The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012981	Burkholderia cepacia ATCC 25416 strain UCB 717 chromosome 1	3791734	1273489	1311993	3791734	plate,protease,transposase	Burkholderia_phage(50.0%)	36	NA	NA
WP_027788532.1|1273489_1274017_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	52.0	9.7e-21
WP_080981881.1|1274320_1274566_+	helix-turn-helix transcriptional regulator	NA	A0A1S5NNJ5	Burkholderia_phage	90.1	1.5e-32
WP_138143304.1|1275169_1276567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080981880.1|1276811_1276943_+	AlpA family phage regulatory protein	NA	E5E3Y1	Burkholderia_phage	88.1	8.2e-14
WP_027788530.1|1277137_1277872_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_080981879.1|1277873_1278959_-	histidine kinase	NA	NA	NA	NA	NA
WP_027788528.1|1279373_1279916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027788527.1|1280270_1280474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027788526.1|1280533_1281334_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027788525.1|1282167_1282476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138143305.1|1283153_1283495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027788523.1|1283756_1284080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027788522.1|1284367_1284949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027788521.1|1285052_1285541_+	DUF4265 domain-containing protein	NA	NA	NA	NA	NA
WP_049096227.1|1285594_1286047_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_027788519.1|1286036_1286396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049096226.1|1286392_1287088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027788517.1|1287180_1287963_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_011350756.1|1287959_1289306_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_027788516.1|1289408_1290020_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_027788515.1|1290393_1291032_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_027788514.1|1291076_1291592_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_006477094.1|1291607_1293098_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_006477093.1|1293168_1293672_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_021161818.1|1294016_1294502_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_027788513.1|1294579_1296415_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_027788512.1|1296378_1297479_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_027788511.1|1297805_1300475_+	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	31.8	3.5e-90
WP_027788510.1|1300514_1301636_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_027788509.1|1301721_1302651_-	OmpA family protein	NA	NA	NA	NA	NA
WP_027788508.1|1302655_1303645_-	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_027788507.1|1303641_1307586_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_021161809.1|1307887_1308733_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_027788506.1|1308854_1309814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027788505.1|1310020_1311046_+	transporter	NA	NA	NA	NA	NA
WP_027788504.1|1311042_1311993_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP012981	Burkholderia cepacia ATCC 25416 strain UCB 717 chromosome 1	3791734	1964117	1972407	3791734		Bacillus_phage(16.67%)	8	NA	NA
WP_027788058.1|1964117_1965518_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.3	1.8e-77
WP_051363294.1|1965525_1966476_+	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	27.5	7.6e-16
WP_027788057.1|1966539_1967532_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	30.9	1.5e-27
WP_021157453.1|1967605_1967953_+	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_027788056.1|1968167_1969070_+	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	40.2	3.7e-52
WP_080982007.1|1969148_1970492_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_021157450.1|1970535_1971459_+	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	34.9	6.7e-41
WP_027788054.1|1971486_1972407_-	alpha/beta hydrolase	NA	Q6TUZ7	Yaba_monkey_tumor_virus	27.2	8.7e-17
>prophage 3
NZ_CP012981	Burkholderia cepacia ATCC 25416 strain UCB 717 chromosome 1	3791734	2576428	2585666	3791734		Pseudomonas_phage(22.22%)	14	NA	NA
WP_027787629.1|2576428_2577388_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	37.6	1.0e-28
WP_006476104.1|2577445_2577661_+	TOBE domain-containing protein	NA	NA	NA	NA	NA
WP_027787628.1|2577800_2577998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027787627.1|2578052_2578298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027787626.1|2578522_2578792_-	pyocin activator PrtN family protein	NA	I6NSR8	Burkholderia_phage	61.4	1.3e-21
WP_027787625.1|2578788_2579571_-	hypothetical protein	NA	A0A0U1SZL2	Pseudomonas_phage	40.4	4.9e-37
WP_027787624.1|2579567_2580056_-	DUF1643 domain-containing protein	NA	B5WZV8	Pseudomonas_phage	50.6	1.6e-38
WP_027787623.1|2580052_2580490_-	hypothetical protein	NA	A0A097EYP5	Mycobacterium_phage	48.1	6.8e-20
WP_138143316.1|2580895_2581183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027787622.1|2581179_2582259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027787621.1|2582251_2583019_-	hypothetical protein	NA	A0A1J0GVP2	Pseudoalteromonas_phage	45.1	1.9e-65
WP_027787620.1|2583082_2583838_-	hypothetical protein	NA	A0A1R3Y5Q7	Salmonella_virus	53.0	4.7e-69
WP_027787619.1|2584263_2584653_-	hypothetical protein	NA	A0A1S6L2W9	Erwinia_phage	73.7	2.7e-44
WP_027787618.1|2584670_2585666_-	RNA-directed DNA polymerase	NA	H7BVN7	unidentified_phage	35.7	3.2e-41
>prophage 4
NZ_CP012981	Burkholderia cepacia ATCC 25416 strain UCB 717 chromosome 1	3791734	2589379	2667625	3791734	plate,terminase,portal,capsid,head,tRNA,tail,integrase	Burkholderia_phage(38.1%)	108	2629538:2629586	2674563:2674611
WP_158605810.1|2589379_2590126_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	35.0	2.9e-18
WP_063623143.1|2590271_2590589_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_034195786.1|2591360_2591660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027787610.1|2592030_2592885_+	hypothetical protein	NA	Q8W6P2	Burkholderia_virus	65.9	5.5e-90
WP_081040784.1|2592881_2593967_+	helix-turn-helix domain-containing protein	NA	A4JX55	Burkholderia_virus	48.6	1.5e-63
WP_027787607.1|2593963_2594509_+	DUF1064 domain-containing protein	NA	A4JX56	Burkholderia_virus	46.0	2.6e-29
WP_099318686.1|2594520_2594913_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_027787606.1|2594909_2595176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027787605.1|2595172_2595616_+	DUF1364 family protein	NA	Q3HR02	Burkholderia_phage	87.8	9.2e-73
WP_027787604.1|2595618_2595951_+	hypothetical protein	NA	A4JX59	Burkholderia_virus	70.0	2.6e-40
WP_051363288.1|2595947_2596187_+	hypothetical protein	NA	A4JX60	Burkholderia_virus	42.3	3.7e-12
WP_051363303.1|2596473_2596683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081040786.1|2597146_2597581_+	DUF4406 domain-containing protein	NA	L7TKQ2	Pseudomonas_virus	56.2	4.5e-24
WP_027787599.1|2597577_2597898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081040814.1|2597972_2598281_+	hypothetical protein	NA	A0A1L7N0Z9	Ralstonia_phage	49.5	5.5e-24
WP_027787597.1|2598305_2598530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027787596.1|2598526_2598895_+	DUF2591 family protein	NA	F8TVJ2	EBPR_siphovirus	38.4	5.4e-10
WP_027787595.1|2598903_2599140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057056459.1|2599167_2599740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027787593.1|2600017_2600320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027787592.1|2600321_2600900_+|tail	phage tail protein	tail	A0A067ZG41	Vibrio_phage	32.1	1.0e-10
WP_027787591.1|2601104_2601698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081040788.1|2601750_2603787_+|terminase	phage terminase large subunit family protein	terminase	A0A2K9V3X4	Faecalibacterium_phage	35.7	5.5e-96
WP_027787589.1|2603794_2604040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027787588.1|2604039_2605710_+|portal	phage portal protein	portal	V5Q9Y6	Xylella_phage	35.8	1.1e-73
WP_027787587.1|2605706_2606573_+	S49 family peptidase	NA	G8DCP1	Silicibacter_phage	52.1	1.6e-49
WP_051363286.1|2606601_2607222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051363285.1|2607264_2608197_+|head	head decoration protein	head	NA	NA	NA	NA
WP_027787586.1|2608305_2609370_+|capsid	major capsid protein	capsid	A0A0A8ILA9	Aurantimonas_phage	37.5	1.8e-53
WP_027787585.1|2609370_2609703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027787584.1|2609699_2610257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027787583.1|2610268_2610466_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_027787582.1|2610462_2611965_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	B5TK67	Pseudomonas_phage	46.5	3.9e-107
WP_034195783.1|2612028_2612400_+|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_051363284.1|2612402_2612690_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_027787579.1|2612835_2614593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027787578.1|2614596_2616054_+	DNA circularization N-terminal domain-containing protein	NA	A0A2P9JZK2	Alteromonadaceae_phage	24.4	2.1e-12
WP_027787577.1|2616057_2617140_+	hypothetical protein	NA	B5TK72	Pseudomonas_phage	32.9	1.7e-43
WP_027787576.1|2617136_2617739_+|plate	phage baseplate assembly protein V	plate	A0A192Y8K5	Salmonella_phage	31.9	2.3e-10
WP_034195782.1|2617735_2618185_+	phage GP46 family protein	NA	B5TAA8	Burkholderia_phage	31.3	1.3e-10
WP_081040790.1|2618185_2619298_+|plate	baseplate J/gp47 family protein	plate	B5TAA9	Burkholderia_phage	26.9	1.0e-19
WP_081040791.1|2619309_2619951_+	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_138143318.1|2619963_2620875_+	hypothetical protein	NA	O22004	Shigella_phage	46.2	1.8e-06
WP_051363283.1|2620890_2621427_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_099318693.1|2623329_2624034_+	lysozyme	NA	A0A059VA40	Pseudomonas_phage	42.2	2.6e-29
WP_027787569.1|2624111_2624747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034195779.1|2624749_2624944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027787568.1|2624986_2625670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027787567.1|2625666_2625975_+	hypothetical protein	NA	A0A1B2IBL3	Erwinia_phage	54.4	6.7e-22
WP_027787566.1|2625971_2626571_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_027787565.1|2626589_2626805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027787564.1|2627212_2628292_-|integrase	tyrosine-type recombinase/integrase	integrase	I6NSG1	Burkholderia_phage	54.5	2.1e-110
WP_081040793.1|2628412_2629453_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
2629538:2629586	attL	AGGATTGTGATTCCTGTCGTCGTGGGTTCGAGTCCCATCAGCCACCCCA	NA	NA	NA	NA
WP_080981894.1|2629673_2630768_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_027787562.1|2630695_2630902_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_027787561.1|2630904_2631918_-	phage Gp37/Gp68 family protein	NA	Q8W6R4	Burkholderia_virus	62.5	1.6e-117
WP_111946790.1|2631914_2632673_-	hypothetical protein	NA	Q8W6Q9	Burkholderia_virus	52.9	1.5e-30
WP_027787560.1|2632669_2633065_-	hypothetical protein	NA	Q6JII6	Burkholderia_virus	70.2	1.7e-46
WP_027787559.1|2633075_2634071_-	RNA-directed DNA polymerase	NA	A0A0N7AE80	Bacillus_phage	34.6	1.7e-45
WP_027787558.1|2634414_2634771_-	four helix bundle protein	NA	NA	NA	NA	NA
WP_027787557.1|2634785_2635250_-	DUF1566 domain-containing protein	NA	NA	NA	NA	NA
WP_027787556.1|2635280_2635643_-	DUF1566 domain-containing protein	NA	NA	NA	NA	NA
WP_027787555.1|2635732_2636356_-	hypothetical protein	NA	A9YX18	Burkholderia_phage	92.6	3.7e-19
WP_027787554.1|2636352_2638119_-	AAA family ATPase	NA	J7HXJ7	Pseudomonas_phage	35.8	3.0e-74
WP_027787553.1|2638131_2639190_-	hypothetical protein	NA	H2BD49	Pseudomonas_phage	54.9	1.1e-76
WP_027787552.1|2639204_2640014_-	PD-(D/E)XK nuclease family protein	NA	J7HXJ4	Pseudomonas_phage	61.3	6.1e-91
WP_167562609.1|2640013_2640178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027787551.1|2640174_2640357_-	hypothetical protein	NA	A9YWW6	Burkholderia_phage	73.0	1.0e-06
WP_027787550.1|2640356_2640686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034195891.1|2640820_2641246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027787548.1|2641279_2641660_-	DUF1566 domain-containing protein	NA	NA	NA	NA	NA
WP_081040797.1|2642493_2642892_-	hypothetical protein	NA	C7BGF7	Burkholderia_phage	76.5	6.8e-51
WP_027787547.1|2642976_2643231_+	Cro/Cl family transcriptional regulator	NA	C7BGF8	Burkholderia_phage	60.0	8.8e-20
WP_027787546.1|2643227_2643455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138143319.1|2643454_2643745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027787544.1|2643856_2644081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027787543.1|2644077_2644290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080981926.1|2644352_2645402_+	DUF1376 domain-containing protein	NA	H2BD69	Pseudomonas_phage	59.0	4.4e-33
WP_027787542.1|2645398_2645764_+	hypothetical protein	NA	Q3HQZ9	Burkholderia_phage	80.5	4.8e-51
WP_080981927.1|2645899_2646193_+	hypothetical protein	NA	A9YWZ0	Burkholderia_phage	63.3	4.4e-23
WP_027787540.1|2646189_2646783_+	hypothetical protein	NA	A9YWZ1	Burkholderia_phage	77.4	6.1e-80
WP_027787539.1|2646890_2647070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027787538.1|2647066_2647720_+	hypothetical protein	NA	A9YWZ4	Burkholderia_phage	85.9	2.1e-105
WP_027787537.1|2647740_2648220_+	DUF2280 domain-containing protein	NA	A9YWZ5	Burkholderia_phage	83.6	3.3e-68
WP_027787536.1|2648221_2649823_+	bacteriophage TerL protein	NA	A9YWZ6	Burkholderia_phage	89.6	1.7e-289
WP_027787535.1|2649819_2651403_+	DUF1073 domain-containing protein	NA	A0A0P0I486	Acinetobacter_phage	61.0	4.6e-151
WP_138143324.1|2651386_2651983_+|capsid	minor capsid protein	capsid	A9YWZ8	Burkholderia_phage	77.2	1.5e-81
WP_027787533.1|2651984_2653289_+	DUF2213 domain-containing protein	NA	A0A0P0IRE1	Acinetobacter_phage	47.3	1.6e-72
WP_027787532.1|2653301_2653790_+	hypothetical protein	NA	A0A0P0I8F3	Acinetobacter_phage	56.8	4.7e-38
WP_027787531.1|2653800_2654838_+	DUF2184 domain-containing protein	NA	A0A0N7IRF2	Acinetobacter_phage	67.7	1.1e-124
WP_027787530.1|2654847_2655285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027787529.1|2655340_2655724_+	DUF4054 domain-containing protein	NA	A9YX25	Burkholderia_phage	75.6	1.2e-52
WP_027787528.1|2655752_2656235_+	hypothetical protein	NA	A9YX26	Burkholderia_phage	84.9	1.6e-70
WP_027787527.1|2656238_2656610_+	hypothetical protein	NA	A9YX28	Burkholderia_phage	87.0	2.2e-59
WP_027787526.1|2656614_2657205_+	hypothetical protein	NA	A9YX29	Burkholderia_phage	79.0	2.8e-85
WP_027787525.1|2657214_2659026_+	DUF3383 domain-containing protein	NA	A0A0P0I492	Acinetobacter_phage	38.8	4.6e-94
WP_027787524.1|2659041_2659482_+	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	58.2	4.9e-42
WP_034195778.1|2659484_2660018_+	hypothetical protein	NA	A0A0N7IRF3	Acinetobacter_phage	40.0	1.8e-22
WP_034195777.1|2660014_2660200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027787522.1|2660192_2662049_+	glucosaminidase domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	41.4	1.6e-38
WP_027787521.1|2662045_2662645_+	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	40.1	3.1e-23
WP_027787520.1|2662644_2662959_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	47.0	1.6e-18
WP_027787519.1|2662958_2663951_+	hypothetical protein	NA	A9YX04	Burkholderia_phage	67.3	3.6e-101
WP_027787518.1|2663947_2664604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027787517.1|2664616_2665360_+	hypothetical protein	NA	A9YX06	Burkholderia_phage	78.1	6.4e-103
WP_027787516.1|2665368_2665722_+	hypothetical protein	NA	A9YX11	Burkholderia_phage	72.6	1.6e-40
WP_027787515.1|2665718_2666906_+|plate	baseplate J/gp47 family protein	plate	A9YX12	Burkholderia_phage	70.4	3.4e-146
WP_027787514.1|2666908_2667625_+	DUF2612 domain-containing protein	NA	A9YX13	Burkholderia_phage	68.2	8.7e-81
2674563:2674611	attR	AGGATTGTGATTCCTGTCGTCGTGGGTTCGAGTCCCATCAGCCACCCCA	NA	NA	NA	NA
>prophage 5
NZ_CP012981	Burkholderia cepacia ATCC 25416 strain UCB 717 chromosome 1	3791734	2992017	3031722	3791734	plate,transposase,protease	Leptospira_phage(16.67%)	32	NA	NA
WP_088611350.1|2992017_2993117_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	2.9e-35
WP_138143282.1|2993793_2996283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088611304.1|2996693_2997903_+|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	62.4	1.0e-97
WP_027787261.1|2998256_2999516_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.5	1.5e-43
WP_138143283.1|3000353_3000767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027787260.1|3000777_3001665_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_027787258.1|3001685_3002573_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_027787257.1|3002574_3003912_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_027787256.1|3003908_3005012_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_027787255.1|3005008_3006361_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_080982084.1|3006357_3007107_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_027787253.1|3007616_3007871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080982120.1|3007809_3008211_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_027787252.1|3008435_3009281_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_006485265.1|3009694_3010261_-	polyhydroxyalkanoate synthesis repressor PhaR	NA	NA	NA	NA	NA
WP_006491801.1|3010380_3011121_-	3-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
WP_027787251.1|3011255_3012437_-	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_027787250.1|3012536_3014402_-	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_027787249.1|3014761_3015601_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_027787248.1|3015607_3016816_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_021163132.1|3016857_3017682_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_027787247.1|3017786_3020033_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	29.3	4.8e-77
WP_006478692.1|3020088_3020304_-	YdcH family protein	NA	NA	NA	NA	NA
WP_027787246.1|3020381_3021134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027787245.1|3021294_3023619_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_034195767.1|3024035_3025064_+	sesquiterpene cyclase	NA	NA	NA	NA	NA
WP_027787243.1|3025086_3027003_-	potassium transporter Kup	NA	A7J6G4	Paramecium_bursaria_Chlorella_virus	32.7	1.1e-77
WP_021163124.1|3027279_3027876_-	phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_011352252.1|3027882_3029229_-	adenylosuccinate synthase	NA	A0A160ER07	Powai_lake_megavirus	36.6	2.6e-70
WP_027787242.1|3029342_3030491_-	ATP phosphoribosyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_011352254.1|3030594_3030786_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_027787241.1|3030822_3031722_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
>prophage 6
NZ_CP012981	Burkholderia cepacia ATCC 25416 strain UCB 717 chromosome 1	3791734	3308781	3400717	3791734	plate,transposase,protease,terminase,holin,portal,capsid,head,tRNA,tail,integrase	uncultured_Caudovirales_phage(25.64%)	91	3345187:3345209	3388987:3389009
WP_027787063.1|3308781_3310191_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_027787062.1|3310471_3311398_+	patatin-like phospholipase family protein	NA	A0A1V0SKV5	Klosneuvirus	27.2	1.7e-07
WP_027787061.1|3311542_3312217_-	C40 family peptidase	NA	A0A217EQL1	Bacillus_phage	40.8	1.2e-20
WP_027787060.1|3312345_3313968_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	1.8e-20
WP_021162484.1|3313964_3315062_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_027787059.1|3315110_3316154_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_148668953.1|3316204_3316888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152036212.1|3317696_3317897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027787057.1|3318212_3318578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011352504.1|3318907_3319240_-	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_021162482.1|3319240_3319849_-	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_021162481.1|3319848_3321855_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_027787056.1|3321858_3322746_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_027787055.1|3323016_3324546_-	NADH-quinone oxidoreductase subunit M	NA	NA	NA	NA	NA
WP_138143286.1|3325140_3325518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027787053.1|3325915_3326314_-	heme-binding protein	NA	NA	NA	NA	NA
WP_027787052.1|3326306_3327083_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_034195760.1|3327151_3328084_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_027787050.1|3328706_3329960_-	aspartate kinase	NA	NA	NA	NA	NA
WP_027787049.1|3330303_3331725_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_006478433.1|3331771_3332743_-	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_027787048.1|3332846_3333674_-	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_027787047.1|3333717_3335115_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	30.9	4.1e-42
WP_027787046.1|3335349_3336072_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_021162660.1|3336111_3336693_+	peptidyl-prolyl cis-trans isomerase	NA	A0A1V0SCU1	Indivirus	38.5	1.2e-11
WP_006751616.1|3336781_3337273_+	peptidyl-prolyl cis-trans isomerase	NA	A0A2H4UTF4	Bodo_saltans_virus	29.6	1.7e-06
WP_027787045.1|3337300_3338101_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_021162662.1|3338159_3338933_-	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_027787044.1|3339240_3340065_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_027787043.1|3340345_3341149_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_027787042.1|3341474_3343097_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_100199223.1|3343250_3343994_-	AAA family ATPase	NA	NA	NA	NA	NA
3345187:3345209	attL	CCAATGATGCAGCAGTACCTGCG	NA	NA	NA	NA
WP_027787040.1|3345368_3346085_+	toll/interleukin-1 receptor domain-containing protein	NA	NA	NA	NA	NA
WP_049096236.1|3346305_3347256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027787038.1|3347449_3348928_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	35.8	4.5e-15
WP_081040819.1|3349152_3349476_-	immunity 52 family protein	NA	A4PE26	Ralstonia_virus	48.0	1.4e-17
WP_059633410.1|3349881_3350493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080982199.1|3350380_3350851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027787035.1|3350840_3351338_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_158605805.1|3351344_3351728_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_027787034.1|3351949_3352735_-	DNA adenine methylase	NA	Q8W6S4	Burkholderia_virus	83.2	9.7e-134
WP_027787033.1|3352905_3353400_-	DUF2514 family protein	NA	C7BGD9	Burkholderia_phage	59.5	2.0e-39
WP_027787032.1|3353396_3353891_-	glycoside hydrolase family 104 protein	NA	Q6J1Q5	Burkholderia_virus	86.6	7.6e-76
WP_027787031.1|3353893_3354178_-|holin	phage holin family protein	holin	C7BGD7	Burkholderia_phage	95.7	3.8e-40
WP_027787030.1|3354254_3355304_-	phage late control D protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	47.5	3.6e-83
WP_027789299.1|3355313_3355520_-|tail	tail protein X	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	58.2	1.5e-14
WP_027787029.1|3355494_3356373_-|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	37.5	8.9e-35
WP_027787028.1|3356383_3358825_-|tail	phage tail tape measure protein	tail	A0A2H4JG00	uncultured_Caudovirales_phage	38.1	3.5e-57
WP_027787027.1|3358905_3359208_-|tail	phage tail assembly protein	tail	A0A1B2LRV6	Wolbachia_phage	39.0	2.7e-07
WP_027787026.1|3359304_3359808_-|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	54.3	2.1e-44
WP_027787025.1|3359818_3360988_-|tail	phage tail sheath family protein	tail	A0A2H4J869	uncultured_Caudovirales_phage	71.8	2.5e-157
WP_027787024.1|3361072_3361852_-|tail	tail assembly chaperone	tail	E5E3Q6	Burkholderia_phage	57.1	1.2e-56
WP_088611304.1|3363443_3364653_+|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	62.4	1.0e-97
WP_034195755.1|3365193_3365772_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	44.1	5.6e-30
WP_027787018.1|3365761_3366658_-|plate	baseplate J/gp47 family protein	plate	A0A218M4K5	Erwinia_phage	41.0	3.9e-46
WP_034195754.1|3366654_3366990_-	GPW/gp25 family protein	NA	A0A2H4JA09	uncultured_Caudovirales_phage	48.1	3.9e-23
WP_027787016.1|3366989_3367190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027787015.1|3367249_3367930_-|plate	phage baseplate assembly protein V	plate	A0A1B2LRU5	Wolbachia_phage	28.5	4.9e-17
WP_027787014.1|3367933_3368458_-	hypothetical protein	NA	Q75QM3	Wolbachia_phage	41.2	1.1e-24
WP_027787013.1|3368447_3368978_-|tail	phage tail protein	tail	A0A2H4JBV1	uncultured_Caudovirales_phage	31.0	9.2e-11
WP_027787012.1|3368980_3369268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027787011.1|3369269_3370265_-|capsid	major capsid protein	capsid	A0A2H4J890	uncultured_Caudovirales_phage	62.7	7.3e-118
WP_027787010.1|3370338_3370683_-|head	head decoration protein	head	NA	NA	NA	NA
WP_027787009.1|3370713_3371790_-|protease	Clp protease ClpP	protease	A0A2H4JDI2	uncultured_Caudovirales_phage	38.5	3.4e-52
WP_027787008.1|3371786_3373280_-|portal	phage portal protein	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	51.4	5.8e-135
WP_027787007.1|3373276_3373483_-	hypothetical protein	NA	A0A219Y8X9	Aeromonas_phage	52.1	8.5e-05
WP_034195753.1|3373496_3375608_-|terminase	phage terminase large subunit family protein	terminase	A0A2D1GMT1	Marinobacter_phage	53.4	1.1e-179
WP_027787004.1|3377148_3377991_-	DUF4747 family protein	NA	NA	NA	NA	NA
WP_027787003.1|3378356_3378944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027787002.1|3379164_3381672_-	virulence protein E	NA	A0A2D1GN57	Marinobacter_phage	39.8	4.9e-94
WP_099318678.1|3381721_3382207_-	hypothetical protein	NA	K7ZPX8	Xanthomonas_citri_phage	33.5	2.1e-09
WP_027787000.1|3382484_3382868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034195752.1|3382869_3383427_-	hypothetical protein	NA	C7BGG0	Burkholderia_phage	47.1	3.5e-29
WP_080982019.1|3383786_3384215_+	transcriptional regulator	NA	A0A0P0J076	Acinetobacter_phage	63.5	3.4e-16
WP_027786997.1|3384672_3384891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027786996.1|3384941_3385304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027786995.1|3385303_3386788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051363300.1|3386865_3387252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080982086.1|3387260_3387503_+	AlpA family phage regulatory protein	NA	C7BGF0	Burkholderia_phage	63.2	4.9e-20
WP_027786993.1|3387480_3388755_-|integrase	integrase family protein	integrase	C7BGE7	Burkholderia_phage	57.8	1.6e-146
WP_049098137.1|3388914_3391605_+	DNA mismatch repair protein MutS	NA	A0A1V0SDQ0	Indivirus	23.6	4.8e-23
3388987:3389009	attR	CCAATGATGCAGCAGTACCTGCG	NA	NA	NA	NA
WP_034195751.1|3391585_3392857_+	membrane protein	NA	NA	NA	NA	NA
WP_027786990.1|3392836_3393379_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_027786989.1|3393411_3394632_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_034195863.1|3394863_3395127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027786988.1|3395240_3396017_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_027786987.1|3396021_3397167_-	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_027786986.1|3397278_3398184_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_027786985.1|3398232_3398835_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011352534.1|3398843_3400046_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_027786984.1|3400054_3400717_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
>prophage 1
NZ_CP012982	Burkholderia cepacia ATCC 25416 strain UCB 717 chromosome 2	3408190	688993	697975	3408190	transposase	Burkholderia_virus(33.33%)	8	NA	NA
WP_027790966.1|688993_689404_-	TIGR02594 family protein	NA	A0A249Y3Q7	Serratia_phage	41.0	4.9e-28
WP_021157316.1|689725_689950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027790965.1|690230_690434_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	70.1	5.4e-20
WP_027790964.1|690810_691722_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	46.8	2.5e-72
WP_027790963.1|691845_693162_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	56.6	6.9e-132
WP_027790962.1|693175_694417_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_027787261.1|694607_695867_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.5	1.5e-43
WP_021157319.1|696112_697975_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	48.2	1.1e-07
>prophage 2
NZ_CP012982	Burkholderia cepacia ATCC 25416 strain UCB 717 chromosome 2	3408190	3081430	3088231	3408190		Burkholderia_phage(50.0%)	12	NA	NA
WP_034196161.1|3081430_3082129_+	hypothetical protein	NA	A9YX14	Burkholderia_phage	54.9	1.5e-56
WP_158605826.1|3082302_3083106_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_027791743.1|3083206_3083389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027791742.1|3083381_3083879_+	lysozyme	NA	Q3HQU9	Burkholderia_phage	92.1	8.4e-83
WP_034196057.1|3083891_3084425_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_080982032.1|3084536_3084695_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_138143377.1|3084777_3085044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051363314.1|3085043_3085880_+	phage antirepressor KilAC domain-containing protein	NA	A0A1W6JP13	Morganella_phage	36.2	1.7e-27
WP_027791740.1|3085945_3086494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034196056.1|3086490_3086970_+	DUF2514 family protein	NA	Q6J1Q4	Burkholderia_virus	55.5	2.8e-35
WP_027791738.1|3087013_3087505_-	hypothetical protein	NA	C7BGE3	Burkholderia_phage	90.8	1.8e-85
WP_027791737.1|3087559_3088231_+	SOS response-associated peptidase family protein	NA	Q8W6R8	Burkholderia_virus	76.1	2.7e-100
