	1.2e-138
WP_015974270.1|69880_70666_+	hypothetical protein	NA	Q71T90	Escherichia_phage	100.0	9.4e-145
WP_000212015.1|70667_71684_+	hypothetical protein	NA	A0A077SLQ1	Escherichia_phage	99.7	4.5e-192
WP_000535203.1|71676_72309_+	hypothetical protein	NA	A0A077SK50	Escherichia_phage	100.0	6.9e-90
WP_060552924.1|72379_73414_-	antirepressor	NA	Q71TN2	Escherichia_phage	79.4	6.3e-149
WP_000245706.1|73410_73632_-	host cell division inhibitor Icd-like protein	NA	Q38557	Escherichia_phage	82.2	2.1e-30
WP_060552925.1|74011_75010_-	hypothetical protein	NA	A0A077SL52	Escherichia_phage	98.5	7.6e-192
WP_001276599.1|75009_76374_-	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	100.0	2.1e-253
WP_000751806.1|76757_77585_-	hypothetical protein	NA	A0A077SLJ6	Escherichia_phage	99.6	2.8e-131
WP_024222318.1|79594_82882_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A077SL51	Escherichia_phage	98.7	0.0e+00
79588:79605	attR	AAATTTATTAGAGCAATA	NA	NA	NA	NA
WP_000472523.1|82878_83784_-	recombination-associated protein RdgC	NA	A0A077SK17	Escherichia_phage	99.3	5.9e-159
WP_001177859.1|83776_84061_-	hypothetical protein	NA	Q71TA2	Escherichia_phage	98.9	1.7e-48
WP_000890203.1|84523_85312_+	hypothetical protein	NA	A0A1B0V830	Salmonella_phage	89.3	9.2e-108
WP_000007769.1|85351_85774_+	hypothetical protein	NA	A0A1B0VCB0	Salmonella_phage	100.0	2.7e-58
WP_000336812.1|85799_85940_+	hypothetical protein	NA	Q71TL6	Escherichia_phage	100.0	6.3e-20
WP_001281116.1|85951_86344_+	hypothetical protein	NA	A0A077SLJ1	Escherichia_phage	99.2	2.0e-71
WP_032346381.1|86677_87562_+	RepB family plasmid replication initiator protein	NA	A0A1B0VDL5	Salmonella_phage	99.3	4.0e-160
WP_023442332.1|87854_88664_+	GIY-YIG nuclease family protein	NA	A0A077SK46	Escherichia_phage	97.8	2.1e-155
WP_001285362.1|88832_90029_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	100.0	1.6e-225
WP_023442333.1|90045_91047_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	99.7	6.3e-178
WP_023442334.1|91272_92979_+	hypothetical protein	NA	Q1MVJ5	Enterobacteria_phage	99.8	0.0e+00
WP_000085155.1|93039_94629_+	hypothetical protein	NA	A0A1B0V7E4	Salmonella_phage	99.2	6.2e-305
WP_000041774.1|94638_95454_+	hypothetical protein	NA	A0A1B0V835	Salmonella_phage	99.3	9.8e-113
WP_064765777.1|95489_96071_+	hypothetical protein	NA	Q1MVJ8	Enterobacteria_phage	96.9	6.1e-101
WP_001313475.1|96706_96862_-	type I toxin-antitoxin system toxin HokD	NA	A0A1I9LJU7	Stx_converting_phage	92.2	1.0e-15
WP_001426344.1|97043_97289_-	hypothetical protein	NA	A0A1B0VDM5	Salmonella_phage	45.0	3.5e-13
