The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013055	Bacillus thuringiensis strain YWC2-8 chromosome, complete genome	5674369	2898	41107	5674369	tail,portal,terminase,protease,capsid,head,integrase	Bacillus_phage(64.1%)	58	25079:25096	38009:38026
WP_001182260.1|2898_3273_-|head	phage head closure protein	head	A0A2H4JHA9	uncultured_Caudovirales_phage	90.3	1.1e-58
WP_044157418.1|5521_6628_-|portal	phage portal protein	portal	A0A2H4JAJ1	uncultured_Caudovirales_phage	89.9	2.4e-186
WP_000124848.1|8347_8683_-	hypothetical protein	NA	A0A1B1P762	Bacillus_phage	31.2	2.3e-07
WP_000666403.1|8832_9168_-	HNH endonuclease	NA	D2XR61	Bacillus_phage	91.9	1.0e-52
WP_000336221.1|9164_9569_-	hypothetical protein	NA	Q2I8B8	Bacillus_phage	75.0	2.7e-47
WP_000124642.1|9710_9971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001012113.1|10645_11188_-|integrase	site-specific integrase	integrase	W8CYP1	Bacillus_phage	92.2	1.3e-89
WP_000166182.1|11187_11670_-	ArpU family transcriptional regulator	NA	H0USV3	Bacillus_phage	82.5	1.9e-71
WP_000866156.1|11697_11868_-	hypothetical protein	NA	A0A1B0T6D0	Bacillus_phage	80.4	5.0e-11
WP_000525861.1|11983_12265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000032412.1|12493_12661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000234108.1|12763_12946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000365653.1|13132_13351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000872736.1|13450_13600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000404182.1|13637_14036_-	hypothetical protein	NA	W8CYU3	Bacillus_phage	75.0	1.2e-52
WP_000397931.1|14073_14340_-	hypothetical protein	NA	D2XR50	Bacillus_phage	42.7	2.2e-13
WP_000433730.1|14343_14481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000805074.1|14515_14938_-	hypothetical protein	NA	A0A1B1P7B4	Bacillus_phage	82.9	2.3e-65
WP_000387671.1|14962_15361_-	hypothetical protein	NA	A0A068ELY9	Bacillus_phage	79.1	2.8e-57
WP_002134037.1|15412_15598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000665841.1|15642_15855_-	hypothetical protein	NA	A0A1B0T6B5	Bacillus_phage	93.5	1.5e-25
WP_002134040.1|15881_16346_-	hypothetical protein	NA	A0A2H4J8I5	uncultured_Caudovirales_phage	35.4	4.4e-17
WP_000811696.1|16354_16609_-	hypothetical protein	NA	A0A1B0T6B9	Bacillus_phage	88.1	1.4e-36
WP_000805170.1|16623_16797_-	DUF3954 domain-containing protein	NA	A0A1B1P7U5	Bacillus_phage	91.2	2.6e-23
WP_000337986.1|16822_17017_-	hypothetical protein	NA	A0A0U3K3J8	Bacillus_phage	76.6	1.0e-20
WP_000235015.1|17032_17908_-	ATP-binding protein	NA	Q2I8C8	Bacillus_phage	47.2	4.3e-66
WP_000073375.1|17846_18734_-	DnaD domain protein	NA	W8CYG5	Bacillus_phage	41.7	6.8e-43
WP_000364148.1|18740_18917_-	hypothetical protein	NA	A0A1B1P7U0	Bacillus_phage	86.2	2.9e-22
WP_000390314.1|18963_19110_-	hypothetical protein	NA	A0A0U3B230	Bacillus_phage	87.2	1.7e-15
WP_000665325.1|19147_19345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000359729.1|19357_20173_-	hypothetical protein	NA	A0A0S2MV65	Bacillus_phage	81.6	6.1e-123
WP_000788380.1|20189_20345_-	hypothetical protein	NA	A0A1C8E9A0	Bacillus_phage	86.3	8.5e-18
WP_000383685.1|20398_20587_-	hypothetical protein	NA	A0A0S2MV91	Bacillus_phage	100.0	4.5e-29
WP_001042666.1|20600_20855_-	DUF739 family protein	NA	A0A0S2MVA3	Bacillus_phage	98.8	5.5e-38
WP_000435973.1|21040_21520_+	helix-turn-helix transcriptional regulator	NA	A0A0S2MVI1	Bacillus_phage	99.4	6.9e-82
WP_000654304.1|21533_21974_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0S2MV59	Bacillus_phage	97.9	6.5e-79
WP_001123356.1|22000_23068_+|integrase	site-specific integrase	integrase	A0A0S2MV79	Bacillus_phage	99.7	3.3e-201
WP_162841983.1|23133_24675_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.7	8.9e-22
25079:25096	attL	TTACATCATTCCGCCCAT	NA	NA	NA	NA
WP_016090283.1|25391_25601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016090284.1|25613_25943_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_044157420.1|25959_27552_-|terminase	terminase large subunit	terminase	A0A290GJW3	Caldibacillus_phage	52.6	2.8e-156
WP_016090286.1|27604_27952_-	hypothetical protein	NA	A0A290GJQ7	Caldibacillus_phage	43.9	3.9e-18
WP_016090287.1|28078_28369_-	HNH endonuclease	NA	R9TNN2	Paenibacillus_phage	53.2	1.6e-25
WP_016090288.1|28361_28649_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_016090289.1|28715_29978_-|capsid	phage major capsid protein	capsid	NA	NA	NA	NA
WP_016090290.1|29982_30561_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBP9	Clostridium_phage	30.2	2.6e-11
WP_016090291.1|30557_31754_-|portal	phage portal protein	portal	A0A1L2BY94	Clostridium_phage	35.9	5.0e-65
WP_016090292.1|31758_31911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016090293.1|31907_32135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016090294.1|32466_34896_-	DUF927 domain-containing protein	NA	Q4ZE73	Staphylococcus_phage	32.6	2.2e-83
WP_016090295.1|34997_35324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016090296.1|35338_35485_-	hypothetical protein	NA	A0A1B2APZ0	Phage_Wrath	66.7	6.8e-09
WP_016090297.1|35626_35896_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016090298.1|36118_36703_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016090299.1|36751_37930_+|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	62.9	8.0e-140
WP_001029993.1|38008_39643_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	58.0	1.5e-157
38009:38026	attR	TTACATCATTCCGCCCAT	NA	NA	NA	NA
WP_000917311.1|39681_39966_-	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	54.8	1.2e-20
WP_000745326.1|40357_41107_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 2
NZ_CP013055	Bacillus thuringiensis strain YWC2-8 chromosome, complete genome	5674369	650638	727004	5674369	tail,transposase,portal,terminase,protease,holin,capsid,head,integrase	Bacillus_phage(50.0%)	98	666907:666927	709447:709467
WP_001267308.1|650638_651019_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_001127250.1|651175_652105_+	HPr(Ser) kinase/phosphatase	NA	NA	NA	NA	NA
WP_000922850.1|652131_652944_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_002097946.1|653011_653662_+	pyrophosphatase PpaX	NA	NA	NA	NA	NA
WP_001255073.1|653695_654208_+	acyltransferase	NA	NA	NA	NA	NA
WP_000517720.1|654347_655859_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_001288079.1|655944_656901_+	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	53.6	4.0e-89
WP_000455200.1|657066_657873_+	DUF368 domain-containing protein	NA	NA	NA	NA	NA
WP_001190080.1|658102_658561_+	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_000138459.1|658581_659463_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.9	4.6e-07
WP_000712186.1|659466_660420_+	YvcK family protein	NA	A1IMD5	Streptococcus_phage	42.8	1.7e-63
WP_000006560.1|660508_661459_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	38.4	1.7e-52
WP_000250307.1|661482_661731_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001049162.1|662058_662640_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	56.5	1.3e-55
WP_000018924.1|662880_663750_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_000215909.1|663770_663977_-	DUF1657 domain-containing protein	NA	NA	NA	NA	NA
WP_000575919.1|663988_664339_-	stage V sporulation protein AE	NA	NA	NA	NA	NA
WP_000938972.1|664335_665352_-	stage V sporulation protein AD	NA	NA	NA	NA	NA
WP_000095408.1|665352_665829_-	stage V sporulation protein AC	NA	NA	NA	NA	NA
WP_001226064.1|665858_666347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000216166.1|666440_666647_-	DUF1657 domain-containing protein	NA	NA	NA	NA	NA
666907:666927	attL	GTTCGAATCCCTCTGGGCGCG	NA	NA	NA	NA
WP_000135757.1|667061_668198_-|integrase	site-specific integrase	integrase	A8ATX2	Listeria_phage	48.0	6.8e-96
WP_001037137.1|668228_668696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002133807.1|668706_669099_-	helix-turn-helix transcriptional regulator	NA	A0A1Q1PVX8	Staphylococcus_phage	58.5	3.2e-13
WP_000216290.1|669263_669494_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000711864.1|669529_669763_+	DUF771 domain-containing protein	NA	Q9MBW7	Lactococcus_phage	43.5	5.6e-05
WP_000788383.1|669946_670102_+	hypothetical protein	NA	A0A1C8E9A0	Bacillus_phage	90.0	2.2e-18
WP_001016247.1|670116_670872_+	phage regulatory protein	NA	A0A2H4JBC7	uncultured_Caudovirales_phage	83.4	1.9e-110
WP_001187283.1|670883_671072_+	hypothetical protein	NA	A0A2H4J4V8	uncultured_Caudovirales_phage	62.9	2.6e-13
WP_000453495.1|671098_671542_+	hypothetical protein	NA	A0A0S2MVA8	Bacillus_phage	90.5	9.8e-67
WP_015382506.1|671559_672273_+	hypothetical protein	NA	A0A0S2MV99	Bacillus_phage	98.3	1.4e-126
WP_000355713.1|672272_672488_+	hypothetical protein	NA	A0A1C8E9A6	Bacillus_phage	98.6	1.1e-31
WP_033676802.1|672420_672759_+	hypothetical protein	NA	A0A0S2MVH7	Bacillus_phage	97.3	7.5e-51
WP_000510889.1|672852_673806_+	DnaD domain protein	NA	A0A0S2MVA0	Bacillus_phage	90.2	8.4e-148
WP_000933908.1|673817_674297_+	hypothetical protein	NA	A0A1C8E9A8	Bacillus_phage	97.5	4.3e-84
WP_000139235.1|674289_674520_+	hypothetical protein	NA	A0A1C8E9C2	Bacillus_phage	100.0	2.5e-34
WP_001245738.1|674543_675101_+	hypothetical protein	NA	A0A1B1P7A6	Bacillus_phage	70.8	2.0e-64
WP_000775809.1|675139_675574_+	hypothetical protein	NA	A0A2H4JBD8	uncultured_Caudovirales_phage	89.6	2.2e-71
WP_001268031.1|675632_675923_+	hypothetical protein	NA	A0A1C8EA94	Bacillus_phage	93.8	2.5e-50
WP_000492043.1|675927_676068_+	hypothetical protein	NA	A0A1C8E9B6	Bacillus_phage	95.7	2.7e-15
WP_000520932.1|676945_677200_+	hypothetical protein	NA	I7ILU4	Staphylococcus_phage	100.0	1.2e-40
WP_000858114.1|677235_677931_+	hypothetical protein	NA	A0A1I9S6E4	Bacillus_phage	81.5	3.2e-112
WP_000590881.1|677975_678287_+	hypothetical protein	NA	A0A0A7AR06	Bacillus_phage	84.5	1.0e-41
WP_000540086.1|678322_678850_+	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	97.7	4.1e-96
WP_015670520.1|678846_679173_+	hypothetical protein	NA	A0A1C8E9C1	Bacillus_phage	98.1	4.7e-58
WP_003308641.1|679210_679612_+	hypothetical protein	NA	A0A1C8E9D1	Bacillus_phage	99.2	1.1e-67
WP_003308642.1|679621_679771_+	hypothetical protein	NA	A0A1C8E9B8	Bacillus_phage	95.9	1.8e-20
WP_000711194.1|679995_680415_-	HicB family protein	NA	A0A2H4J4X8	uncultured_Caudovirales_phage	79.9	4.5e-61
WP_071686389.1|680466_680649_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0U4KLG1	Pseudomonas_phage	64.9	3.9e-14
WP_000650576.1|680828_681053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000343502.1|681066_681270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001002014.1|681275_681710_+	hypothetical protein	NA	Q2I8B8	Bacillus_phage	61.5	9.8e-19
WP_001177575.1|681778_681988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000378699.1|681994_682252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001177571.1|682242_682617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000666398.1|682582_682918_+	HNH endonuclease	NA	D2XR61	Bacillus_phage	91.0	1.6e-53
WP_000301150.1|683042_683354_+|terminase	terminase	terminase	D2XR14	Bacillus_phage	86.3	4.7e-39
WP_000595321.1|683350_685036_+|terminase	terminase large subunit	terminase	D2XR15	Bacillus_phage	85.7	5.5e-275
WP_000118683.1|685056_686208_+|portal	phage portal protein	portal	A8AT96	Listeria_phage	51.1	1.8e-104
WP_000791073.1|686197_686923_+|protease	Clp protease ClpP	protease	A0A2H4J8Y7	uncultured_Caudovirales_phage	53.2	1.7e-44
WP_000245092.1|686949_688116_+|capsid	phage major capsid protein	capsid	A0A2H4JH29	uncultured_Caudovirales_phage	77.7	9.6e-162
WP_000361981.1|688128_688422_+	hypothetical protein	NA	A0A2H4JG04	uncultured_Caudovirales_phage	76.3	2.7e-36
WP_001247297.1|688423_688774_+|head	phage head closure protein	head	D2XR20	Bacillus_phage	87.9	3.7e-53
WP_000997537.1|688775_689120_+	HK97 gp10 family phage protein	NA	A0A2H4JAH8	uncultured_Caudovirales_phage	80.5	1.7e-45
WP_000219080.1|689116_689452_+	hypothetical protein	NA	A0A2H4JAG4	uncultured_Caudovirales_phage	94.5	3.2e-54
WP_001004920.1|689452_690046_+|tail	phage tail protein	tail	A0A2H4JDV4	uncultured_Caudovirales_phage	91.8	3.7e-101
WP_000415931.1|690052_690415_+	hypothetical protein	NA	A0A2H4JAG8	uncultured_Caudovirales_phage	71.7	1.4e-42
WP_000897021.1|690645_691881_+	hypothetical protein	NA	A0A2H4JAI2	uncultured_Caudovirales_phage	73.1	3.6e-151
WP_002133928.1|692158_694540_+	hypothetical protein	NA	A0A2H4JC82	uncultured_Caudovirales_phage	44.1	3.7e-43
WP_015382503.1|694581_696051_+	hypothetical protein	NA	A0A0S2MV63	Bacillus_phage	80.2	2.6e-236
WP_015382502.1|696047_700430_+	phage minor structural protein	NA	A0A0S2MVB4	Bacillus_phage	58.4	0.0e+00
WP_016090170.1|700446_700818_+	hypothetical protein	NA	A0A0S2MVE0	Bacillus_phage	58.4	2.2e-35
WP_000499524.1|700938_702132_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	25.1	1.2e-23
WP_042991251.1|702426_702870_+|holin	phage holin family protein	holin	A0A0S2MVC4	Bacillus_phage	97.8	1.8e-68
WP_000499524.1|702931_704125_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	25.1	1.2e-23
WP_000405783.1|704422_705358_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2MVR5	Bacillus_phage	82.3	1.8e-155
WP_000993515.1|705561_706677_+	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	54.9	4.0e-109
WP_000734384.1|706676_706895_+	hypothetical protein	NA	A0A2H4JBB8	uncultured_Caudovirales_phage	73.8	1.7e-16
WP_000742864.1|707073_707640_-	hypothetical protein	NA	A6XML2	Bacillus_virus	45.7	4.8e-26
WP_001016121.1|707783_708002_+	hypothetical protein	NA	A0A2H4JC50	uncultured_Caudovirales_phage	93.1	7.3e-31
WP_001273481.1|708026_708320_+	hypothetical protein	NA	A0A1C8E992	Bacillus_phage	87.6	2.7e-41
WP_000412580.1|708335_709163_-	hypothetical protein	NA	A0A1C8EA76	Bacillus_phage	90.9	7.6e-137
WP_000647955.1|709725_711033_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
709447:709467	attR	GTTCGAATCCCTCTGGGCGCG	NA	NA	NA	NA
WP_000869730.1|711042_711288_+	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_001258185.1|711423_712452_+	gapA transcriptional regulator CggR	NA	NA	NA	NA	NA
WP_000161236.1|712478_713483_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_001036350.1|713622_714807_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_001231038.1|714839_715595_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_001231158.1|715591_717121_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_000103951.1|717151_718447_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	75.4	1.1e-182
WP_001125064.1|718498_719449_-	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_000673222.1|719801_720170_+|holin	CidA/LrgA family holin-like protein	holin	NA	NA	NA	NA
WP_000078304.1|720166_720859_+	LrgB family protein	NA	NA	NA	NA	NA
WP_000557264.1|720953_721187_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_000761976.1|721348_722089_+	carboxylesterase	NA	NA	NA	NA	NA
WP_000391097.1|722231_724670_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	40.6	1.7e-91
WP_001123919.1|724796_725264_+	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	63.2	5.4e-47
WP_000915084.1|726071_727004_-|holin	choline-binding protein A	holin	NA	NA	NA	NA
>prophage 3
NZ_CP013055	Bacillus thuringiensis strain YWC2-8 chromosome, complete genome	5674369	858563	952481	5674369	tail,transposase,tRNA,portal,terminase,protease,holin,coat,capsid,head,integrase	Bacillus_phage(79.69%)	102	871149:871168	957936:957955
WP_000241505.1|858563_859676_-|protease	cysteine protease StiP family protein	protease	NA	NA	NA	NA
WP_000856300.1|859681_861028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001106091.1|860972_862076_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_000351148.1|862238_862766_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000665094.1|862789_863281_-	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	53.8	3.5e-41
WP_000614218.1|863401_864403_+|coat	spore coat protein CotS	coat	NA	NA	NA	NA
WP_001125494.1|864464_864680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000431159.1|864874_865111_-	NifU family protein	NA	Q58MC7	Prochlorococcus_phage	46.6	2.0e-10
WP_000248588.1|865306_865615_+	YuzD family protein	NA	NA	NA	NA	NA
WP_002101505.1|865667_866462_+	DUF4111 domain-containing protein	NA	NA	NA	NA	NA
WP_000049707.1|866584_867253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002101500.1|867303_867942_-	DUF4304 domain-containing protein	NA	NA	NA	NA	NA
WP_000843107.1|867928_868399_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_000383681.1|868488_868743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000607080.1|868779_869163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003285671.1|869451_870249_+	DUF2628 domain-containing protein	NA	NA	NA	NA	NA
WP_000622258.1|870318_870600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000212737.1|870759_871101_+	alkylphosphonate utilization operon protein PhnA	NA	NA	NA	NA	NA
871149:871168	attL	TTTTGTCGGTAAATCGATAT	NA	NA	NA	NA
WP_000679246.1|871321_872119_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_000470265.1|872102_872762_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.7	1.3e-22
WP_001054089.1|872817_872991_-	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
WP_000682077.1|873224_874295_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000595026.1|874641_874881_+	YuzB family protein	NA	NA	NA	NA	NA
WP_000077397.1|875149_876016_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_000573825.1|876057_876411_+	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	43.3	3.7e-16
WP_087942842.1|876492_877838_-|transposase	IS3-like element ISBth10 family transposase	transposase	A0A1B1P773	Bacillus_phage	74.4	3.6e-112
WP_000834606.1|878263_879028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000833145.1|879651_880005_+	YxeA family protein	NA	A0A0K2CYS5	Paenibacillus_phage	39.7	4.5e-14
WP_000237487.1|880093_881155_-|integrase	site-specific integrase	integrase	A0A1B2AQ00	Phage_Wrath	83.9	3.5e-171
WP_000896931.1|882117_882348_+	hypothetical protein	NA	H0UST5	Bacillus_phage	90.8	8.5e-30
WP_001164934.1|882515_883646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000005253.1|884048_884378_-	helix-turn-helix transcriptional regulator	NA	H0UST7	Bacillus_phage	97.2	5.6e-51
WP_000368216.1|884625_884871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000277643.1|885015_885204_+	helix-turn-helix domain-containing protein	NA	A0A1B2APY7	Phage_Wrath	80.6	2.6e-21
WP_000788369.1|885220_885376_+	hypothetical protein	NA	I7J4K2	Bacillus_phage	86.3	2.7e-19
WP_000960416.1|885521_886238_+	hypothetical protein	NA	Q3HL19	Bacillus_phage	78.2	6.4e-100
WP_000218620.1|886399_886714_+	hypothetical protein	NA	A0A0S2GLB6	Bacillus_phage	100.0	1.1e-51
WP_015382495.1|886988_887636_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0S2GLJ1	Bacillus_phage	99.5	8.9e-117
WP_015382176.1|887859_888876_+	hypothetical protein	NA	A0A0S2GLI6	Bacillus_phage	100.0	2.8e-189
WP_002133989.1|888838_889651_+	ATP-binding protein	NA	A0A0S2GLK2	Bacillus_phage	100.0	1.2e-155
WP_000436951.1|889692_889959_+	hypothetical protein	NA	A0A0S2GLK4	Bacillus_phage	100.0	7.7e-43
WP_000817807.1|890030_890195_+	DUF3954 domain-containing protein	NA	A0A0S2GLF5	Bacillus_phage	100.0	1.0e-24
WP_001025406.1|890212_890428_+	hypothetical protein	NA	A0A0S2GLC6	Bacillus_phage	100.0	8.7e-37
WP_000705118.1|890424_890724_-	hypothetical protein	NA	A0A0S2GLD6	Bacillus_phage	100.0	1.9e-50
WP_038413787.1|890874_891174_+	hypothetical protein	NA	A0A0S2GLL5	Bacillus_phage	99.0	1.8e-51
WP_000404184.1|891527_891935_+	hypothetical protein	NA	A0A0S2GLF8	Bacillus_phage	100.0	4.9e-73
WP_000965619.1|893343_893625_+	hypothetical protein	NA	A0A0S2GLD3	Bacillus_phage	100.0	8.7e-45
WP_000866514.1|893790_893955_+	hypothetical protein	NA	W8CYZ7	Bacillus_phage	100.0	5.0e-16
WP_000166155.1|893982_894468_+	ArpU family transcriptional regulator	NA	A0A0S2GLJ9	Bacillus_phage	99.4	1.8e-85
WP_001012176.1|894464_895007_+|integrase	site-specific integrase	integrase	A0A0S2GLG4	Bacillus_phage	100.0	3.3e-96
WP_015382276.1|895213_895459_+	hypothetical protein	NA	W8CYG8	Bacillus_phage	97.5	6.5e-36
WP_000017440.1|895861_896149_+	hypothetical protein	NA	H0USV6	Bacillus_phage	91.6	1.7e-43
WP_000464752.1|896185_896413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000443965.1|896458_896638_+	hypothetical protein	NA	W8CYF7	Bacillus_phage	98.3	6.0e-23
WP_000002725.1|896672_896912_+	hypothetical protein	NA	W8CZ42	Bacillus_phage	93.7	1.1e-16
WP_000773601.1|896928_897141_+	hypothetical protein	NA	H0USV9	Bacillus_phage	97.1	1.0e-29
WP_001139454.1|897519_897897_+	HNH endonuclease	NA	A0A0S2GLI5	Bacillus_phage	94.4	2.1e-65
WP_000233390.1|898026_898530_+|terminase	phage terminase small subunit P27 family	terminase	A0A0S2GLF2	Bacillus_phage	99.4	1.0e-88
WP_000621131.1|898531_900226_+|terminase	terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	99.6	0.0e+00
WP_000577489.1|900414_901668_+|portal	phage portal protein	portal	A0A0S2GLJ4	Bacillus_phage	99.3	1.7e-241
WP_001259159.1|901654_902365_+|protease	Clp protease ClpP	protease	W8CYT5	Bacillus_phage	95.8	2.4e-123
WP_000361137.1|902402_903569_+|capsid	phage major capsid protein	capsid	W8CYN2	Bacillus_phage	96.6	4.0e-208
WP_000244586.1|903589_903877_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	100.0	1.8e-45
WP_015382490.1|903863_904187_+|head	phage head closure protein	head	H0USW8	Bacillus_phage	99.1	3.3e-56
WP_000763219.1|904179_904614_+	HK97 gp10 family phage protein	NA	H0USW9	Bacillus_phage	100.0	1.8e-76
WP_000609194.1|904610_904970_+	DUF3168 domain-containing protein	NA	H0USX0	Bacillus_phage	96.6	2.5e-60
WP_000896769.1|904970_905579_+|tail	tail protein	tail	W8CYT6	Bacillus_phage	94.1	1.3e-98
WP_015382489.1|905625_905943_+	hypothetical protein	NA	W8CYN3	Bacillus_phage	97.1	4.9e-52
WP_000344049.1|905972_906149_+	hypothetical protein	NA	W8CYG0	Bacillus_phage	100.0	6.7e-27
WP_015382488.1|906163_910087_+|tail	phage tail tape measure protein	tail	I3WTY6	Bacillus_phage	99.3	0.0e+00
WP_000517105.1|910101_911583_+|tail	phage tail protein	tail	W8CYY9	Bacillus_phage	99.6	5.4e-295
WP_001260185.1|911579_915605_+	hypothetical protein	NA	H0USX5	Bacillus_phage	93.6	0.0e+00
WP_000373903.1|916029_916455_+|holin	phage holin family protein	holin	H0USX7	Bacillus_phage	97.2	7.0e-70
WP_000405777.1|916454_917156_+	N-acetylmuramoyl-L-alanine amidase	NA	W8CZ46	Bacillus_phage	89.8	6.4e-121
WP_000119484.1|919132_919471_-	hypothetical protein	NA	A0A1B1P7R0	Bacillus_phage	92.9	4.6e-48
WP_000043398.1|919524_920103_-	type IV secretory system conjugative DNA transfer family protein	NA	H0USX9	Bacillus_phage	88.5	2.2e-95
WP_001137905.1|920108_920288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000649833.1|920296_920494_-	helix-turn-helix transcriptional regulator	NA	A0A288WG80	Bacillus_phage	76.2	3.4e-19
WP_001257569.1|920676_920994_+	hypothetical protein	NA	H0USY0	Bacillus_phage	98.1	6.4e-52
WP_000170777.1|920990_921173_+	hypothetical protein	NA	Q2I8E2	Bacillus_phage	90.0	1.4e-22
WP_000891535.1|921288_922470_+	cell division protein FtsK	NA	H0USY1	Bacillus_phage	94.4	9.0e-216
WP_000551103.1|922411_923032_+	hypothetical protein	NA	H0USY2	Bacillus_phage	93.2	6.5e-109
WP_000710530.1|923041_923869_-	hypothetical protein	NA	A0A2H4J6G7	uncultured_Caudovirales_phage	69.5	1.8e-101
WP_000635484.1|924191_924653_-	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_000535259.1|924732_925614_+	decarboxylase	NA	NA	NA	NA	NA
WP_000391942.1|925631_926879_-	MFS transporter	NA	NA	NA	NA	NA
WP_000902159.1|927044_927524_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000815771.1|927994_937966_+	DUF11 domain-containing protein	NA	NA	NA	NA	NA
WP_000829788.1|938078_939068_-	NAD(P)/FAD-dependent oxidoreductase	NA	Q9JRK7	Streptococcus_phage	52.4	3.0e-31
WP_000856612.1|939529_940738_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000415321.1|940861_941368_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000027016.1|941364_941682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000920098.1|941768_942395_+	3D domain-containing protein	NA	A0A0H3UZG2	Geobacillus_virus	42.1	6.1e-14
WP_000487942.1|942554_944039_+	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.9	8.7e-59
WP_000545253.1|944213_944819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001104221.1|944962_946687_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	53.5	1.6e-176
WP_002097988.1|946794_947682_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	54.1	7.0e-80
WP_001252163.1|947727_948321_-	biotin transporter BioY	NA	NA	NA	NA	NA
WP_000810336.1|948371_949115_-	DUF3298 and DUF4163 domain-containing protein	NA	NA	NA	NA	NA
WP_001140612.1|949210_949594_+	hotdog fold thioesterase	NA	NA	NA	NA	NA
WP_087942833.1|949648_950991_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	37.3	6.3e-32
WP_000287147.1|951104_952481_-|tRNA	glycine--tRNA ligase	tRNA	A0A1V0SIF1	Klosneuvirus	27.9	5.8e-49
957936:957955	attR	ATATCGATTTACCGACAAAA	NA	NA	NA	NA
>prophage 4
NZ_CP013055	Bacillus thuringiensis strain YWC2-8 chromosome, complete genome	5674369	1302324	1310010	5674369		Bacillus_phage(33.33%)	10	NA	NA
WP_001036847.1|1302324_1303308_+	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	27.2	2.5e-17
WP_000403760.1|1303297_1304068_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.6	7.6e-14
WP_001086121.1|1304100_1304865_+	class B sortase	NA	NA	NA	NA	NA
WP_000587826.1|1304937_1305261_-	heme oxygenase	NA	NA	NA	NA	NA
WP_001255971.1|1305556_1306756_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	41.2	1.6e-71
WP_001014310.1|1306794_1306989_-	YwbE family protein	NA	NA	NA	NA	NA
WP_001293578.1|1306989_1307163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000018029.1|1307331_1308024_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.2	3.7e-36
WP_000609140.1|1308025_1308961_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	24.8	9.2e-22
WP_000221066.1|1309086_1310010_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	43.5	1.5e-45
>prophage 5
NZ_CP013055	Bacillus thuringiensis strain YWC2-8 chromosome, complete genome	5674369	1342325	1403632	5674369	protease,coat,transposase,tRNA	Klosneuvirus(22.22%)	57	NA	NA
WP_001236345.1|1342325_1343555_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	49.4	4.5e-85
WP_000919605.1|1343907_1344579_+	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_000774010.1|1344854_1345664_+	glutamate racemase	NA	NA	NA	NA	NA
WP_001126749.1|1345845_1346895_+	spore germination protein GerM	NA	NA	NA	NA	NA
WP_001261771.1|1347026_1347764_+	ribonuclease PH	NA	NA	NA	NA	NA
WP_000815943.1|1347775_1348384_+	XTP/dITP diphosphatase	NA	A0A0P0A2M4	Ugandan_cassava_brown_streak_virus	34.4	2.0e-14
WP_000645506.1|1348397_1348901_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_000124460.1|1349584_1349785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000473868.1|1349879_1350494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001983650.1|1351013_1351262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000358278.1|1351459_1352458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000105215.1|1352767_1354045_+	trigger factor	NA	NA	NA	NA	NA
WP_000472289.1|1354309_1355569_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	66.3	1.0e-148
WP_000119180.1|1355675_1357346_+|protease	ATP-dependent protease LonB	protease	E3T4F6	Cafeteria_roenbergensis_virus	33.5	6.7e-15
WP_000097285.1|1357527_1359858_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.5	1.2e-176
WP_000869116.1|1359854_1360451_+	ribosome biogenesis GTP-binding protein YsxC	NA	NA	NA	NA	NA
WP_000359781.1|1360484_1360901_-	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_000133923.1|1360903_1361356_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000547867.1|1361772_1363107_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_000008991.1|1363124_1363958_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_001226396.1|1363973_1364903_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_000992340.1|1364905_1365658_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_001087065.1|1365678_1366668_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_000712943.1|1366667_1367957_+	glutamate-1-semialdehyde 2,1-aminomutase	NA	A0A1V0SKB7	Klosneuvirus	34.1	1.7e-05
WP_003285397.1|1368035_1369046_+	stage VI sporulation protein D	NA	NA	NA	NA	NA
WP_000350653.1|1369112_1370138_+|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
WP_000072250.1|1370661_1373307_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	42.8	1.2e-164
WP_000582068.1|1373400_1374702_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_000361014.1|1374867_1375818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001226291.1|1376050_1376626_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_001013391.1|1376672_1377350_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_000466736.1|1377507_1378527_+	rod shape-determining protein MreB	NA	NA	NA	NA	NA
WP_001135490.1|1378568_1379420_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_000975766.1|1379434_1379980_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_000391525.1|1380015_1380702_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000503309.1|1380704_1381502_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_000797471.1|1381635_1382382_+	stage IV sporulation protein SpoIVFA	NA	NA	NA	NA	NA
WP_000599055.1|1382374_1383235_+	stage IV sporulation protein SpoIVFB	NA	NA	NA	NA	NA
WP_000855488.1|1383302_1384691_+	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_000270907.1|1384860_1385169_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_002001054.1|1385180_1385525_+|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_000944958.1|1385528_1385819_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_001003584.1|1385882_1386431_+	sporulation protein	NA	NA	NA	NA	NA
WP_000497128.1|1386430_1387717_+	GTPase ObgE	NA	NA	NA	NA	NA
WP_001986640.1|1387857_1388565_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000865415.1|1388554_1389637_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_000114529.1|1389730_1390507_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.4	1.3e-29
WP_001011422.1|1390481_1392404_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001026366.1|1392453_1394367_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000621701.1|1394463_1395315_+	prephenate dehydratase	NA	NA	NA	NA	NA
WP_000510665.1|1395420_1396068_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_000812272.1|1396148_1396691_-	transcription repressor NadR	NA	NA	NA	NA	NA
WP_000973772.1|1396690_1397833_-	IscS subfamily cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	29.2	5.0e-30
WP_001138529.1|1397985_1399515_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_001092208.1|1399534_1400368_+	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_000025344.1|1400398_1401505_+	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_038413747.1|1401730_1403632_+|coat	spore coat assembly protein ExsA	coat	NA	NA	NA	NA
>prophage 6
NZ_CP013055	Bacillus thuringiensis strain YWC2-8 chromosome, complete genome	5674369	3610853	3663295	5674369	bacteriocin,transposase,tRNA,integrase	Orpheovirus(25.0%)	36	3635893:3635909	3661847:3661863
WP_000377332.1|3610853_3612152_-|tRNA	aspartate--tRNA(Asn) ligase	tRNA	A0A2I2L4Y8	Orpheovirus	38.5	1.8e-76
WP_001167912.1|3612693_3613173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087942842.1|3613315_3614660_+|transposase	IS3-like element ISBth10 family transposase	transposase	A0A1B1P773	Bacillus_phage	74.4	3.6e-112
WP_000482274.1|3614717_3616229_-	peptidase M36	NA	NA	NA	NA	NA
WP_000045222.1|3616559_3617144_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001093123.1|3617145_3618231_+	DUF1624 domain-containing protein	NA	NA	NA	NA	NA
WP_000754899.1|3618281_3621383_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	31.9	5.7e-153
WP_000883846.1|3621770_3625973_-|bacteriocin	bacteriocin-processing peptidase family protein	bacteriocin	NA	NA	NA	NA
WP_000275558.1|3626310_3626802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000498601.1|3626913_3627132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000621475.1|3627161_3627491_-	DUF2085 domain-containing protein	NA	NA	NA	NA	NA
WP_000384921.1|3627603_3629292_-|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	32.9	8.1e-77
WP_000637451.1|3629592_3630369_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000063706.1|3630418_3630853_-	BrxA/BrxB family bacilliredoxin	NA	NA	NA	NA	NA
WP_000634884.1|3630936_3631320_-	DUF393 domain-containing protein	NA	NA	NA	NA	NA
WP_000692580.1|3631323_3632451_-	PBS lyase	NA	NA	NA	NA	NA
WP_000714949.1|3632868_3633429_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_001082769.1|3633765_3634098_-	single-stranded DNA-binding protein	NA	A0A059T5E0	Listeria_phage	61.1	1.1e-33
WP_001259000.1|3634438_3635530_-	hypothetical protein	NA	NA	NA	NA	NA
3635893:3635909	attL	GAAAGGATGGCGTTTTT	NA	NA	NA	NA
WP_001089284.1|3636805_3637315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021280.1|3637628_3637865_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000734833.1|3638023_3642085_-	ATP-binding protein	NA	A0A2H4PQT3	Staphylococcus_phage	34.7	2.9e-96
WP_000239530.1|3642307_3643261_-	DUF4238 domain-containing protein	NA	NA	NA	NA	NA
WP_000829601.1|3643552_3644650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000451337.1|3645473_3646211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001009203.1|3646734_3650214_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_000520934.1|3650591_3651320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001289510.1|3651321_3653031_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000249670.1|3653023_3655768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000266759.1|3655748_3656372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000275580.1|3656513_3657809_+|transposase	IS21-like element IS232 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	28.8	5.3e-12
WP_000798699.1|3657798_3658551_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	47.3	7.0e-57
WP_001259440.1|3658599_3659295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001053969.1|3659549_3660986_+|transposase	IS4-like element IS231C family transposase	transposase	NA	NA	NA	NA
WP_000364215.1|3661305_3661716_+	DUF1878 family protein	NA	NA	NA	NA	NA
WP_000116992.1|3661864_3663295_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
3661847:3661863	attR	GAAAGGATGGCGTTTTT	NA	NA	NA	NA
>prophage 7
NZ_CP013055	Bacillus thuringiensis strain YWC2-8 chromosome, complete genome	5674369	3767951	3829223	5674369	tail,transposase,bacteriocin,portal,terminase,protease,capsid,head,integrase	Bacillus_phage(90.57%)	72	3767590:3767608	3814502:3814520
3767590:3767608	attL	TAAGAAACACTGTGACCAT	NA	NA	NA	NA
WP_000730123.1|3767951_3768776_+	helix-turn-helix domain-containing protein	NA	A0A2H4J969	uncultured_Caudovirales_phage	66.9	2.1e-99
WP_000551102.1|3768785_3769406_-	hypothetical protein	NA	H0USY2	Bacillus_phage	96.1	8.3e-112
WP_000891545.1|3769347_3770529_-	cell division protein FtsK	NA	H0USY1	Bacillus_phage	93.4	1.9e-213
WP_000170790.1|3770644_3770827_-	hypothetical protein	NA	A0A288WGN6	Bacillus_phage	90.0	1.1e-21
WP_001257568.1|3770823_3771138_-	hypothetical protein	NA	H0USY0	Bacillus_phage	96.2	7.7e-50
WP_000941958.1|3771326_3771533_+	helix-turn-helix transcriptional regulator	NA	A0A288WG80	Bacillus_phage	41.5	4.1e-07
WP_000669561.1|3771532_3772336_+	hypothetical protein	NA	A6M971	Geobacillus_virus	41.3	5.4e-23
WP_000751888.1|3772405_3773470_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4JAS1	uncultured_Caudovirales_phage	93.8	5.4e-196
WP_000389067.1|3773466_3773697_-|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	A0A1B1P7Q9	Bacillus_phage	93.4	5.3e-32
WP_000499524.1|3773992_3775186_+|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	25.1	1.2e-23
WP_000822831.1|3775320_3776280_-|integrase	site-specific integrase	integrase	A0A0U3B271	Bacillus_phage	94.4	1.2e-173
WP_038413468.1|3776381_3780407_-	phage minor structural protein	NA	A0A0S2GLH1	Bacillus_phage	89.9	0.0e+00
WP_038413466.1|3780403_3781888_-|tail	phage tail protein	tail	A0A0S2GLF9	Bacillus_phage	99.4	1.9e-295
WP_038415467.1|3781899_3785748_-|tail	phage tail tape measure protein	tail	A0A288WG88	Bacillus_phage	88.8	0.0e+00
WP_000169371.1|3786569_3787877_-	group II intron reverse transcriptase/maturase	NA	H7BV92	unidentified_phage	24.2	1.7e-10
WP_001100112.1|3788050_3788230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015382186.1|3789604_3789922_-	hypothetical protein	NA	W8CYN3	Bacillus_phage	98.1	1.3e-52
WP_000896775.1|3789969_3790575_-|tail	tail protein	tail	A0A288WG55	Bacillus_phage	88.6	1.1e-95
WP_015382185.1|3790575_3790935_-	DUF3168 domain-containing protein	NA	A0A2H4JAR3	uncultured_Caudovirales_phage	95.8	2.7e-59
WP_015382184.1|3790931_3791366_-	HK97 gp10 family phage protein	NA	H0USW9	Bacillus_phage	99.3	2.3e-76
WP_015382183.1|3791358_3791682_-|head	phage head closure protein	head	H0USW8	Bacillus_phage	98.1	7.4e-56
WP_000244586.1|3791668_3791956_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	100.0	1.8e-45
WP_000361137.1|3791976_3793143_-|capsid	phage major capsid protein	capsid	W8CYN2	Bacillus_phage	96.6	4.0e-208
WP_001259159.1|3793180_3793891_-|protease	Clp protease ClpP	protease	W8CYT5	Bacillus_phage	95.8	2.4e-123
WP_000577489.1|3793877_3795131_-|portal	phage portal protein	portal	A0A0S2GLJ4	Bacillus_phage	99.3	1.7e-241
WP_000621131.1|3795319_3797014_-|terminase	terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	99.6	0.0e+00
WP_000233390.1|3797015_3797519_-|terminase	phage terminase small subunit P27 family	terminase	A0A0S2GLF2	Bacillus_phage	99.4	1.0e-88
WP_001139454.1|3797648_3798026_-	HNH endonuclease	NA	A0A0S2GLI5	Bacillus_phage	94.4	2.1e-65
WP_000773601.1|3798404_3798617_-	hypothetical protein	NA	H0USV9	Bacillus_phage	97.1	1.0e-29
WP_000002725.1|3798633_3798873_-	hypothetical protein	NA	W8CZ42	Bacillus_phage	93.7	1.1e-16
WP_000443965.1|3798907_3799087_-	hypothetical protein	NA	W8CYF7	Bacillus_phage	98.3	6.0e-23
WP_000464752.1|3799132_3799360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000017440.1|3799396_3799684_-	hypothetical protein	NA	H0USV6	Bacillus_phage	91.6	1.7e-43
WP_015382276.1|3800086_3800332_-	hypothetical protein	NA	W8CYG8	Bacillus_phage	97.5	6.5e-36
WP_001012176.1|3800538_3801081_-|integrase	site-specific integrase	integrase	A0A0S2GLG4	Bacillus_phage	100.0	3.3e-96
WP_000166155.1|3801077_3801563_-	ArpU family transcriptional regulator	NA	A0A0S2GLJ9	Bacillus_phage	99.4	1.8e-85
WP_000866514.1|3801590_3801755_-	hypothetical protein	NA	W8CYZ7	Bacillus_phage	100.0	5.0e-16
WP_000965619.1|3801920_3802202_-	hypothetical protein	NA	A0A0S2GLD3	Bacillus_phage	100.0	8.7e-45
WP_000404184.1|3803610_3804018_-	hypothetical protein	NA	A0A0S2GLF8	Bacillus_phage	100.0	4.9e-73
WP_001098845.1|3804371_3804671_-	hypothetical protein	NA	A0A0S2GLL5	Bacillus_phage	100.0	2.7e-52
WP_000705118.1|3804821_3805121_+	hypothetical protein	NA	A0A0S2GLD6	Bacillus_phage	100.0	1.9e-50
WP_001025406.1|3805117_3805333_-	hypothetical protein	NA	A0A0S2GLC6	Bacillus_phage	100.0	8.7e-37
WP_000817807.1|3805350_3805515_-	DUF3954 domain-containing protein	NA	A0A0S2GLF5	Bacillus_phage	100.0	1.0e-24
WP_000436951.1|3805586_3805853_-	hypothetical protein	NA	A0A0S2GLK4	Bacillus_phage	100.0	7.7e-43
WP_002133989.1|3805894_3806707_-	ATP-binding protein	NA	A0A0S2GLK2	Bacillus_phage	100.0	1.2e-155
WP_015382274.1|3806669_3807686_-	hypothetical protein	NA	A0A0S2GLI6	Bacillus_phage	97.6	2.0e-187
WP_038415676.1|3807929_3808577_-	sigma-70 family RNA polymerase sigma factor	NA	A0A0S2GLJ1	Bacillus_phage	96.3	3.9e-112
WP_000176230.1|3808600_3808909_-	hypothetical protein	NA	W8CYU1	Bacillus_phage	92.6	2.2e-41
WP_015382272.1|3809070_3809814_-	phage regulatory protein	NA	A0A0S2GLP8	Bacillus_phage	76.4	2.9e-103
WP_000788398.1|3809859_3810015_-	hypothetical protein	NA	I7J4K2	Bacillus_phage	94.1	3.3e-22
WP_000549467.1|3810039_3810228_-	helix-turn-helix transcriptional regulator	NA	W8CYN7	Bacillus_phage	95.2	1.4e-25
WP_000714354.1|3810303_3810510_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000258007.1|3810685_3811030_+	helix-turn-helix domain-containing protein	NA	H0UST7	Bacillus_phage	40.6	1.2e-14
WP_001033792.1|3811026_3811173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000936291.1|3811429_3812650_-	hypothetical protein	NA	A0A0U3TNF6	Bacillus_phage	49.5	2.2e-108
WP_000237493.1|3813389_3814481_+|integrase	site-specific integrase	integrase	A0A0S2GLI2	Bacillus_phage	79.8	8.1e-163
WP_001166434.1|3814812_3815403_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
3814502:3814520	attR	TAAGAAACACTGTGACCAT	NA	NA	NA	NA
WP_002004921.1|3815492_3816647_-	stage II sporulation protein P	NA	NA	NA	NA	NA
WP_000226253.1|3816717_3817686_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_000741975.1|3817688_3818117_-	NfeD family protein	NA	NA	NA	NA	NA
WP_001245226.1|3818391_3819609_+	MFS transporter	NA	NA	NA	NA	NA
WP_000405394.1|3819658_3821134_-	amidase	NA	NA	NA	NA	NA
WP_000178288.1|3821316_3821763_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_000747647.1|3821786_3822527_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_000617573.1|3822538_3823036_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001079274.1|3823291_3824446_-	stage II sporulation protein P	NA	NA	NA	NA	NA
WP_000770738.1|3824534_3824831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016109792.1|3824835_3825141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000435828.1|3825113_3825680_-	DUF1572 family protein	NA	NA	NA	NA	NA
WP_001263016.1|3825660_3825990_-	chaperone CsaA	NA	NA	NA	NA	NA
WP_000839661.1|3826055_3827402_-	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_087942842.1|3827878_3829223_+|transposase	IS3-like element ISBth10 family transposase	transposase	A0A1B1P773	Bacillus_phage	74.4	3.6e-112
>prophage 8
NZ_CP013055	Bacillus thuringiensis strain YWC2-8 chromosome, complete genome	5674369	3843034	3903148	5674369	protease,coat,transposase	Bacillus_phage(23.53%)	60	NA	NA
WP_000937997.1|3843034_3844111_-|coat	spore coat protein CotH	coat	NA	NA	NA	NA
WP_000817485.1|3844292_3844835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000858822.1|3844881_3845493_-	phosphoserine phosphatase 1	NA	NA	NA	NA	NA
WP_000943769.1|3846065_3846482_-	FosB/FosD family fosfomycin resistance bacillithiol transferase	NA	Q2LI91	Bacillus_phage	64.8	1.3e-39
WP_000824280.1|3846541_3848203_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002098546.1|3848287_3849274_-	DUF2628 domain-containing protein	NA	NA	NA	NA	NA
WP_000283913.1|3849299_3849752_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	41.0	1.1e-25
WP_001083648.1|3849885_3850923_+	NADPH dehydrogenase NamA	NA	NA	NA	NA	NA
WP_001042736.1|3850952_3851612_-	oxidoreductase	NA	NA	NA	NA	NA
WP_000169371.1|3852443_3853751_-	group II intron reverse transcriptase/maturase	NA	H7BV92	unidentified_phage	24.2	1.7e-10
WP_001100112.1|3853924_3854104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002132987.1|3855291_3855513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001126151.1|3855777_3856728_+	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001048676.1|3856866_3857337_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000613420.1|3857449_3858400_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_001040871.1|3858497_3859967_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	G3MB42	Bacillus_virus	41.7	2.7e-68
WP_000376357.1|3860228_3861131_+	aldo/keto reductase family oxidoreductase	NA	NA	NA	NA	NA
WP_001068749.1|3861155_3861740_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001168116.1|3861824_3863288_-	flavin monoamine oxidase family protein	NA	A0A2K9L022	Tupanvirus	22.3	1.2e-15
WP_000683357.1|3863465_3863657_+	DUF3896 family protein	NA	NA	NA	NA	NA
WP_000594031.1|3863761_3864763_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_087942833.1|3864875_3866217_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	37.3	6.3e-32
WP_000798320.1|3866278_3867223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000488206.1|3867438_3867894_-	DUF3939 domain-containing protein	NA	NA	NA	NA	NA
WP_000105199.1|3867996_3868440_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	62.1	6.2e-45
WP_000370203.1|3868680_3869721_+	membrane protein	NA	NA	NA	NA	NA
WP_000965059.1|3869755_3870121_-	DUF3979 family protein	NA	NA	NA	NA	NA
WP_000539571.1|3870443_3870749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000517294.1|3870945_3872928_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.0	3.5e-23
WP_001073075.1|3873128_3874181_-	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_000426317.1|3875086_3875434_+	DUF4257 domain-containing protein	NA	NA	NA	NA	NA
WP_000162602.1|3875518_3875743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001198794.1|3875942_3876305_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_001101741.1|3876448_3876655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001082497.1|3876703_3877879_-	MFS transporter	NA	NA	NA	NA	NA
WP_000874082.1|3877926_3878862_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_001259906.1|3878968_3879277_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000099756.1|3879318_3880266_-|protease	serine protease	protease	A0A127AWU5	Bacillus_phage	57.4	1.4e-94
WP_000648325.1|3880540_3880828_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	56.5	1.2e-12
WP_001026002.1|3880943_3882824_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000174901.1|3883099_3883918_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	63.3	1.7e-93
WP_000024999.1|3883967_3884429_-	NUDIX hydrolase	NA	A0A2I6PFL2	Proteus_phage	35.1	8.5e-05
WP_001048102.1|3884460_3884658_-	DUF4083 domain-containing protein	NA	NA	NA	NA	NA
WP_000520856.1|3884763_3885924_-	peptidase	NA	NA	NA	NA	NA
WP_001034835.1|3886074_3886827_-	DUF1963 domain-containing protein	NA	NA	NA	NA	NA
WP_000540423.1|3887050_3887191_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_000686789.1|3887278_3888244_+	patatin-like phospholipase family protein	NA	A0A1V0SKV5	Klosneuvirus	31.2	1.1e-25
WP_000816391.1|3888357_3888525_-	DUF3933 family protein	NA	NA	NA	NA	NA
WP_000439399.1|3888537_3889980_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_001287305.1|3890098_3890713_+	amino acid transporter	NA	NA	NA	NA	NA
WP_033667350.1|3890766_3891996_-	MFS transporter	NA	NA	NA	NA	NA
WP_000113545.1|3892231_3892438_-	alpha/beta-type small acid-soluble spore protein	NA	Q77YX0	Bacillus_phage	63.1	3.4e-14
WP_000877670.1|3892562_3893405_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_000200704.1|3893442_3894426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001250558.1|3894449_3894716_-	petrobactin biosynthesis protein AsbD	NA	NA	NA	NA	NA
WP_000909581.1|3894712_3895951_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_000275580.1|3897261_3898557_+|transposase	IS21-like element IS232 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	28.8	5.3e-12
WP_000798699.1|3898546_3899299_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	47.3	7.0e-57
WP_001163356.1|3900025_3901834_-	Petrobactin biosynthesis protein AsbA	NA	NA	NA	NA	NA
WP_000710470.1|3901990_3903148_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q331V1	Clostridium_botulinum_C_phage	59.0	1.8e-123
>prophage 9
NZ_CP013055	Bacillus thuringiensis strain YWC2-8 chromosome, complete genome	5674369	3923109	3931260	5674369		Bacillus_phage(66.67%)	7	NA	NA
WP_001258538.1|3923109_3923982_-	aminoglycoside 6-adenylyltransferase	NA	A0A1X9I6F2	Streptococcus_phage	44.7	2.1e-65
WP_000818979.1|3924272_3924992_-	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	100.0	5.9e-61
WP_001231621.1|3925281_3926355_-	HAMP domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	98.0	6.1e-187
WP_000612414.1|3926351_3927029_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	99.1	1.1e-122
WP_000453861.1|3927114_3928875_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	98.0	2.4e-273
WP_001194306.1|3929115_3929880_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000755525.1|3929979_3931260_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	31.5	3.4e-11
>prophage 10
NZ_CP013055	Bacillus thuringiensis strain YWC2-8 chromosome, complete genome	5674369	4594201	4669269	5674369	tail,transposase,tRNA,portal,terminase,protease,holin,capsid,head	Bacillus_phage(47.17%)	88	NA	NA
WP_000110985.1|4594201_4595191_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000966128.1|4595471_4596218_-	YjbA family protein	NA	A0A0A0RP53	Bacillus_phage	40.5	8.0e-45
WP_000513275.1|4596361_4597150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000412656.1|4597256_4598495_-	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_001100533.1|4598526_4599459_-	beta-ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_001986215.1|4599996_4600173_-	competence protein ComG	NA	NA	NA	NA	NA
WP_000487722.1|4600227_4601100_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000028691.1|4601129_4601864_-	hydrolase	NA	NA	NA	NA	NA
WP_001211116.1|4602020_4602203_+	YjzD family protein	NA	NA	NA	NA	NA
WP_000365401.1|4602241_4604842_-	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	33.1	2.4e-120
WP_000531421.1|4605051_4605231_-	YjzC family protein	NA	NA	NA	NA	NA
WP_001041232.1|4605722_4606532_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_000516816.1|4606637_4606778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000527407.1|4606778_4606976_+	DUF3813 domain-containing protein	NA	NA	NA	NA	NA
WP_000364432.1|4607001_4607859_-	YitT family protein	NA	NA	NA	NA	NA
WP_001120849.1|4607959_4608109_+	DUF3941 domain-containing protein	NA	NA	NA	NA	NA
WP_001214215.1|4608238_4609096_+	peptidylprolyl isomerase PrsA	NA	NA	NA	NA	NA
WP_001153798.1|4609135_4609399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000548429.1|4609618_4610104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000281260.1|4610522_4611377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001040149.1|4611607_4612099_+	YajQ family cyclic di-GMP-binding protein	NA	NA	NA	NA	NA
WP_000397871.1|4612960_4613272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103580702.1|4613572_4614814_-	alpha-amylase	NA	NA	NA	NA	NA
WP_000367127.1|4615087_4616323_+	ammonium transporter	NA	NA	NA	NA	NA
WP_000076219.1|4616443_4617085_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001238640.1|4617261_4617498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003283577.1|4617518_4618145_-	sporulation membrane protein YtaF	NA	NA	NA	NA	NA
WP_000148974.1|4618252_4618486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000619724.1|4618475_4618772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001190887.1|4618785_4623324_-	HAD-IC family P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	28.1	7.2e-72
WP_000486133.1|4623369_4623720_-	YtxH domain-containing protein	NA	NA	NA	NA	NA
WP_001069180.1|4624531_4625998_-	catalase	NA	A0A2K9L572	Tupanvirus	47.4	1.0e-123
WP_000163133.1|4626057_4627017_-	ferrochelatase	NA	NA	NA	NA	NA
WP_000730207.1|4627495_4628329_+	hypothetical protein	NA	A0A2H4J6G7	uncultured_Caudovirales_phage	81.9	2.6e-121
WP_000100788.1|4628346_4628637_-	hypothetical protein	NA	A0A1C8E992	Bacillus_phage	90.7	9.3e-42
WP_001016122.1|4628661_4628880_-	hypothetical protein	NA	A0A2H4JC50	uncultured_Caudovirales_phage	90.3	3.6e-30
WP_000742862.1|4629019_4629586_+	hypothetical protein	NA	A6XML2	Bacillus_virus	45.7	5.9e-24
WP_000405773.1|4629751_4630684_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2MVR5	Bacillus_phage	84.2	3.3e-157
WP_000373898.1|4630683_4631109_-|holin	phage holin family protein	holin	A0A0S2MVC4	Bacillus_phage	100.0	2.6e-72
WP_001004976.1|4631146_4631521_-	hypothetical protein	NA	A0A0S2MVE0	Bacillus_phage	98.4	2.7e-65
WP_015382232.1|4631536_4636381_-	hypothetical protein	NA	A0A0S2MVB4	Bacillus_phage	83.4	0.0e+00
WP_000094123.1|4636377_4637847_-|tail	phage tail protein	tail	A0A0S2MV63	Bacillus_phage	79.6	2.8e-235
WP_015382231.1|4637888_4641521_-	hypothetical protein	NA	A0A2H4JAI2	uncultured_Caudovirales_phage	84.1	2.4e-182
WP_000415929.1|4641751_4642114_-	hypothetical protein	NA	A0A2H4JAG8	uncultured_Caudovirales_phage	70.0	6.8e-42
WP_001004921.1|4642120_4642714_-|tail	phage tail protein	tail	A0A2H4JDV4	uncultured_Caudovirales_phage	93.3	6.7e-103
WP_000172080.1|4642714_4643044_-	hypothetical protein	NA	A0A2H4JAG4	uncultured_Caudovirales_phage	83.5	2.9e-47
WP_001273706.1|4643040_4643397_-	HK97 gp10 family phage protein	NA	D2XR21	Bacillus_phage	60.7	3.0e-34
WP_000998123.1|4643389_4643689_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_000600950.1|4643685_4643958_-	DNA-packaging protein	NA	R9TMB7	Paenibacillus_phage	53.9	3.0e-18
WP_001016250.1|4643954_4644212_-	hypothetical protein	NA	A6XMJ7	Bacillus_virus	43.2	1.1e-06
WP_001031425.1|4644227_4645412_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	24.4	5.1e-09
WP_000361708.1|4645428_4646013_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2I7SBY1	Paenibacillus_phage	44.6	2.7e-32
WP_000499523.1|4646309_4647503_+|transposase	IS110-like element ISBth13 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	26.1	1.1e-24
WP_000522435.1|4647597_4648776_-|portal	phage portal protein	portal	A0A0A8WJ25	Clostridium_phage	61.6	5.5e-141
WP_033676369.1|4648789_4650478_-|terminase	terminase large subunit	terminase	A0A290GJW3	Caldibacillus_phage	72.6	3.9e-249
WP_001282601.1|4650486_4650849_-	hypothetical protein	NA	A0A290GJQ7	Caldibacillus_phage	43.5	2.4e-18
WP_001149928.1|4650941_4651337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001051281.1|4651339_4651642_-	HNH endonuclease	NA	A0A1B0YEC6	Lactobacillus_phage	48.5	1.5e-18
WP_000196707.1|4651658_4651859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000499523.1|4652130_4653324_-|transposase	IS110-like element ISBth13 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	26.1	1.1e-24
WP_071686481.1|4653620_4653803_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0U4KLG1	Pseudomonas_phage	67.2	9.4e-16
WP_000711196.1|4653854_4654274_+	HicB family protein	NA	A0A2H4J4X8	uncultured_Caudovirales_phage	79.9	7.6e-61
WP_033676375.1|4654656_4655058_-	hypothetical protein	NA	A0A1C8E9D1	Bacillus_phage	98.5	1.8e-67
WP_038413362.1|4655095_4655422_-	hypothetical protein	NA	A0A1C8E9C1	Bacillus_phage	97.2	2.3e-57
WP_000540088.1|4655418_4655946_-	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	98.3	5.4e-96
WP_000590880.1|4655981_4656293_-	hypothetical protein	NA	A0A0A7AR06	Bacillus_phage	83.5	2.9e-41
WP_000389429.1|4656526_4656931_-	hypothetical protein	NA	I6TG10	Staphylococcus_virus	37.1	7.7e-10
WP_000356654.1|4657090_4657273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001093039.1|4657357_4658149_-	prohibitin family protein	NA	A0A1C8E9A9	Bacillus_phage	100.0	6.8e-143
WP_001268033.1|4658295_4658586_-	hypothetical protein	NA	A0A1C8EA94	Bacillus_phage	94.8	8.4e-51
WP_001010921.1|4658644_4659079_-	hypothetical protein	NA	A0A1C8E9B0	Bacillus_phage	95.1	1.3e-76
WP_015382228.1|4659117_4659675_-	hypothetical protein	NA	A0A1B1P7A6	Bacillus_phage	71.4	4.0e-65
WP_000139235.1|4659698_4659929_-	hypothetical protein	NA	A0A1C8E9C2	Bacillus_phage	100.0	2.5e-34
WP_000933912.1|4659921_4660401_-	hypothetical protein	NA	A0A2H4J396	uncultured_Caudovirales_phage	93.7	1.3e-80
WP_000510888.1|4660412_4661366_-	DnaD domain protein	NA	A0A0S2MVA0	Bacillus_phage	90.2	6.4e-148
WP_038413358.1|4661459_4661798_-	hypothetical protein	NA	A0A0S2MVH7	Bacillus_phage	96.4	2.6e-51
WP_015382226.1|4661730_4661946_-	hypothetical protein	NA	A0A1C8E9A6	Bacillus_phage	97.2	5.5e-31
WP_000178947.1|4661945_4662659_-	hypothetical protein	NA	A0A0S2MV99	Bacillus_phage	98.3	1.0e-126
WP_000453494.1|4662677_4663112_-	hypothetical protein	NA	A0A0S2MVA8	Bacillus_phage	99.3	1.1e-73
WP_001186272.1|4663138_4663327_-	hypothetical protein	NA	A0A2H4J4V8	uncultured_Caudovirales_phage	96.8	6.1e-26
WP_000372563.1|4663338_4664091_-	phage regulatory protein	NA	A0A2H4JBC7	uncultured_Caudovirales_phage	81.0	4.8e-106
WP_000788388.1|4664105_4664261_-	hypothetical protein	NA	A0A1C8E9A0	Bacillus_phage	90.0	1.3e-18
WP_000014074.1|4664343_4664508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000385074.1|4664573_4664846_-	helix-turn-helix transcriptional regulator	NA	A0A141E0W0	Streptococcus_phage	50.0	3.0e-10
WP_000130922.1|4664995_4665679_+	LexA family transcriptional regulator	NA	D7RWF2	Brochothrix_phage	34.2	1.3e-22
WP_000289677.1|4665694_4665913_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000650392.1|4666056_4667460_+	recombinase family protein	NA	A0A2I7SDG6	Paenibacillus_phage	44.8	1.5e-113
WP_000333967.1|4667490_4669269_-	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1V0SGM7	Hokovirus	27.3	1.6e-22
>prophage 11
NZ_CP013055	Bacillus thuringiensis strain YWC2-8 chromosome, complete genome	5674369	5140993	5195369	5674369	tail,transposase,portal,terminase,protease,capsid,head,integrase	Bacillus_phage(92.98%)	64	5143610:5143628	5185604:5185622
WP_000948949.1|5140993_5142310_-	FAD-binding protein	NA	A0A2K9L0J9	Tupanvirus	22.1	5.3e-07
WP_000373746.1|5142297_5143470_-	amino acid deaminase/aldolase	NA	NA	NA	NA	NA
5143610:5143628	attL	AATGATCAGAGTAATCATT	NA	NA	NA	NA
WP_000730127.1|5143967_5144849_+	HTH domain-containing protein	NA	I7ILW0	Bacillus_phage	100.0	1.5e-159
WP_000842173.1|5144853_5145462_-	hypothetical protein	NA	A0A0S2GLL8	Bacillus_phage	100.0	3.3e-113
WP_000511371.1|5145451_5146618_-	DNA translocase FtsK	NA	A0A0S2GLG9	Bacillus_phage	100.0	9.4e-226
WP_000495118.1|5146628_5146949_-	hypothetical protein	NA	A0A0S2GLK1	Bacillus_phage	100.0	1.9e-51
WP_000467327.1|5147411_5147633_+	helix-turn-helix transcriptional regulator	NA	A0A0S2GLH4	Bacillus_phage	100.0	2.9e-35
WP_000423300.1|5147701_5148031_+	hypothetical protein	NA	A0A0S2GLG3	Bacillus_phage	100.0	2.4e-54
WP_000542506.1|5148071_5148890_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2GLD4	Bacillus_phage	100.0	3.2e-164
WP_001076454.1|5148889_5149102_-	hypothetical protein	NA	A0A0S2GM50	Bacillus_phage	100.0	1.4e-34
WP_000151530.1|5149104_5149386_-	hypothetical protein	NA	A0A0S2GM64	Bacillus_phage	100.0	9.1e-42
WP_000822820.1|5149399_5150359_-|integrase	site-specific integrase	integrase	A0A0S2GLC8	Bacillus_phage	99.7	3.1e-182
WP_015382189.1|5150455_5154481_-	minor structural protein	NA	A0A0S2GLH1	Bacillus_phage	100.0	0.0e+00
WP_000232880.1|5154477_5155962_-|tail	phage tail protein	tail	A0A0S2GLF9	Bacillus_phage	100.0	9.9e-297
WP_038413316.1|5155973_5159900_-|tail	phage tail tape measure protein	tail	A0A0S2GLG8	Bacillus_phage	100.0	0.0e+00
WP_000344048.1|5159914_5160091_-	hypothetical protein	NA	I3WTY5	Bacillus_phage	100.0	1.1e-26
WP_000779042.1|5160120_5160438_-	hypothetical protein	NA	A0A0S2GLH2	Bacillus_phage	100.0	8.9e-54
WP_000896661.1|5160484_5161090_-|tail	tail protein	tail	A0A0S2GLI0	Bacillus_phage	100.0	9.2e-100
WP_000609197.1|5161090_5161450_-	DUF3168 domain-containing protein	NA	A0A0S2GLE3	Bacillus_phage	100.0	3.5e-62
WP_000763223.1|5161446_5161884_-	HK97 gp10 family phage protein	NA	A0A0S2GLH3	Bacillus_phage	100.0	7.9e-77
WP_001068030.1|5161876_5162200_-|head	phage head closure protein	head	H0USW8	Bacillus_phage	100.0	1.1e-56
WP_000244586.1|5162186_5162474_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	100.0	1.8e-45
WP_015382182.1|5162494_5163661_-|capsid	phage major capsid protein	capsid	A0A0S2GLG0	Bacillus_phage	100.0	3.3e-210
WP_015382181.1|5163698_5164409_-|protease	Clp protease ClpP	protease	A0A0S2GLD5	Bacillus_phage	100.0	5.5e-128
WP_015382180.1|5164395_5165649_-|portal	phage portal protein	portal	A0A0S2GLJ4	Bacillus_phage	99.8	3.5e-242
WP_015382179.1|5165837_5167532_-|terminase	terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	100.0	0.0e+00
WP_000233388.1|5167533_5168037_-|terminase	phage terminase small subunit P27 family	terminase	A0A0S2GLF2	Bacillus_phage	100.0	8.0e-89
WP_001139459.1|5168165_5168543_-	HNH endonuclease	NA	A0A0S2GLI5	Bacillus_phage	100.0	6.8e-69
WP_001198493.1|5168532_5168787_-	hypothetical protein	NA	A0A0S2GLL6	Bacillus_phage	100.0	3.9e-44
WP_000778983.1|5168922_5169135_-	hypothetical protein	NA	A0A0S2GM40	Bacillus_phage	100.0	2.7e-30
WP_000002720.1|5169151_5169391_-	hypothetical protein	NA	A0A0S2GLE8	Bacillus_phage	98.7	5.2e-22
WP_000443964.1|5169419_5169605_-	hypothetical protein	NA	A0A0S2GLH7	Bacillus_phage	100.0	8.6e-25
WP_001050326.1|5169653_5170520_-	hypothetical protein	NA	A0A0S2GLF7	Bacillus_phage	100.0	2.8e-166
WP_000792998.1|5170601_5170784_-	hypothetical protein	NA	A0A0S2GLH0	Bacillus_phage	100.0	3.1e-27
WP_015382178.1|5171155_5171401_-	hypothetical protein	NA	A0A0S2GLK0	Bacillus_phage	100.0	9.0e-38
WP_001012176.1|5171607_5172150_-|integrase	site-specific integrase	integrase	A0A0S2GLG4	Bacillus_phage	100.0	3.3e-96
WP_015382492.1|5172146_5172632_-	transcription regulator	NA	A0A0S2GLJ9	Bacillus_phage	100.0	7.9e-86
WP_015382275.1|5172659_5172824_-	hypothetical protein	NA	A0A0S2GLH8	Bacillus_phage	100.0	6.5e-16
WP_000965619.1|5172989_5173271_-	hypothetical protein	NA	A0A0S2GLD3	Bacillus_phage	100.0	8.7e-45
WP_000404184.1|5174679_5175087_-	hypothetical protein	NA	A0A0S2GLF8	Bacillus_phage	100.0	4.9e-73
WP_001098845.1|5175440_5175740_-	hypothetical protein	NA	A0A0S2GLL5	Bacillus_phage	100.0	2.7e-52
WP_000705118.1|5175890_5176190_+	hypothetical protein	NA	A0A0S2GLD6	Bacillus_phage	100.0	1.9e-50
WP_001025406.1|5176186_5176402_-	hypothetical protein	NA	A0A0S2GLC6	Bacillus_phage	100.0	8.7e-37
WP_000817807.1|5176419_5176584_-	DUF3954 domain-containing protein	NA	A0A0S2GLF5	Bacillus_phage	100.0	1.0e-24
WP_000436951.1|5176655_5176922_-	hypothetical protein	NA	A0A0S2GLK4	Bacillus_phage	100.0	7.7e-43
WP_002133989.1|5176963_5177776_-	ATP-binding protein	NA	A0A0S2GLK2	Bacillus_phage	100.0	1.2e-155
WP_015382176.1|5177738_5178755_-	hypothetical protein	NA	A0A0S2GLI6	Bacillus_phage	100.0	2.8e-189
WP_000123128.1|5178978_5179626_-	sigma-70 family RNA polymerase sigma factor	NA	A0A0S2GLJ1	Bacillus_phage	100.0	1.8e-117
WP_000218620.1|5179900_5180215_-	hypothetical protein	NA	A0A0S2GLB6	Bacillus_phage	100.0	1.1e-51
WP_015382175.1|5180376_5181156_-	phage regulatory protein	NA	A0A0S2GLP8	Bacillus_phage	100.0	1.6e-141
WP_000549466.1|5181381_5181570_-	helix-turn-helix transcriptional regulator	NA	A0A0S2GLE9	Bacillus_phage	100.0	3.2e-27
WP_000813892.1|5181602_5181839_-	helix-turn-helix transcriptional regulator	NA	A0A0S2GLE0	Bacillus_phage	100.0	8.7e-38
WP_000511082.1|5181987_5182332_+	helix-turn-helix transcriptional regulator	NA	I7J6V3	Bacillus_phage	100.0	4.2e-57
WP_000466636.1|5182731_5183970_-	hypothetical protein	NA	I7J4K0	Bacillus_phage	100.0	8.2e-236
WP_000262047.1|5184487_5185588_+|integrase	site-specific integrase	integrase	A0A0S2GLI2	Bacillus_phage	100.0	8.6e-205
WP_000676802.1|5185526_5186573_-	sphingomyelin phosphodiesterase	NA	A0A1P8L6H7	Staphylococcus_phage	59.0	1.1e-87
5185604:5185622	attR	AATGATCAGAGTAATCATT	NA	NA	NA	NA
WP_000730997.1|5186649_5187501_-	phospholipase C	NA	NA	NA	NA	NA
WP_087970930.1|5187842_5189001_+|transposase	IS3-like element ISBth8 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	42.0	2.5e-37
WP_000948209.1|5189045_5189390_-	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_000645827.1|5189509_5190562_-	(R,R)-butanediol dehydrogenase	NA	E3SJ82	Synechococcus_phage	27.6	3.9e-21
WP_000873276.1|5190787_5191942_+	MFS transporter	NA	NA	NA	NA	NA
WP_000964468.1|5191862_5192288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000658667.1|5192309_5192651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001252962.1|5192969_5195369_-|protease	M6 family metalloprotease domain-containing protein	protease	NA	NA	NA	NA
>prophage 12
NZ_CP013055	Bacillus thuringiensis strain YWC2-8 chromosome, complete genome	5674369	5466286	5564519	5674369	tail,transposase,tRNA,portal,terminase,protease,capsid,head,integrase	Bacillus_phage(62.5%)	111	5515272:5515300	5563158:5563186
WP_000275580.1|5466286_5467582_-|transposase	IS21-like element IS232 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	28.8	5.3e-12
WP_000619194.1|5468033_5468717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001081906.1|5468873_5469563_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_000113948.1|5469764_5470727_-	carbamate kinase	NA	NA	NA	NA	NA
WP_000503399.1|5470764_5472180_-	arginine-ornithine antiporter	NA	NA	NA	NA	NA
WP_000930287.1|5472279_5473278_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000682331.1|5473308_5474541_-	arginine deiminase	NA	NA	NA	NA	NA
WP_000711827.1|5474809_5475259_-	arginine repressor	NA	NA	NA	NA	NA
WP_000410233.1|5475405_5476698_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	42.7	9.1e-12
WP_000616925.1|5476909_5477632_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.8	1.4e-33
WP_000823769.1|5477754_5478549_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003283038.1|5478592_5479348_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000661226.1|5479401_5480487_-	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_001053969.1|5481832_5483269_+|transposase	IS4-like element IS231C family transposase	transposase	NA	NA	NA	NA
WP_001182683.1|5484404_5485706_+	aromatic acid/H+ symport family MFS transporter	NA	NA	NA	NA	NA
WP_001208232.1|5485719_5486502_-	nucleotidyltransferase domain-containing protein	NA	Q8SCS5	Pseudomonas_phage	43.5	1.4e-44
WP_000147471.1|5486613_5487723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000862985.1|5488069_5488702_+	cyclase family protein	NA	NA	NA	NA	NA
WP_000424119.1|5488729_5489110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001046104.1|5489338_5490565_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_000434752.1|5490702_5491968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001004265.1|5492206_5492875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000443836.1|5493036_5493486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000051528.1|5493506_5494016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000276022.1|5494251_5494482_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000235475.1|5494677_5495046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001078266.1|5495241_5496291_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000732593.1|5496624_5497542_+	iron-hydroxamate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002100683.1|5497590_5498631_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000983744.1|5498627_5499635_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000926553.1|5499680_5500322_-	L-fuculose-phosphate aldolase	NA	NA	NA	NA	NA
WP_033679657.1|5500375_5501422_-	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_000033255.1|5501431_5502661_-	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_000924420.1|5503252_5503816_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_000599501.1|5503830_5505357_+	alkyl hydroperoxide reductase subunit F	NA	A0A1W6JNB4	Lactococcus_phage	30.8	1.2e-18
WP_001005631.1|5505390_5505996_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000853511.1|5506230_5507346_-	amidohydrolase	NA	NA	NA	NA	NA
WP_000972812.1|5509048_5510320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000704490.1|5510413_5511523_+	dipeptide epimerase	NA	Q6A202	Oenococcus_phage	25.6	5.0e-19
WP_000217543.1|5511537_5512233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000233735.1|5512433_5513141_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_001251702.1|5513236_5513755_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	36.5	4.3e-21
WP_000566707.1|5514105_5515095_-|tRNA	tRNA-dihydrouridine synthase	tRNA	NA	NA	NA	NA
5515272:5515300	attL	CCAAGCCACACACTCCACATGAGTCGTAT	NA	NA	NA	NA
WP_000477499.1|5515754_5516852_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0E3M2X0	Bacillus_phage	23.4	2.1e-09
WP_001028065.1|5516848_5518858_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000247457.1|5518850_5519255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000349585.1|5519323_5520115_-	sulfotransferase family 2 domain-containing protein	NA	A0A288WG17	Bacillus_phage	68.4	6.8e-103
WP_000027993.1|5520155_5520929_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_000794364.1|5521017_5521806_-	sulfotransferase family 2 domain-containing protein	NA	A0A288WG17	Bacillus_phage	51.4	2.8e-64
WP_002133890.1|5522102_5522411_+	YolD-like family protein	NA	NA	NA	NA	NA
WP_000542507.1|5522455_5523274_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2GLD4	Bacillus_phage	95.6	1.6e-158
WP_000159646.1|5523273_5523480_-	hypothetical protein	NA	D2XR32	Bacillus_phage	97.1	1.3e-32
WP_000215408.1|5523482_5523764_-	hypothetical protein	NA	A0A0S2GM64	Bacillus_phage	81.7	2.4e-34
WP_000354142.1|5523800_5524178_-	hypothetical protein	NA	A0A0S2MVE0	Bacillus_phage	59.5	8.4e-35
WP_015382161.1|5524194_5528589_-	hypothetical protein	NA	A0A0S2MVB4	Bacillus_phage	63.6	0.0e+00
WP_015382160.1|5528585_5530055_-	hypothetical protein	NA	A0A0S2MV63	Bacillus_phage	78.3	6.5e-232
WP_044157404.1|5530094_5535092_-|tail	phage tail protein	tail	A0A2H4JI37	uncultured_Caudovirales_phage	81.6	0.0e+00
WP_015382157.1|5535256_5535631_-	hypothetical protein	NA	A0A2H4JBU8	uncultured_Caudovirales_phage	86.8	1.8e-53
WP_001251821.1|5535687_5536272_-|tail	tail protein	tail	A0A2H4JET9	uncultured_Caudovirales_phage	93.3	2.9e-98
WP_001243517.1|5536287_5536650_-	DUF3168 domain-containing protein	NA	A0A2H4JBW1	uncultured_Caudovirales_phage	84.2	2.4e-55
WP_000818832.1|5536646_5537084_-	hypothetical protein	NA	A0A2H4JBV5	uncultured_Caudovirales_phage	80.7	4.5e-64
WP_001068032.1|5537071_5537416_-|head	phage head closure protein	head	A0A2H4JHA9	uncultured_Caudovirales_phage	71.1	7.0e-44
WP_000904085.1|5537412_5537706_-	hypothetical protein	NA	A0A0A7S0C9	Clostridium_phage	39.6	4.6e-12
WP_001123701.1|5537740_5538913_-|capsid	phage major capsid protein	capsid	A0A2H4JHG1	uncultured_Caudovirales_phage	62.5	2.4e-128
WP_002134054.1|5538950_5539649_-|protease	Clp protease ClpP	protease	A0A0A7RTN2	Clostridium_phage	59.0	2.7e-71
WP_000499523.1|5539939_5541133_+|transposase	IS110-like element ISBth13 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	26.1	1.1e-24
WP_000264107.1|5541227_5542448_-|portal	phage portal protein	portal	A6M949	Geobacillus_virus	53.0	5.4e-123
WP_001082759.1|5542461_5544177_-|terminase	terminase large subunit	terminase	A0A0A7RVS5	Clostridium_phage	63.2	5.3e-217
WP_000113652.1|5544186_5544708_-|terminase	phage terminase small subunit P27 family	terminase	Q9ZXG2	Bacillus_phage	63.7	5.6e-53
WP_000924768.1|5544807_5545221_-	HNH endonuclease	NA	Q0SPJ9	Clostridium_phage	43.0	1.6e-23
WP_000869623.1|5545201_5545447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001091354.1|5545449_5545614_-	helix-turn-helix domain-containing protein	NA	A0A142F1N8	Bacillus_phage	64.4	2.0e-09
WP_000964495.1|5545618_5545843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000002735.1|5545842_5546277_-	hypothetical protein	NA	A0A0A7AQA1	Bacillus_phage	55.0	4.3e-14
WP_000370222.1|5546269_5546512_-	hypothetical protein	NA	A0A0S2MVA9	Bacillus_phage	87.5	1.1e-30
WP_016090301.1|5547157_5547700_-|integrase	site-specific integrase	integrase	W8CYP1	Bacillus_phage	92.2	1.3e-89
WP_000166188.1|5547699_5548182_-	ArpU family transcriptional regulator	NA	H0USV3	Bacillus_phage	83.1	1.1e-71
WP_000677456.1|5548209_5548380_-	hypothetical protein	NA	A0A1B0T6D0	Bacillus_phage	82.1	4.5e-12
WP_001226456.1|5548508_5548895_-	hypothetical protein	NA	I7I4E2	Bacillus_phage	100.0	5.2e-72
WP_000873130.1|5549014_5549293_-	hypothetical protein	NA	I7J4K9	Bacillus_phage	100.0	8.1e-43
WP_000351065.1|5549289_5549487_-	hypothetical protein	NA	I7IDJ9	Bacillus_phage	100.0	5.6e-30
WP_000406974.1|5549522_5549699_-	hypothetical protein	NA	I7ILW5	Bacillus_phage	100.0	1.8e-24
WP_002134061.1|5549732_5550098_-	hypothetical protein	NA	I7J6W4	Bacillus_phage	100.0	3.6e-59
WP_002134063.1|5550132_5550294_-	hypothetical protein	NA	A0A1B1P7M8	Bacillus_phage	70.6	3.5e-14
WP_000350118.1|5550338_5550767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000539656.1|5550910_5551078_-	hypothetical protein	NA	A0A0M4RER6	Bacillus_phage	90.4	7.5e-20
WP_000670920.1|5551108_5551318_-	hypothetical protein	NA	A0A068EPB6	Bacillus_phage	47.1	2.4e-07
WP_001268380.1|5551357_5551630_-	hypothetical protein	NA	I7J4K9	Bacillus_phage	58.1	2.7e-19
WP_000455138.1|5551673_5552057_-	hypothetical protein	NA	Q2LI92	Bacillus_phage	44.1	1.1e-24
WP_001030635.1|5552086_5552620_-	hypothetical protein	NA	U5PUK4	Bacillus_phage	59.4	4.4e-53
WP_000323893.1|5552612_5552810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000331942.1|5552845_5553235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001134294.1|5553279_5553753_-	hypothetical protein	NA	A0A0H3UZ60	Geobacillus_virus	57.5	2.7e-30
WP_001054607.1|5553793_5554303_-	dUTPase	NA	A0A1L2JY27	Aeribacillus_phage	44.9	1.4e-27
WP_000109543.1|5554322_5554574_-	hypothetical protein	NA	A0A0K2CNP4	Brevibacillus_phage	42.2	2.2e-07
WP_000717829.1|5554599_5554767_-	DUF3954 domain-containing protein	NA	A0A1B0T6B8	Bacillus_phage	64.2	9.5e-15
WP_001125972.1|5554785_5555145_-	hypothetical protein	NA	A0A1B1P7A1	Bacillus_phage	54.2	4.9e-32
WP_000799098.1|5555137_5555416_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	59.3	1.6e-11
WP_000337984.1|5555432_5555627_-	hypothetical protein	NA	A0A0U3K3J8	Bacillus_phage	81.2	6.5e-23
WP_001148230.1|5555629_5556493_-	ATP-binding protein	NA	A0A1B0T6C3	Bacillus_phage	94.9	3.1e-133
WP_000190244.1|5556440_5557181_-	DnaD domain protein	NA	A0A1B0T6C0	Bacillus_phage	82.5	2.4e-81
WP_001084331.1|5557185_5557362_-	hypothetical protein	NA	A0A1B1P7U0	Bacillus_phage	86.2	7.7e-23
WP_000969632.1|5557391_5557559_-	hypothetical protein	NA	A0A0U3B230	Bacillus_phage	79.6	6.0e-17
WP_001246222.1|5557555_5557906_-	helix-turn-helix domain-containing protein	NA	A0A1B0T6C2	Bacillus_phage	87.1	7.5e-54
WP_000022043.1|5557902_5558145_-	helix-turn-helix transcriptional regulator	NA	A0A1B0T6B2	Bacillus_phage	83.3	1.1e-24
WP_000172107.1|5558366_5558720_+	helix-turn-helix transcriptional regulator	NA	A0A1B0T6A7	Bacillus_phage	85.5	9.6e-49
WP_002134067.1|5559087_5559237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000838797.1|5559233_5560373_-	hypothetical protein	NA	H0UST6	Bacillus_phage	58.6	1.6e-124
WP_000703672.1|5560934_5561798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000679465.1|5561956_5563081_+|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	98.1	2.0e-212
WP_000105033.1|5563139_5564519_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	46.7	3.8e-117
5563158:5563186	attR	CCAAGCCACACACTCCACATGAGTCGTAT	NA	NA	NA	NA
>prophage 13
NZ_CP013055	Bacillus thuringiensis strain YWC2-8 chromosome, complete genome	5674369	5601974	5610350	5674369		Synechococcus_phage(50.0%)	8	NA	NA
WP_000088589.1|5601974_5602562_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.4	9.1e-28
WP_001262439.1|5602558_5603599_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	45.9	1.2e-67
WP_000879025.1|5603704_5605120_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.4	3.3e-55
WP_000055562.1|5605104_5607324_-	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	41.2	2.6e-163
WP_000666789.1|5607307_5607991_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_000278823.1|5607987_5608242_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_001170544.1|5608234_5608954_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	44.3	4.0e-49
WP_000625682.1|5609042_5610350_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.3	4.9e-21
>prophage 14
NZ_CP013055	Bacillus thuringiensis strain YWC2-8 chromosome, complete genome	5674369	5656459	5670259	5674369	holin,transposase,tail	Bacillus_phage(87.5%)	10	NA	NA
WP_000741567.1|5656459_5657536_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	86.6	1.2e-171
WP_002134199.1|5657877_5658069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000956437.1|5658084_5658351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000579579.1|5659354_5660605_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	41.9	2.7e-69
WP_000403436.1|5661056_5661995_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2MV84	Bacillus_phage	94.7	3.3e-136
WP_000373855.1|5661994_5662420_-|holin	phage holin family protein	holin	A0A1B1P787	Bacillus_phage	97.2	4.8e-71
WP_000390477.1|5662495_5662720_-	hypothetical protein	NA	A0A1B1P780	Bacillus_phage	89.2	1.1e-26
WP_015382147.1|5662846_5663212_-	hypothetical protein	NA	A0A0S2MVE0	Bacillus_phage	59.0	3.7e-35
WP_015382146.1|5663228_5668793_-	hypothetical protein	NA	A0A0S2MVB4	Bacillus_phage	64.1	0.0e+00
WP_000093847.1|5668789_5670259_-|tail	phage tail protein	tail	A0A0S2MV63	Bacillus_phage	78.3	1.1e-231
>prophage 1
NZ_CP013056	Bacillus thuringiensis strain YWC2-8 plasmid pYWC2-8-1, complete sequence	250706	102197	154061	250706	protease,transposase,integrase	Bacillus_phage(40.0%)	46	135081:135140	154129:155783
WP_001098031.1|102197_103133_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_000502626.1|103222_103492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000869334.1|103605_103809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001180021.1|103865_104051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001216652.1|104167_104587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001233517.1|104653_105004_+	PrgI family protein	NA	NA	NA	NA	NA
WP_000892000.1|105004_105919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016090237.1|105921_108030_+	DUF87 domain-containing protein	NA	NA	NA	NA	NA
WP_000890337.1|108060_112080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000108316.1|113745_115551_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	28.1	5.5e-31
WP_003275463.1|116606_118403_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	27.1	6.9e-34
WP_000043048.1|118471_118663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001149932.1|119238_121062_+	maturase	NA	A0A0U4J920	Pseudomonas_phage	33.3	5.6e-23
WP_014481869.1|121221_122097_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A7KUS1	Bacillus_phage	38.3	3.5e-15
WP_000757464.1|122113_122689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001242518.1|122850_123234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000104242.1|123230_123530_+	DUF2325 domain-containing protein	NA	NA	NA	NA	NA
WP_000659905.1|123658_123967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000343609.1|124006_124732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000342852.1|124782_125028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001065855.1|125359_126043_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001186844.1|126499_127645_-	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_000725572.1|127685_128168_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_000523962.1|128778_130125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000025329.1|130124_130553_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_001102776.1|130865_131939_-	hypothetical protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	44.2	1.8e-77
WP_000802626.1|132188_133679_+	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_000888766.1|134658_134910_-	YolD-like family protein	NA	NA	NA	NA	NA
135081:135140	attL	CATGCCCATCAACTTAAGGATAGAAACTCTACGGTTTTCCATTAATTGAAATGAACAAAC	NA	NA	NA	NA
WP_001053969.1|135207_136644_-|transposase	IS4-like element IS231C family transposase	transposase	NA	NA	NA	NA
WP_000351941.1|137531_138431_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000020440.1|138553_139141_+	flavodoxin family protein	NA	NA	NA	NA	NA
WP_016090335.1|139155_140085_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000650425.1|140513_141488_-	DUF4179 domain-containing protein	NA	NA	NA	NA	NA
WP_000955500.1|141491_142022_-	RNA polymerase sigma factor SigX	NA	NA	NA	NA	NA
WP_000898260.1|142564_142804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000417392.1|142856_143108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001154608.1|143326_143701_-	hypothetical protein	NA	D2XQ01	Bacillus_virus	52.5	4.8e-30
WP_000238290.1|143749_144058_-	YolD-like family protein	NA	NA	NA	NA	NA
WP_000794364.1|144354_145143_+	sulfotransferase family 2 domain-containing protein	NA	A0A288WG17	Bacillus_phage	51.4	2.8e-64
WP_000027993.1|145231_146005_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_000349585.1|146045_146837_+	sulfotransferase family 2 domain-containing protein	NA	A0A288WG17	Bacillus_phage	68.4	6.8e-103
WP_000247457.1|146905_147310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001028065.1|147302_149312_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000477499.1|149308_150406_-|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	30.3	6.5e-11
WP_000272577.1|150586_151852_-	Y-family DNA polymerase	NA	O64031	Bacillus_phage	46.7	4.2e-102
WP_001053969.1|152624_154061_+|transposase	IS4-like element IS231C family transposase	transposase	NA	NA	NA	NA
154129:155783	attR	GTTTGTTCATTTCAATTAATGGAAAACCGTAGAGTTTCTATCCTTAAGTTGATGGGCATGGGGTTAATTCACTATGTTAAAGAAAATGATGTTTATGTTAATGGCTCTTACTCTAGTTTTTGTACCAACTCTCGCTTCAGCTGCAACTATAGAGGATGGAAAGAAATACAACGCAACACAGGAGGAATTAGAAGCTCAAGTTAAAGAATTAGAATATATTTTTTCGGTACTTATGGTAAAGGATGATAAAACAGGTAAATATGTTCTTAATAAAGAAGAATTAGCGAAATCTTCATATAACAATGAAGAAAAAGCAGCTATTATAGCTGGTGTTTATGTAATGAATGATGAAGAAATTCCATCTAATATGTACTCTAGTAACGTTTGGGAAAGATGTTGGCAGGATGCATTAGGTATTAGTAAATCATATTTTAATCAAATAAAATCGTATCTTAAGAAAGAGGATTACTGGGGAGCATTGGGAATGCTTTCGTTGCTTGGGCTACCATATAAGCCTGCGTTGTTATTTGCTTTTGCAGTAACTTGCGGGCCAGCTCCAGCTTATATTGCACCTAACCCTCATGAATAATAAGCCTGATATCTTATAAGTAAATGAACTAAAATTAGAATCTCTTTTGTAAATCTATTGATGCAAAAGAGATTCTTTTATCTTTTTAAAGAAGTATTTCTGTTAAATATGAAAATATTAAGTATATTCTGTTGAAAAAAAGTAGATTTGAAGTAAGTTAAACTTTCATATGATATGCTTATTCTATACTAACTAATTTTCAGGTGAGGAGTTGATCGGTTATTACTAGTATAGAGAATATATATAATGTTTCTGTATTCTTAATGCTTTTATCTACTTTTTGTTTTTATCTGTATTTACGAAAAATAAAAAGAGAAAGAAAGCTCACTGGTTTCGAATTTACAATGTATATCATAACACAAGTTAGTTACATTCTTTGGGGAATCTATATTATTTATATAAACTTTGGATGATATTTTTTGTTTTATGAAAAAAAGGCTATTAAAAAAGGGTTTGAGATAAATATCAAACCCTTTTGACTATATATAATTATTTCACTGCTTCTTTTAATTCTTTTCCAGCTTTAAAAGCAGGTGCCTTTGAAGCGGCGATTTGCATTTCTTCACCTGTTTGTGGGTTACGTCCTGTACGTGCAGATCTTTCACGTACTTCAAATGTACCAAAACCAAGAATCTGTACTTTTTCTCCATTTGCTAGCGCATTTGTTATTGTATCTAAAACAGCTTGTGTTGCTGCAGCTGCATCCTTTTGTGTAAGTTCTGCTTTTTCTGCTATTACTTTTGTTAATTCTGTCTTATTCATTTTTTGCACCTCTTCATATGTAATTAGGTGACTATTATAACGTGTGTATACTTATGATGCAATTAATATTGTGCATAGAAAAAGCCCTAGCAAGAGCTAGGGGACAATTTCTGTGTGGTAGTAAGAAAGAAAAACATGTTCATCGTACAGTCTAAATTGTAACATCTATATTAAATGATGAAAAGTACTTATTCTAGATGTTCTACTTGTTTCCACATATTCTATAATGAAAAATATCCCTCTAATTCATTTCATCTTAGAAGGATATTTCCAATCTTTTTCTTTTCGAGTATTTAGAGCAGGT	NA	NA	NA	NA
>prophage 2
NZ_CP013056	Bacillus thuringiensis strain YWC2-8 plasmid pYWC2-8-1, complete sequence	250706	161476	222992	250706	integrase,transposase	Bacillus_phage(23.53%)	50	152624:152683	166287:167855
152624:152683	attL	TATGAATCTTTCAATTCAAGATGAATTACAACTATTTTCTGAAGAGCTGTATCGTCATTT	NA	NA	NA	NA
WP_001021539.1|161476_162520_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0E3T6D9	Bacillus_phage	23.1	1.2e-09
WP_000149389.1|162751_163102_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_000121085.1|163123_163636_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000346798.1|164214_164379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053969.1|164908_166345_-|transposase	IS4-like element IS231C family transposase	transposase	NA	NA	NA	NA
WP_000532004.1|166510_167815_+	WXG100 family type VII secretion target	NA	NA	NA	NA	NA
WP_000128275.1|167837_168056_+	hypothetical protein	NA	NA	NA	NA	NA
166287:167855	attR	AAATGACGATACAGCTCTTCAGAAAATAGTTGTAATTCATCTTGAATTGAAAGATTCATAAAAAATGTCATCCTTTCTAGCTAGCTTTTTAGAAAGAATAACGTTTTTTGACACTTGGGGGTAGTGCAAATTCTTAAGTTGATGGGCATGTGTCTGTACCCCCCTATGAATTTTCTATACTTGTACTAGAAGTTTTATACATATAGGTGAAGGGAGGAAATTAATTGGGACAAGTACGTGTTGACCCAGATAAATTAGAATCAGCTGCAAATTCCATGTCACGAAATAGAGAGTCTATGGAAAGTATAATTCGAGAGCTTTTACAAGTCACGTTCGAATTACAGATGTCTTGGGAAGGGATGGCATATCAACGGTTTTTCGATGAATTTTTCTCAAAAAAGAGGAGTATGGATGATTTAGTTAAGCATTTACATCATACTGAACTCGAACTAAAGAAAGCTGCGAAAACATTCCGTGAAGCGGATGAGAAAGCGTTTGGGGATTTTAATCAGATGGGCAAGCTATGGGACGCCTTTCAGCGAGGAAGCGGGAAGGCTGCAGGGGACACTATTTTTGATCCATTAAAAAAAGGGTGGAACCAAACATCCGACTTTTTCGGAAACTTGGTGGATAATCCAATGGACGCATTGGAAGATGCAAAATATGGACTTACGGACTTTGTGGAGAGTTCTATTGATGATACGAAAGAGGAATTTAGAGATAAATACGAATTTATGAAAGATATGTGGAATAATCCTATTGGAACATTAAAACATGAGTTGGACGAGGAAGTCCAAGAGATGTATGCTATACGAAATGTTTTATCAGATTGGTATGTGGAGAACATAAAATATGGAGATGCAGAAAGTATCACGGAATCAGTAGCATACGGAGCGACTAATTTAGCTTTCTTTGGACTTGTCACAAGAGGTGCCAGTGCCGTAGGTAATGGTGCAAGATGGGGAAAAAATTTATCATCTATATCCAAGCTTCAGTTAGAAAATCGTTTAGAACCAGCTTTCGCTTATGGTAAGATAGATTATAAAGTTGATACTATTAAACCATCAGATACATATATGTTTGCAAAAACTTCAAGTGCGGTAAAAAGAAAGACCCCAGGTACAGTGACCTCAAGTTTTAACCTCGAACGAAGTTTAGGTACCCAAAAGAAGTTAATGTATAATGATGGTGCTATTGGTATTATTCCGCAAGAAGTTCGAGAAAAATTAGTAGGAAGAGAATTCAAATCTTTTGACGATTTTAGAGAAGAATTTTGGAAAACACTTTCTGATTCGAGCTATGCTAAAGAATTTAGTCCTATGAATATAAAACTTATGAAGCAGGGTAAGGCACCTTACTCACCACGAGCAGAACATTATGGGAACCATAATAAATATATACTACATCATAAACAGCCTATTGATAAAGGTGGAGATGTCTATAATCTTGATAATCTAATAATTGTATCTCCTAAAATGCATCAAAACGTTTTAGATCCCGCATACCATTTCGGGACCAAAGGGCTATAAATTAAACGGAAGGATGAAAAATATGACATGTAAAATGACG	NA	NA	NA	NA
WP_000790837.1|168129_168522_-	DUF4878 domain-containing protein	NA	NA	NA	NA	NA
WP_001236345.1|168877_170107_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	49.4	4.5e-85
WP_000997955.1|170837_171587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000065268.1|171874_172099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033679476.1|172278_173109_+	SEC-C motif-containing protein	NA	NA	NA	NA	NA
WP_014481861.1|173192_173357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000737575.1|173480_173618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001103226.1|173614_174709_-	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	48.8	1.5e-92
WP_000844156.1|175053_175302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000845491.1|175438_175648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001032039.1|176200_176500_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016099974.1|177066_178083_+	exosporium leader peptide-containing protein	NA	NA	NA	NA	NA
WP_000520933.1|180215_181088_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000169371.1|182081_183389_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.0	1.3e-26
WP_001100112.1|183562_183742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014481860.1|185327_185639_-	mono-ADP-ribosyltransferase C3 (Exoenzyme C3)	NA	NA	NA	NA	NA
WP_014481859.1|185598_186135_-	ADP-ribosyltransferase	NA	NA	NA	NA	NA
WP_016090368.1|186751_186913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000954716.1|187667_188510_+	N-hydroxyarylamine O-acetyltransferase	NA	NA	NA	NA	NA
WP_001255046.1|188799_189147_+	DUF4064 domain-containing protein	NA	A0A0S2MVJ2	Bacillus_phage	54.1	2.5e-25
WP_003319651.1|189339_189702_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	45.7	6.0e-14
WP_001025593.1|190498_193570_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	22.3	4.3e-44
WP_001224533.1|193820_194444_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	33.7	4.4e-12
WP_002133690.1|195090_195342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016090366.1|195965_199499_-	pesticidal crystal protein cry1Ac	NA	NA	NA	NA	NA
WP_000215667.1|199788_200745_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2MV84	Bacillus_phage	39.5	6.9e-49
WP_001053956.1|202536_203973_+|transposase	IS4-like element IS231B family transposase	transposase	NA	NA	NA	NA
WP_000275580.1|204180_205476_+|transposase	IS21-like element IS232 family transposase	transposase	A0A059NT83	Lactococcus_phage	31.0	1.0e-42
WP_000798699.1|205465_206218_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	47.3	7.0e-57
WP_016090469.1|206379_206823_-|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	65.6	9.6e-46
WP_016099948.1|207221_208217_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	79.7	1.1e-137
WP_016097421.1|208392_208935_-	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	31.5	3.4e-13
WP_016097422.1|209115_210579_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	57.2	8.1e-142
WP_016090463.1|210601_211021_+	universal stress protein	NA	NA	NA	NA	NA
WP_016090464.1|211107_212775_+	ribonuclease J	NA	NA	NA	NA	NA
WP_140159901.1|213133_214063_-	collagen-like protein	NA	NA	NA	NA	NA
WP_016090232.1|215603_216200_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_016090231.1|216478_216889_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_016090230.1|217018_217780_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_016090229.1|217907_218294_-	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_016090228.1|218326_219139_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_016090227.1|219455_220001_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	41.0	1.1e-30
WP_016090226.1|220043_222992_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	26.6	6.1e-80
>prophage 1
NZ_CP013057	Bacillus thuringiensis strain YWC2-8 plasmid pYWC2-8-2, complete sequence	84491	7941	59444	84491	integrase,transposase	Lactococcus_phage(26.67%)	48	54621:54637	60046:60062
WP_000275580.1|7941_9237_+|transposase	IS21-like element IS232 family transposase	transposase	A0A059NT83	Lactococcus_phage	31.0	1.0e-42
WP_000798699.1|9226_9979_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	47.3	7.0e-57
WP_000412868.1|10644_11064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012008613.1|11469_12036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000230191.1|12096_13368_-	ParM/StbA family protein	NA	NA	NA	NA	NA
WP_001200537.1|13593_14013_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_016097290.1|14028_14322_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016090467.1|14877_15420_-	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	31.5	4.5e-13
WP_142388634.1|16070_17861_-	collagen-like protein	NA	NA	NA	NA	NA
WP_016090232.1|19032_19629_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_016090231.1|19907_20318_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_016090230.1|20447_21209_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_016090229.1|21336_21723_-	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_016090228.1|21755_22568_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_016090227.1|22884_23430_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	41.0	1.1e-30
WP_016090226.1|23472_26421_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	26.6	6.1e-80
WP_002133690.1|27117_27369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044157363.1|27914_29168_+|transposase	IS21-like element IS232 family transposase	transposase	A0A059NT83	Lactococcus_phage	31.0	9.7e-43
WP_000798699.1|29199_29952_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	47.3	7.0e-57
WP_001224533.1|30203_30827_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	33.7	4.4e-12
WP_001025593.1|31077_34149_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	22.3	4.3e-44
WP_000190466.1|34258_34675_-	hypothetical protein	NA	A0A2H4J4V0	uncultured_Caudovirales_phage	44.9	5.9e-29
WP_016097345.1|34694_35852_-	WXG100 family type VII secretion target	NA	A0A2H4J389	uncultured_Caudovirales_phage	65.8	2.9e-142
WP_012008607.1|36284_37817_-	replication protein ori43	NA	NA	NA	NA	NA
WP_012008606.1|38593_39292_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_012008605.1|39403_40048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012008604.1|40194_40377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003272553.1|40404_40671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000217377.1|40862_41177_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000876891.1|41258_41810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012008603.1|42769_43063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040120061.1|43121_43445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012008601.1|43605_43977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012008600.1|44059_44434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012008599.1|44480_45095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012008598.1|45161_45431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001004369.1|45474_45807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000651963.1|46040_46226_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000751784.1|46900_47035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000287770.1|47031_48144_-	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	47.8	3.4e-92
WP_016097343.1|48361_48796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000382147.1|48957_49812_+|integrase	tyrosine-type recombinase/integrase	integrase	S5M9V8	Brevibacillus_phage	26.4	4.4e-23
WP_000538375.1|49830_52794_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	39.2	4.1e-201
WP_001053969.1|52986_54423_-|transposase	IS4-like element IS231C family transposase	transposase	NA	NA	NA	NA
WP_016099920.1|54400_54874_-	hypothetical protein	NA	NA	NA	NA	NA
54621:54637	attL	AATATATATTTTTGATT	NA	NA	NA	NA
WP_000946495.1|54888_55263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012008596.1|55310_57965_-	type IA DNA topoisomerase	NA	NA	NA	NA	NA
WP_000432938.1|58517_59444_-|integrase	tyrosine-type recombinase/integrase	integrase	S5M9V8	Brevibacillus_phage	34.2	2.2e-36
60046:60062	attR	AATATATATTTTTGATT	NA	NA	NA	NA
>prophage 1
NZ_CP013059	Bacillus thuringiensis strain YWC2-8 plasmid pYWC2-8-4, complete sequence	80699	13430	39320	80699	integrase,transposase,protease	Bacillus_phage(25.0%)	22	30257:30294	39618:39655
WP_016097323.1|13430_13877_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_016097325.1|14266_15265_-|integrase	site-specific integrase	integrase	A0A1B1P793	Bacillus_phage	35.1	3.1e-36
WP_016097326.1|15236_15854_-	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	32.0	2.7e-14
WP_016097327.1|16514_17099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016097328.1|17175_17421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_090782881.1|17516_18676_-|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	41.6	1.5e-37
WP_016097331.1|18827_19202_-	hypothetical protein	NA	D2XQ01	Bacillus_virus	51.3	1.5e-28
WP_016097332.1|19661_20297_+	DUF3967 domain-containing protein	NA	A0A1Z1LZN4	Bacillus_phage	28.4	8.7e-08
WP_016097333.1|20439_21555_+	transcriptional regulator	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	52.2	1.2e-92
WP_016097335.1|22399_24040_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016097336.1|24106_24832_+	hypothetical protein	NA	A0A0A7AR45	Bacillus_phage	54.9	7.8e-61
WP_016097337.1|24989_25319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016097338.1|25334_25568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016097339.1|25692_26016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016097340.1|25978_26905_-	AAA family ATPase	NA	F0PIG8	Enterococcus_phage	35.4	1.1e-30
WP_016097341.1|27775_29317_+	replication initiation protein RepS	NA	NA	NA	NA	NA
WP_016097342.1|29519_30293_+	hypothetical protein	NA	NA	NA	NA	NA
30257:30294	attL	GGGGTACCGCCAGCATTTCGGAAAAAAACCACGCTAAG	NA	NA	NA	NA
WP_000538375.1|30322_33286_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	39.2	4.1e-201
WP_044157348.1|33304_34141_-|integrase	tyrosine-type recombinase/integrase	integrase	S5M9V8	Brevibacillus_phage	27.0	3.7e-22
WP_002133690.1|34476_34728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001224533.1|35374_35998_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	33.7	4.4e-12
WP_001025593.1|36248_39320_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	22.3	4.3e-44
39618:39655	attR	CTTAGCGTGGTTTTTTTCCGAAATGCTGGCGGTACCCC	NA	NA	NA	NA
>prophage 1
NZ_CP013060	Bacillus thuringiensis strain YWC2-8 plasmid pYWC2-8-5, complete sequence	46634	45	46397	46634	holin,terminase,portal,head,tail,integrase	Bacillus_phage(100.0%)	68	9387:9402	42453:42468
WP_016090401.1|45_708_-	hypothetical protein	NA	A0A0S2MVD6	Bacillus_phage	100.0	5.3e-125
WP_016090400.1|731_1835_-	hypothetical protein	NA	A0A0S2MVK1	Bacillus_phage	100.0	1.5e-172
WP_016090399.1|2434_2779_-	DUF4064 domain-containing protein	NA	A0A0S2MVJ2	Bacillus_phage	100.0	5.3e-52
WP_016090398.1|2798_3326_-	DUF4352 domain-containing protein	NA	A0A0S2MVG4	Bacillus_phage	100.0	2.0e-90
WP_016090397.1|3936_4254_-	helix-turn-helix transcriptional regulator	NA	A0A0S2MVM8	Bacillus_phage	100.0	5.8e-53
WP_016090396.1|4818_6006_+	helix-turn-helix transcriptional regulator	NA	A0A0S2MVK2	Bacillus_phage	100.0	4.6e-220
WP_016090395.1|6052_6199_+	hypothetical protein	NA	A0A0S2MVH0	Bacillus_phage	100.0	2.3e-20
WP_016090394.1|6350_6488_+	hypothetical protein	NA	A0A0S2MVE3	Bacillus_phage	100.0	3.2e-16
WP_016090393.1|6493_6844_-	helix-turn-helix transcriptional regulator	NA	A0A0S2MVD3	Bacillus_phage	100.0	4.7e-56
WP_016090392.1|7057_7255_+	helix-turn-helix transcriptional regulator	NA	A0A0S2MVJ7	Bacillus_phage	100.0	1.4e-28
WP_016090391.1|7321_8050_+	rha family phage regulatory protein	NA	A0A0S2MVD8	Bacillus_phage	100.0	2.6e-133
WP_016090390.1|8061_8436_+	hypothetical protein	NA	A0A0S2MVH3	Bacillus_phage	100.0	5.6e-63
WP_016090389.1|8459_9167_+	hypothetical protein	NA	A0A0S2MVI5	Bacillus_phage	100.0	1.0e-129
WP_016090388.1|9166_9346_+	hypothetical protein	NA	A0A0S2MVI7	Bacillus_phage	100.0	5.4e-24
WP_016090387.1|9335_9665_+	hypothetical protein	NA	A0A0S2MVM3	Bacillus_phage	100.0	8.1e-50
9387:9402	attL	GAATATATGATGAATC	NA	NA	NA	NA
WP_016090386.1|9810_10314_+	hypothetical protein	NA	A0A0S2MVD2	Bacillus_phage	100.0	8.5e-91
WP_016090385.1|10282_10666_+	hypothetical protein	NA	A0A0S2MVI0	Bacillus_phage	100.0	1.1e-69
WP_016090384.1|10685_11042_+	hypothetical protein	NA	A0A0S2MVL2	Bacillus_phage	100.0	5.1e-66
WP_016090383.1|11065_11533_+	hypothetical protein	NA	A0A0S2MVF1	Bacillus_phage	100.0	1.3e-85
WP_016090382.1|11646_12084_+	hypothetical protein	NA	A0A0S2MVD9	Bacillus_phage	100.0	1.0e-76
WP_016090381.1|12083_12536_+	hypothetical protein	NA	A0A0S2MVJ1	Bacillus_phage	100.0	7.9e-88
WP_016090380.1|12532_13114_+	hypothetical protein	NA	A0A0S2MVD0	Bacillus_phage	100.0	3.0e-108
WP_016090379.1|13135_13618_+	hypothetical protein	NA	A0A0S2MVE6	Bacillus_phage	100.0	2.5e-87
WP_016090378.1|13751_14051_+	hypothetical protein	NA	A0A0S2MVI8	Bacillus_phage	100.0	1.1e-50
WP_016090376.1|14279_14687_+	hypothetical protein	NA	A0A0S2MVF6	Bacillus_phage	100.0	6.9e-75
WP_016090479.1|15288_15534_+	hypothetical protein	NA	A0A0S2MVC7	Bacillus_phage	100.0	8.4e-36
WP_016090480.1|15583_15808_+	hypothetical protein	NA	A0A0S2MVG0	Bacillus_phage	100.0	4.5e-36
WP_016090481.1|15849_16227_+	hypothetical protein	NA	A0A0S2MVH4	Bacillus_phage	100.0	1.1e-50
WP_016090449.1|16351_16534_+	hypothetical protein	NA	A0A0S2MVH2	Bacillus_phage	100.0	4.3e-29
WP_016049864.1|16564_17095_+	Holliday junction resolvase RecU	NA	A0A0S2MVB5	Bacillus_phage	100.0	1.2e-98
WP_016090448.1|17114_17438_+	hypothetical protein	NA	A0A0S2MV86	Bacillus_phage	100.0	3.3e-56
WP_016090447.1|17582_18083_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0S2MVE1	Bacillus_phage	100.0	1.2e-89
WP_016049868.1|18669_18846_+	hypothetical protein	NA	A0A0S2MVD4	Bacillus_phage	100.0	1.0e-22
WP_016049869.1|18975_19218_+	hypothetical protein	NA	A0A0S2MVA9	Bacillus_phage	100.0	2.9e-36
WP_016049870.1|19210_19477_+	hypothetical protein	NA	A0A0S2MVC8	Bacillus_phage	100.0	2.3e-39
WP_016049871.1|19615_19858_+	DUF2829 domain-containing protein	NA	A0A0S2MV73	Bacillus_phage	100.0	8.6e-41
WP_016049872.1|19857_20121_+	DUF2829 domain-containing protein	NA	A0A0S2MVC6	Bacillus_phage	100.0	9.0e-44
WP_016049873.1|20380_20701_+	hypothetical protein	NA	A0A0S2MVH6	Bacillus_phage	100.0	4.8e-55
WP_016049874.1|20728_21112_+	hypothetical protein	NA	I7J6Y9	Bacillus_phage	100.0	2.2e-67
WP_016049845.1|21144_21474_+	hypothetical protein	NA	A0A0S2MVB8	Bacillus_phage	100.0	1.7e-52
WP_000762692.1|21460_21673_+	hypothetical protein	NA	A0A0S2MV92	Bacillus_phage	100.0	7.1e-31
WP_016049846.1|21823_22738_+|terminase	phage terminase small subunit	terminase	A0A0S2MVB6	Bacillus_phage	100.0	2.5e-141
WP_016049847.1|22727_24002_+|terminase	PBSX family phage terminase large subunit	terminase	A0A0S2MVC1	Bacillus_phage	100.0	2.4e-254
WP_016049848.1|24014_25448_+|portal	phage portal protein	portal	A0A0S2MVB2	Bacillus_phage	100.0	8.5e-277
WP_016090413.1|25521_26289_+	hypothetical protein	NA	A0A0S2MVF0	Bacillus_phage	100.0	1.1e-142
WP_016049850.1|26288_26561_+	DUF2829 domain-containing protein	NA	A0A0S2MV93	Bacillus_phage	100.0	2.5e-49
WP_016049851.1|26640_27321_+	DUF4355 domain-containing protein	NA	A0A0S2MVA2	Bacillus_phage	100.0	9.7e-106
WP_016049852.1|27338_28181_+	hypothetical protein	NA	A0A0S2MVF8	Bacillus_phage	100.0	2.2e-155
WP_016049853.1|28231_28540_+	phage related protein gp15	NA	A0A0S2MVF2	Bacillus_phage	100.0	3.1e-51
WP_016049854.1|28536_28881_+|head,tail	head-tail adaptor protein	head,tail	A0A0S2MVD7	Bacillus_phage	100.0	6.7e-63
WP_016049855.1|28855_29263_+	HK97 gp10 family phage protein	NA	A0A0S2MVE4	Bacillus_phage	100.0	1.4e-67
WP_016049856.1|29268_29631_+	hypothetical protein	NA	A0A0S2MV90	Bacillus_phage	100.0	1.1e-63
WP_016049857.1|29645_30239_+	hypothetical protein	NA	A0A0S2MV81	Bacillus_phage	100.0	1.6e-109
WP_016049858.1|30285_30714_+	hypothetical protein	NA	A0A0S2MV94	Bacillus_phage	100.0	1.5e-72
WP_044129691.1|30818_31025_+	hypothetical protein	NA	A0A0S2MV68	Bacillus_phage	100.0	5.6e-33
WP_016049860.1|31025_33965_+|tail	phage tail tape measure protein	tail	A0A0S2MVC9	Bacillus_phage	100.0	0.0e+00
WP_016049861.1|33977_35456_+|tail	phage tail fiber protein	tail	A0A0S2MVB9	Bacillus_phage	100.0	9.9e-297
WP_016090411.1|35452_40162_+	phage minor structural protein	NA	A0A0S2MVH9	Bacillus_phage	100.0	0.0e+00
WP_016090410.1|40261_41221_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A068EP13	Bacillus_phage	100.0	4.8e-183
WP_016090409.1|41236_41476_+	hypothetical protein	NA	A0A0S2MVH5	Bacillus_phage	100.0	4.8e-36
WP_016090408.1|41518_41749_+|holin	phage holin	holin	A0A0S2MVE8	Bacillus_phage	100.0	1.1e-34
WP_016090407.1|41765_42701_+	L-alanyl-D-glutamate peptidase	NA	A0A0S2MVR5	Bacillus_phage	100.0	5.7e-189
42453:42468	attR	GATTCATCATATATTC	NA	NA	NA	NA
WP_016090406.1|42995_43280_-	hypothetical protein	NA	A0A0S2MVK9	Bacillus_phage	100.0	2.7e-49
WP_000539769.1|43714_43948_-	helix-turn-helix transcriptional regulator	NA	A0A0S2MVM0	Bacillus_phage	100.0	7.3e-37
WP_016090405.1|44033_44564_-	hypothetical protein	NA	A0A0S2MVP2	Bacillus_phage	100.0	7.1e-96
WP_031303572.1|44575_44956_-	hypothetical protein	NA	A0A0S2MVE7	Bacillus_phage	100.0	2.8e-62
WP_016090403.1|45073_45406_-	hypothetical protein	NA	A0A0S2MVL6	Bacillus_phage	99.1	4.6e-53
WP_016090402.1|45365_46397_-	ParM/StbA family protein	NA	A0A0S2MVG2	Bacillus_phage	100.0	1.1e-196
