The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LN890524	Salmonella enterica subsp. enterica serovar Weltevreden strain 2511STDY5712385 chromosome 1	4966880	610886	663343	4966880	lysis,tRNA,tail,holin,integrase,terminase,coat,protease	Salmonella_phage(47.46%)	70	624138:624184	663888:663934
WP_000912376.1|610886_612272_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.5	1.1e-44
WP_001143506.1|612362_612911_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190281.1|613038_613251_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729165.1|613252_614119_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	36.5	4.2e-29
WP_000681032.1|614665_615223_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000619604.1|615297_615831_+	type 1 fimbrial protein subunit FimI	NA	NA	NA	NA	NA
WP_001519112.1|615874_616567_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_000754203.1|616597_619210_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_000708649.1|619224_620232_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_000603410.1|620241_620760_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000801273.1|620805_621438_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
WP_001258107.1|622041_622764_-	fimbria biosynthesis regulator FimY	NA	NA	NA	NA	NA
WP_000948629.1|623254_623851_-	fimbria biosynthesis transcriptional regulator FimW	NA	NA	NA	NA	NA
624138:624184	attL	CTTCTAAGCCGTGGGTCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_052909371.1|624197_625361_-|integrase	site-specific integrase	integrase	B9UDL9	Salmonella_phage	96.9	2.2e-222
WP_057516429.1|625590_626226_-	hypothetical protein	NA	A0A075B8I7	Enterobacteria_phage	88.2	3.7e-107
WP_000509169.1|626470_626737_-	hypothetical protein	NA	A0A1V0E5L9	Salmonella_phage	97.7	3.7e-45
WP_057516589.1|626813_627392_-	DUF551 domain-containing protein	NA	G9L6G3	Escherichia_phage	70.7	8.9e-68
WP_001229203.1|627388_627904_-	hypothetical protein	NA	A0A0P0ZBM8	Stx2-converting_phage	100.0	2.4e-101
WP_057516573.1|628391_628580_-	hypothetical protein	NA	A0A192Y8X2	Salmonella_phage	93.5	1.5e-24
WP_057516572.1|628582_629293_-	ead/Ea22-like family protein	NA	A0A0M5M1J9	Salmonella_phage	97.9	3.1e-46
WP_001748035.1|629289_629700_-	hypothetical protein	NA	A0A1R3Y5S0	Salmonella_virus	94.1	5.7e-69
WP_071846992.1|629696_629867_-	DUF2737 family protein	NA	I6S642	Salmonella_phage	98.2	5.1e-24
WP_057516571.1|629877_630171_-	DUF2856 family protein	NA	A0A192Y654	Salmonella_phage	97.9	1.4e-48
WP_001253479.1|630217_630502_-	sigma-70 family RNA polymerase sigma factor	NA	Q76H41	Enterobacteria_phage	98.9	5.2e-45
WP_057516570.1|630501_631209_-	recombinase	NA	K7PKU3	Enterobacteria_phage	96.2	5.7e-133
WP_000361564.1|631402_631516_-	host cell division inhibitory peptide Kil	NA	C6ZR39	Salmonella_phage	100.0	7.8e-13
WP_001200014.1|631508_631649_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	84.8	3.5e-18
WP_057516569.1|631974_632274_-	hypothetical protein	NA	A0A1R3Y5U4	Salmonella_virus	97.0	6.2e-49
WP_000680460.1|632311_632479_-	hypothetical protein	NA	A0A0K2FH54	Enterobacter_phage	53.8	2.2e-11
WP_057516568.1|632487_632826_-	hypothetical protein	NA	E7C9Q7	Salmonella_phage	95.5	6.6e-55
WP_000786965.1|633189_633399_+	fumarate hydratase FumD	NA	I6R0R9	Salmonella_phage	92.8	1.9e-28
WP_000841071.1|633740_634259_-	hypothetical protein	NA	I6R9C4	Salmonella_phage	100.0	1.9e-85
WP_000712403.1|634462_635152_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	100.0	1.3e-126
WP_000182204.1|635262_635478_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	100.0	1.3e-32
WP_001103492.1|635588_635870_+	hypothetical protein	NA	Q76H54	Enterobacteria_phage	100.0	4.3e-44
WP_001125981.1|635904_636051_+	DUF2740 family protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
WP_057516564.1|636043_636877_+	replication protein	NA	A0A1R3Y5R9	Salmonella_virus	98.6	3.0e-149
WP_057517991.1|636873_638250_+	AAA family ATPase	NA	A0A192Y673	Salmonella_phage	99.3	1.4e-252
WP_000736922.1|638323_638761_+	recombination protein NinB	NA	C6ZR55	Salmonella_phage	100.0	7.7e-80
WP_071846993.1|638757_638931_+	protein ninD	NA	C6ZR56	Salmonella_phage	98.2	3.4e-31
WP_000113765.1|638897_639074_+	NinE family protein	NA	C6ZR57	Salmonella_phage	100.0	4.6e-28
WP_057516566.1|639076_639478_+	hypothetical protein	NA	Q9EYC4	Enterobacteria_phage	82.7	4.3e-61
WP_057516567.1|639470_639674_+	protein ninF	NA	I6S668	Salmonella_phage	93.0	8.9e-23
WP_057516587.1|639976_640582_+	recombination protein NinG	NA	E7C9S3	Salmonella_phage	93.5	3.2e-92
WP_000036320.1|640578_640803_+	hypothetical protein	NA	Q76H69	Enterobacteria_phage	100.0	6.3e-38
WP_000149882.1|640799_641003_+	protein ninH	NA	I6RSQ6	Salmonella_phage	100.0	7.2e-33
WP_000219134.1|640983_641163_+	hypothetical protein	NA	I6RSJ2	Salmonella_phage	100.0	3.2e-24
WP_057516414.1|641159_641933_+	antitermination protein	NA	Q76H66	Enterobacteria_phage	99.2	1.5e-131
WP_000738703.1|642357_642684_+|holin	phage holin, lambda family	holin	Q5G8R5	Enterobacteria_phage	100.0	1.7e-52
WP_023177674.1|642667_643105_+	lysozyme	NA	Q5G8R3	Enterobacteria_phage	97.2	1.4e-73
WP_057516415.1|643101_643572_+|lysis	lysis protein	lysis	A0A192Y689	Salmonella_phage	86.1	2.7e-62
WP_021527496.1|643559_643712_+	hypothetical protein	NA	K7PHR3	Enterobacteria_phage	98.0	3.6e-21
WP_001058931.1|643917_644403_+	GIY-YIG nuclease family protein	NA	C6ZR70	Salmonella_phage	100.0	8.5e-88
WP_000807785.1|644650_644893_+	DUF2560 family protein	NA	A0A0M4R322	Salmonella_phage	100.0	7.5e-37
WP_057516416.1|644894_645074_+	hypothetical protein	NA	A0A088CPS9	Enterobacteria_phage	98.3	8.3e-25
WP_000729920.1|645097_645586_+	hypothetical protein	NA	G8EYI7	Enterobacteria_phage	100.0	1.4e-90
WP_057516417.1|645563_647063_+|terminase	terminase	terminase	A0A2D1GLW6	Escherichia_phage	99.6	2.0e-305
WP_023486193.1|647063_649229_+	packaging glycoprotein	NA	A0A2D1GLJ6	Escherichia_phage	99.7	0.0e+00
WP_000373006.1|649242_650154_+	scaffold protein	NA	A0A2D1GLN7	Escherichia_phage	100.0	1.3e-161
WP_057516418.1|650153_651449_+|coat	coat protein	coat	A0A2D1GLV2	Escherichia_phage	98.8	1.8e-241
WP_057516419.1|651493_651718_+	hypothetical protein	NA	A0A2D1GLK1	Escherichia_phage	68.2	6.8e-24
WP_057516420.1|651695_652196_+	recombinase RmuC	NA	G8EYJ2	Enterobacteria_phage	98.2	4.2e-90
WP_057516421.1|652195_653614_+	packaged DNA stabilization protein gp10	NA	A0A2D1GM00	Escherichia_phage	98.5	5.1e-274
WP_057515760.1|653617_654319_+	hypothetical protein	NA	I1TEJ2	Salmonella_phage	99.1	6.1e-71
WP_057516422.1|654318_654774_+	DUF2824 family protein	NA	E7C9U3	Salmonella_phage	99.3	3.0e-87
WP_023135926.1|654776_655466_+	hypothetical protein	NA	B9UDK9	Salmonella_phage	92.6	4.3e-93
WP_162847479.1|655475_656831_+	phage DNA ejection protein	NA	C6ZR17	Salmonella_phage	97.6	4.1e-241
WP_057515761.1|656830_658801_+	hypothetical protein	NA	C6ZR18	Salmonella_phage	99.4	0.0e+00
WP_072141829.1|658956_661074_+|tail	phage tail protein	tail	C6ZR19	Salmonella_phage	99.0	0.0e+00
WP_057516423.1|661420_663343_-	acyltransferase	NA	C6ZR20	Salmonella_phage	98.8	0.0e+00
663888:663934	attR	CTTCTAAGCCGTGGGTCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
>prophage 2
NZ_LN890524	Salmonella enterica subsp. enterica serovar Weltevreden strain 2511STDY5712385 chromosome 1	4966880	1013682	1082269	4966880	lysis,tail,holin,terminase,transposase,portal	Enterobacteria_phage(33.96%)	83	NA	NA
WP_000027181.1|1013682_1014411_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	35.8	6.7e-28
WP_001270724.1|1014640_1015156_-	lipoprotein	NA	NA	NA	NA	NA
WP_072142541.1|1015251_1016577_-	DUF3596 domain-containing protein	NA	Q20GI2	Phage_258-320	64.0	1.9e-166
WP_001193375.1|1016602_1016842_-	excisionase family protein	NA	A0A286S2A4	Klebsiella_phage	68.0	2.5e-24
WP_020844552.1|1016851_1016998_-	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	81.2	1.8e-17
WP_057515154.1|1017209_1017518_-	hypothetical protein	NA	A0A1B5FPC7	Escherichia_phage	82.7	4.2e-16
WP_057515155.1|1017514_1017739_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	69.4	2.9e-19
WP_057515156.1|1017735_1018161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077945177.1|1018150_1018528_-	Lar family restriction alleviation protein	NA	NA	NA	NA	NA
WP_077945176.1|1018557_1019412_-	ORF6N domain-containing protein	NA	F1C5A3	Cronobacter_phage	68.9	2.3e-48
WP_057515158.1|1019366_1019762_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	74.6	1.2e-50
WP_057515159.1|1019751_1019988_-	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	75.3	2.0e-26
WP_077910712.1|1019987_1020365_-	hypothetical protein	NA	A0A1B5FPB3	Escherichia_phage	54.8	5.0e-27
WP_000267316.1|1020327_1020537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023228515.1|1020724_1020910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057515169.1|1020906_1021101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057515160.1|1021202_1021619_-	helix-turn-helix domain-containing protein	NA	Q8W649	Enterobacteria_phage	47.7	3.0e-09
WP_057515161.1|1021760_1022210_-	helix-turn-helix domain-containing protein	NA	K7PHG0	Enterobacteria_phage	30.9	1.1e-09
WP_071846997.1|1022293_1022536_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	45.2	1.1e-14
WP_032652465.1|1022657_1022984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057515163.1|1023107_1024019_+	helix-turn-helix domain-containing protein	NA	Q8W642	Enterobacteria_phage	74.1	1.7e-52
WP_057515164.1|1024119_1025991_+	toprim domain-containing protein	NA	K7PK08	Enterobacteria_phage	61.1	4.4e-225
WP_057515165.1|1025993_1026317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057516611.1|1026313_1027129_+	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	73.1	4.0e-114
WP_057516612.1|1027284_1028478_-|transposase	IS4 family transposase	transposase	S5FM71	Shigella_phage	65.0	8.4e-145
WP_071846998.1|1028734_1029289_+	hypothetical protein	NA	A0A0U2KD26	Escherichia_phage	63.9	2.0e-48
WP_057516650.1|1029215_1029641_+	subtilase cytotoxin subunit B-like protein	NA	NA	NA	NA	NA
WP_001294873.1|1029953_1030343_+|holin	phage holin family protein	holin	K7PHB9	Enterobacterial_phage	72.5	4.8e-41
WP_000226307.1|1030329_1030611_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
WP_057516649.1|1030610_1031225_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	86.3	6.1e-99
WP_057516648.1|1031221_1031704_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	76.5	8.0e-54
WP_057516647.1|1031883_1032387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000744510.1|1032441_1032633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057516646.1|1032984_1033476_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	57.5	7.6e-44
WP_057516645.1|1033462_1035571_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	70.7	4.3e-293
WP_000196423.1|1035567_1035774_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	48.6	1.1e-07
WP_057516644.1|1035770_1037306_+|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	62.7	6.2e-177
WP_001107911.1|1039425_1039749_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	63.2	1.0e-28
WP_023227232.1|1039741_1040017_+	hypothetical protein	NA	K7PH43	Enterobacteria_phage	42.9	6.0e-14
WP_057518682.1|1040026_1040605_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	78.1	1.5e-78
WP_043991247.1|1040653_1041784_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	99.7	4.5e-217
WP_057516608.1|1041892_1042294_+|tail	phage tail protein	tail	Q9G0F3	Phage_Gifsy-1	99.0	4.0e-51
WP_000971954.1|1042301_1043048_+	Ig-like domain-containing protein	NA	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_000479607.1|1043098_1043494_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_077905125.1|1043490_1043829_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	63.6	3.5e-32
WP_057516411.1|1043800_1046842_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	64.8	3.4e-291
WP_000447369.1|1046844_1047174_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_001152689.1|1047183_1047882_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_057515768.1|1047888_1048626_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	84.6	5.7e-128
WP_057524907.1|1048523_1049171_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	78.1	1.0e-88
WP_057516412.1|1049233_1052596_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.9	0.0e+00
WP_000178849.1|1052634_1052877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057525099.1|1052930_1055372_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	63.1	7.3e-87
WP_000593428.1|1055368_1056193_+	macro domain-containing protein	NA	A0A0M4QWS3	Salmonella_phage	94.9	4.9e-152
WP_057516656.1|1056182_1056758_+|tail	tail fiber assembly protein	tail	E5G6P1	Salmonella_phage	87.4	1.2e-93
WP_000711200.1|1057407_1057965_+	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	32.8	3.9e-20
WP_057515787.1|1058255_1058456_-	PagK	NA	NA	NA	NA	NA
WP_071587004.1|1058635_1058797_+	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	97.0	1.5e-09
WP_043991223.1|1058917_1059589_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.4	4.0e-80
WP_001521673.1|1059840_1060053_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.5e-20
WP_000502119.1|1060251_1060710_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_000917260.1|1061210_1062335_+	type III secretion system effector SopF	NA	NA	NA	NA	NA
WP_001033398.1|1063324_1064113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497448.1|1064602_1064842_-	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.5	2.5e-32
WP_001534683.1|1065032_1065554_-	ricin-type beta-trefoil lectin domain protein	NA	NA	NA	NA	NA
WP_001537306.1|1065971_1066184_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_024134152.1|1066315_1066579_-	virulence protein PagD	NA	NA	NA	NA	NA
WP_000789472.1|1067383_1067941_+	virulence membrane protein PagC	NA	Q9LA63	Enterobacterial_phage	33.0	2.2e-15
WP_000977722.1|1069178_1069523_-	c-type lysozyme inhibitor	NA	NA	NA	NA	NA
WP_077905118.1|1070225_1070456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001218118.1|1070650_1071118_+	Hsp20 family protein	NA	NA	NA	NA	NA
WP_000780159.1|1071456_1072500_+	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_000929974.1|1072582_1073113_-	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	70.5	2.8e-36
WP_000182479.1|1073261_1073576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000946087.1|1074257_1075892_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001520270.1|1075891_1076866_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000966636.1|1076855_1077668_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000950206.1|1077661_1078459_+	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.2	4.7e-11
WP_000947455.1|1078452_1079043_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_000456065.1|1079124_1080258_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_001183697.1|1080451_1080778_+	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_001537483.1|1080974_1081622_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_000502119.1|1081810_1082269_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
>prophage 3
NZ_LN890524	Salmonella enterica subsp. enterica serovar Weltevreden strain 2511STDY5712385 chromosome 1	4966880	1837609	1859490	4966880	transposase,plate	Shigella_phage(33.33%)	16	NA	NA
WP_149800254.1|1837609_1838772_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.5	2.6e-50
WP_000739390.1|1838965_1839931_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_000449478.1|1839998_1840295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086011251.1|1840430_1841592_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.9	6.2e-52
WP_000081842.1|1841707_1842910_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	71.5	4.4e-77
WP_165899064.1|1842989_1843574_-	RHS domain-containing protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	45.0	4.4e-22
WP_130559205.1|1843618_1844080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000335208.1|1844105_1845902_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	43.3	1.8e-21
WP_001534622.1|1845906_1846119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000103450.1|1850390_1852532_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.2	2.6e-24
WP_001142967.1|1852754_1853273_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000031252.1|1853900_1854404_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000058003.1|1854694_1856167_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000611700.1|1856163_1856580_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393864.1|1856584_1858438_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000509050.1|1858401_1859490_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 4
NZ_LN890524	Salmonella enterica subsp. enterica serovar Weltevreden strain 2511STDY5712385 chromosome 1	4966880	1924743	2010794	4966880	lysis,tRNA,tail,terminase,portal,transposase,protease	Salmonella_phage(32.14%)	89	NA	NA
WP_086011251.1|1924743_1925906_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.9	6.2e-52
WP_000374046.1|1927002_1927662_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_000904446.1|1927748_1928078_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|1928074_1928356_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548082.1|1928404_1929184_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000859417.1|1929209_1929758_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140480.1|1929972_1931184_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|1931241_1931559_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_001537782.1|1931603_1932017_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847719.1|1932190_1932853_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|1932947_1933406_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420523.1|1933441_1935496_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
WP_001261222.1|1935619_1936066_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950876.1|1936084_1938238_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|1938224_1938830_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288732.1|1939046_1939556_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001670727.1|1939912_1940965_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|1941036_1941489_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156452.1|1941674_1943435_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|1943503_1944022_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|1944121_1944289_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759137.1|1944544_1945108_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433416.1|1945104_1946745_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333145.1|1946749_1948003_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|1948017_1949925_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_001086485.1|1949937_1952046_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224074.1|1952144_1953254_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001220671.1|1953250_1953793_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|1953958_1954969_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193770.1|1955176_1957789_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	4.8e-20
WP_000497441.1|1958215_1958407_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_057516635.1|1958677_1959364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057516634.1|1959723_1960350_+	SOS response-associated peptidase family protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001674638.1|1960821_1961790_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.4	3.0e-193
WP_023204074.1|1961935_1962268_+|tail	tail fiber assembly protein	tail	A0A1B0VCD0	Salmonella_phage	63.4	4.4e-19
WP_000421115.1|1962911_1963430_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	51.4	2.5e-45
WP_023233090.1|1963444_1966123_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A1B0VFW4	Salmonella_phage	62.8	1.0e-145
WP_000178853.1|1966176_1966419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077905120.1|1966457_1967333_-	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	79.7	1.5e-50
WP_045716920.1|1969879_1970584_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	63.1	2.4e-67
WP_000606351.1|1970481_1971219_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_001152415.1|1971228_1971924_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000877926.1|1972013_1972547_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_000410972.1|1972636_1973161_-	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	35.3	1.8e-19
WP_000978295.1|1973259_1973592_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	2.6e-35
WP_077945271.1|1973588_1976576_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	61.9	3.6e-261
WP_071846999.1|1976655_1976985_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	3.8e-23
WP_045716924.1|1976981_1977380_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.5	1.5e-29
WP_045716925.1|1977425_1978175_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000196703.1|1978186_1978588_-|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	2.0e-42
WP_045716927.1|1978584_1979151_-|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	95.7	2.1e-13
WP_000774239.1|1979131_1979431_-	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_023209454.1|1979423_1979747_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_077910846.1|1979837_1981919_-|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.5	6.3e-265
WP_057516619.1|1981842_1983390_-|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	64.3	3.7e-177
WP_000196190.1|1983386_1983593_-	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_057516620.1|1983589_1985698_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	70.3	2.0e-290
WP_045717924.1|1985687_1986179_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	58.4	2.2e-43
WP_149795776.1|1986396_1986870_-|lysis	lysis protein	lysis	Q8HA85	Salmonella_phage	81.2	1.1e-58
WP_057516622.1|1986890_1987379_-	lysozyme	NA	M9P0E5	Enterobacteria_phage	68.1	1.3e-56
WP_001526513.1|1987356_1987659_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000658038.1|1987861_1988050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057516623.1|1988359_1989040_-	antiterminator	NA	I6PDF8	Cronobacter_phage	53.6	4.7e-60
WP_000801757.1|1989036_1989177_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_057516624.1|1989173_1989785_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	98.0	1.2e-91
WP_057516625.1|1989993_1990596_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
WP_014343878.1|1990630_1990879_-	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_001217669.1|1990995_1991229_-	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_057516626.1|1991749_1992547_-	hypothetical protein	NA	A0A1R3Y5Q8	Salmonella_virus	81.9	1.7e-32
WP_000801767.1|1992560_1993256_-	hypothetical protein	NA	G8C7U6	Escherichia_phage	45.9	1.5e-56
WP_023185158.1|1993252_1994089_-	replication protein	NA	K7PGT1	Enterobacteria_phage	48.5	2.7e-49
WP_015702794.1|1994180_1994555_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	98.4	3.3e-63
WP_000145711.1|1994520_1994748_-	helix-turn-helix domain-containing protein	NA	K7PKS2	Enterobacteria_phage	95.9	1.5e-34
WP_001539622.1|1994761_1995229_+	helix-turn-helix domain-containing protein	NA	K7PHG0	Enterobacteria_phage	84.5	7.9e-67
WP_001170496.1|1995379_1995853_+	hypothetical protein	NA	K7PLT9	Enterobacteria_phage	59.1	2.3e-53
WP_023185157.1|1995849_1996782_+	hypothetical protein	NA	K7PGT0	Enterobacteria_phage	53.2	9.6e-88
WP_000373338.1|1996814_1997021_-	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	67.6	1.6e-16
WP_000551854.1|1997418_1997589_+	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	51.0	3.3e-07
WP_077945180.1|1997610_1997961_+	DNA breaking-rejoining protein	NA	S4TSN6	Salmonella_phage	99.1	2.2e-61
WP_057516627.1|1998087_2001015_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	S4TNL0	Salmonella_phage	98.7	0.0e+00
WP_001539618.1|2000977_2002135_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_001237031.1|2002177_2002417_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_057516628.1|2002457_2002706_+	excisionase family protein	NA	S4TND0	Salmonella_phage	98.8	1.0e-41
WP_001262307.1|2002750_2004043_+	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	100.0	3.4e-253
WP_000191409.1|2004237_2005440_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000893191.1|2005520_2006954_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000544858.1|2007199_2008414_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000762342.1|2008731_2009193_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000117867.1|2009393_2010794_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	35.8	4.5e-81
>prophage 5
NZ_LN890524	Salmonella enterica subsp. enterica serovar Weltevreden strain 2511STDY5712385 chromosome 1	4966880	2058516	2111509	4966880	protease,tRNA,tail	Enterobacteria_phage(20.83%)	44	NA	NA
WP_000886697.1|2058516_2059809_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.5	8.6e-95
WP_000067785.1|2060067_2061411_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.9	1.6e-80
WP_001519746.1|2061420_2062032_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_001535019.1|2062174_2066314_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.5	2.9e-88
WP_000228469.1|2066448_2066943_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537406.1|2067489_2068458_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	45.5	6.5e-63
WP_001044534.1|2068571_2070338_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.6	9.2e-23
WP_001202257.1|2070338_2072060_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	23.5	6.4e-13
WP_001241650.1|2072104_2072809_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001539595.1|2072809_2073193_+	membrane protein	NA	NA	NA	NA	NA
WP_001040187.1|2073120_2073339_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000597932.1|2073429_2074341_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000809969.1|2074449_2075310_+	pirin family protein	NA	NA	NA	NA	NA
WP_000097893.1|2075329_2076007_+	hydrolase	NA	NA	NA	NA	NA
WP_001117984.1|2077710_2077908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000934064.1|2078118_2080395_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|2080425_2080746_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|2081069_2081291_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125895.1|2081420_2083367_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
WP_001201754.1|2083363_2084482_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_001519667.1|2084627_2085578_+	VirK/YbjX family protein	NA	NA	NA	NA	NA
WP_000599770.1|2085574_2087233_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_000491118.1|2087435_2088335_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_000458776.1|2088478_2090131_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000178698.1|2090142_2091111_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000815313.1|2091268_2092987_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.4	1.7e-29
WP_000566346.1|2093025_2094027_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_000079019.1|2094037_2095471_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000866904.1|2095566_2096580_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001202294.1|2096576_2097407_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.7	2.3e-08
WP_001160725.1|2097403_2097727_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_057515227.1|2098056_2098296_+	DinI family protein	NA	K7PKR6	Enterobacteria_phage	87.3	5.5e-32
WP_057515228.1|2098507_2098672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057515232.1|2099169_2099988_+	cytolethal distending toxin subunit B family protein	NA	A5LH53	Enterobacteria_phage	50.4	1.9e-63
WP_001277616.1|2100060_2100438_+	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
WP_057515229.1|2100586_2101129_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	66.5	2.3e-70
WP_057515230.1|2101320_2102049_-	pertussis-like toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	52.0	1.0e-60
WP_057515231.1|2102065_2102479_-	subtilase cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	38.6	3.2e-19
WP_057517999.1|2103252_2103774_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	51.4	2.5e-45
WP_060527600.1|2103788_2106467_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A1B0VFW4	Salmonella_phage	64.6	4.6e-151
WP_000178849.1|2106520_2106763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057516412.1|2106801_2110164_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.9	0.0e+00
WP_057524907.1|2110226_2110874_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	78.1	1.0e-88
WP_057515768.1|2110771_2111509_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	84.6	5.7e-128
>prophage 6
NZ_LN890524	Salmonella enterica subsp. enterica serovar Weltevreden strain 2511STDY5712385 chromosome 1	4966880	2115571	2148910	4966880	tRNA,tail,holin,integrase,terminase,capsid,transposase,portal,head	Salmonella_phage(40.0%)	46	2137579:2137594	2145875:2145890
WP_077905125.1|2115571_2115910_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	63.6	3.5e-32
WP_000479607.1|2115906_2116302_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_000971954.1|2116352_2117099_-	Ig-like domain-containing protein	NA	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_057516608.1|2117106_2117508_-|tail	phage tail protein	tail	Q9G0F3	Phage_Gifsy-1	99.0	4.0e-51
WP_043991247.1|2117616_2118747_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	99.7	4.5e-217
WP_000677089.1|2118795_2119374_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000083295.1|2119360_2119738_-|tail	tail attachment protein	tail	K7PHD8	Enterobacteria_phage	54.7	3.4e-28
WP_000235459.1|2119748_2120108_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_057515266.1|2120165_2121194_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	60.8	5.0e-114
WP_000011258.1|2121248_2121596_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	53.8	4.1e-20
WP_001189503.1|2121608_2123105_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
WP_000831821.1|2123094_2124675_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_000201415.1|2124671_2124875_-	gpW family protein	NA	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_001534812.1|2124858_2126790_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	2.8e-259
WP_001102153.1|2126761_2127307_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_001252725.1|2127565_2128069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000636436.1|2128171_2128714_-	DUF2514 family protein	NA	NA	NA	NA	NA
WP_001075992.1|2128710_2129325_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	92.2	6.7e-106
WP_000226307.1|2129324_2129606_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
WP_001294875.1|2129592_2129982_-|holin	phage holin family protein	holin	K7PHB9	Enterobacterial_phage	71.8	8.1e-41
WP_000658036.1|2130071_2130260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000057291.1|2130563_2131259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001534776.1|2131561_2132398_-	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	77.4	3.5e-121
WP_000595052.1|2132394_2132667_-	hypothetical protein	NA	A0A1B5FPA6	Escherichia_phage	77.6	9.4e-28
WP_024134153.1|2132681_2133671_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	7.1e-190
WP_001061461.1|2133678_2134539_-	KilA-N domain-containing protein	NA	A0A192Y6F8	Salmonella_phage	98.3	2.3e-160
WP_000767086.1|2134555_2134945_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A192Y8N5	Salmonella_phage	97.7	1.6e-68
WP_000066940.1|2134941_2135835_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	93.9	7.3e-162
WP_001669427.1|2135834_2136317_-	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	98.1	6.0e-86
WP_000104923.1|2136318_2137278_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	83.4	3.2e-123
WP_000620702.1|2137274_2137499_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_001087399.1|2137495_2138638_-	Rha family phage regulatory protein	NA	A0A1C9IHV9	Salmonella_phage	93.4	2.5e-194
2137579:2137594	attL	ACAGGTTTACGGCCAG	NA	NA	NA	NA
WP_000509731.1|2138634_2139189_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
WP_001191666.1|2139217_2139442_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_001020636.1|2139539_2140235_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	100.0	3.2e-128
WP_000883481.1|2140569_2140767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000997190.1|2141305_2141677_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
WP_000080410.1|2141734_2142562_+	DUF2303 family protein	NA	Q8HAA2	Salmonella_phage	98.9	1.1e-151
WP_000008350.1|2142698_2143238_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	98.9	6.5e-97
WP_000089142.1|2143381_2143618_+	excisionase	NA	NA	NA	NA	NA
WP_000741325.1|2143607_2144750_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21929	Phage_21	80.3	8.2e-174
WP_000444507.1|2144863_2146114_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	1.1e-19
2145875:2145890	attR	CTGGCCGTAAACCTGT	NA	NA	NA	NA
WP_001249415.1|2146285_2146951_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000825956.1|2146947_2147277_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_000476064.1|2147288_2147750_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000004540.1|2147803_2148910_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 7
NZ_LN890524	Salmonella enterica subsp. enterica serovar Weltevreden strain 2511STDY5712385 chromosome 1	4966880	2338778	2345075	4966880		Enterobacteria_phage(50.0%)	6	NA	NA
WP_001100807.1|2338778_2339309_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.1	3.7e-52
WP_000857532.1|2339313_2340192_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	1.7e-107
WP_001023657.1|2340239_2341139_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	7.9e-31
WP_000697846.1|2341138_2342224_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_000981469.1|2342600_2343494_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001111837.1|2343671_2345075_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	3.1e-21
>prophage 8
NZ_LN890524	Salmonella enterica subsp. enterica serovar Weltevreden strain 2511STDY5712385 chromosome 1	4966880	2418387	2427558	4966880	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195334.1|2418387_2420421_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703137.1|2420661_2421120_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_001265351.1|2421291_2421822_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950422.1|2421878_2422346_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	89.7	1.1e-73
WP_000598637.1|2422392_2423112_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272850.1|2423108_2424794_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_001240418.1|2425016_2425748_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|2425807_2425915_+	protein YohO	NA	NA	NA	NA	NA
WP_000824854.1|2425895_2426627_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569166.1|2426610_2427558_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 9
NZ_LN890524	Salmonella enterica subsp. enterica serovar Weltevreden strain 2511STDY5712385 chromosome 1	4966880	2897981	2997078	4966880	lysis,tRNA,tail,holin,integrase,plate,terminase,capsid,portal,transposase,head	Salmonella_phage(50.0%)	91	2899179:2899195	2952967:2952983
WP_000083345.1|2897981_2898719_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219174.1|2898849_2900184_+	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
2899179:2899195	attL	TACCGGCGGCGTGGCCT	NA	NA	NA	NA
WP_001535061.1|2900201_2901101_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000188415.1|2901203_2901791_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627811.1|2901852_2902236_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000179978.1|2902554_2903244_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000997368.1|2903359_2904397_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098732.1|2904600_2905020_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	40.6	1.2e-16
WP_000183637.1|2905092_2905773_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082657.1|2905826_2908487_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949287.1|2908601_2909957_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001264475.1|2910001_2910325_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000807803.1|2910321_2911623_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.1	4.5e-43
WP_000985658.1|2911726_2912182_-	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	49.3	8.6e-34
WP_001235092.1|2918329_2920903_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.5	2.6e-127
WP_000992643.1|2921032_2921764_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079130.1|2921760_2922741_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197660.1|2922872_2923610_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178449.1|2923881_2924220_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_010989056.1|2924323_2924371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200078.1|2924470_2925631_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000210993.1|2925591_2926500_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000225191.1|2926557_2927679_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168062.1|2927688_2928759_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_001212379.1|2929198_2929717_+	YfiR family protein	NA	NA	NA	NA	NA
WP_001030985.1|2929709_2930930_+	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
WP_000218686.1|2931182_2932232_-|integrase	site-specific integrase	integrase	A0A0M4S6G4	Salmonella_phage	99.7	3.3e-206
WP_000382813.1|2932253_2932817_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_000997320.1|2932816_2933659_-	phage repressor protein CI	NA	A0A0M4RE65	Salmonella_phage	70.8	3.9e-112
WP_001278194.1|2933772_2934144_+	hypothetical protein	NA	A0A0M4R4X7	Salmonella_phage	99.2	1.4e-61
WP_000459331.1|2934176_2934686_+	phage regulatory CII family protein	NA	A0A0M4QWN1	Salmonella_phage	100.0	3.3e-90
WP_000916539.1|2934693_2934894_+	DUF2724 domain-containing protein	NA	Q6K1F7	Salmonella_virus	98.5	2.1e-32
WP_000963464.1|2934857_2935196_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	92.9	6.8e-52
WP_001246237.1|2935263_2935491_+	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	100.0	6.8e-32
WP_000752600.1|2935490_2935712_+	TraR/DksA family transcriptional regulator	NA	A0A218M4I6	Erwinia_phage	100.0	3.8e-35
WP_031624535.1|2935827_2936421_+	3'-5' exonuclease	NA	A0A218M4G8	Erwinia_phage	99.0	6.0e-112
WP_000058625.1|2936417_2936699_+	DUF5405 family protein	NA	A0A218M4I8	Erwinia_phage	98.9	6.1e-46
WP_000556267.1|2936691_2938920_+	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	96.9	0.0e+00
WP_000232650.1|2939037_2939220_+	hypothetical protein	NA	A0A0M5M1G5	Salmonella_phage	100.0	4.1e-27
WP_001222153.1|2939223_2939457_+	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	100.0	2.1e-36
WP_000517959.1|2940464_2941511_-|portal	phage portal protein	portal	A0A0M4S6E8	Salmonella_phage	100.0	4.0e-191
WP_000156055.1|2941510_2943280_-|terminase	terminase ATPase subunit family protein	terminase	A0A0M4RE51	Salmonella_phage	100.0	0.0e+00
WP_060527609.1|2943445_2944300_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0M3UL81	Salmonella_phage	99.6	2.2e-147
WP_001247246.1|2944376_2945360_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M4R4W2	Salmonella_phage	98.2	1.4e-177
WP_086011248.1|2945340_2946596_-|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	34.5	9.8e-19
WP_000203475.1|2946762_2947512_+|terminase	terminase endonuclease subunit	terminase	Q6K1I5	Salmonella_virus	96.8	6.4e-127
WP_000214255.1|2947605_2948112_+|head	head completion/stabilization protein	head	S4TNY1	Salmonella_phage	100.0	1.3e-91
WP_000870102.1|2948111_2948315_+|tail	tail protein X	tail	S4TTA0	Salmonella_phage	97.0	8.8e-31
WP_000134659.1|2948318_2948615_+|holin	holin	holin	S4TP56	Salmonella_phage	100.0	4.4e-47
WP_001144116.1|2948601_2949099_+	glycoside hydrolase family 104 protein	NA	S4TUB1	Salmonella_phage	99.4	1.2e-92
WP_000866103.1|2949095_2949509_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A0M4R2N5	Salmonella_phage	94.2	8.4e-44
WP_015633067.1|2949480_2949654_+	hypothetical protein	NA	S4TNY4	Salmonella_phage	96.5	1.1e-24
WP_001169074.1|2949616_2950084_+|tail	phage tail protein	tail	S4TTA5	Salmonella_phage	100.0	1.1e-84
WP_001293096.1|2950076_2950526_+	phage virion morphogenesis protein	NA	S4TP59	Salmonella_phage	99.3	4.2e-73
WP_001094748.1|2950594_2951236_+|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	96.7	3.2e-111
WP_000127177.1|2951232_2951580_+	GPW/gp25 family protein	NA	A0A0M4RE59	Salmonella_phage	98.3	7.2e-57
WP_000246671.1|2951586_2952495_+|plate	baseplate assembly protein	plate	A0A1J0I2M3	Salmonella_phage	99.3	5.4e-160
WP_001000069.1|2952487_2953018_+|tail	phage tail protein I	tail	A0A0M4R4W9	Salmonella_phage	99.4	5.4e-104
2952967:2952983	attR	TACCGGCGGCGTGGCCT	NA	NA	NA	NA
WP_000104700.1|2953028_2955005_+|tail	tail fiber protein	tail	S4TP62	Salmonella_phage	97.4	0.0e+00
WP_000122993.1|2955017_2955566_+|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	98.9	3.8e-100
WP_001279033.1|2955700_2956888_+|tail	phage tail sheath protein	tail	Q6K1H0	Salmonella_virus	99.5	9.9e-223
WP_001207675.1|2956903_2957422_+|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	100.0	6.5e-94
WP_001029727.1|2957484_2957820_+|tail	phage tail assembly protein	tail	A0A0M4S5P8	Salmonella_phage	100.0	1.8e-52
WP_085984508.1|2957816_2957972_+|tail	GpE family phage tail protein	tail	Q6K1G8	Salmonella_virus	98.0	8.8e-23
WP_057515790.1|2957964_2960409_+|tail	phage tail tape measure protein	tail	S4TP64	Salmonella_phage	94.1	0.0e+00
WP_000978862.1|2960423_2960909_+|tail	phage tail protein	tail	Q6K1G5	Salmonella_virus	100.0	3.6e-86
WP_000627819.1|2960905_2962075_+	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	99.0	4.1e-213
WP_000972010.1|2962150_2962369_+	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	100.0	1.2e-38
WP_000065257.1|2962513_2962861_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000469813.1|2962901_2963669_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043266.1|2963713_2964262_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256453.1|2964280_2964529_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460052.1|2964842_2966204_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001537507.1|2966369_2967161_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_130559217.1|2967180_2968467_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001287924.1|2968587_2969193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001518875.1|2969227_2969818_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059155.1|2969941_2970820_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880965.1|2970905_2972567_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203445.1|2972715_2973054_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001112990.1|2973219_2973510_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000242603.1|2973499_2973976_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001518569.1|2974125_2974608_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_001535045.1|2975227_2986702_+	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_000533868.1|2986766_2988176_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_000196141.1|2988172_2990353_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_000342601.1|2990360_2991524_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000388873.1|2992481_2993021_-	phase 1 flagellin gene repressor FljA	NA	NA	NA	NA	NA
WP_000079789.1|2993088_2994591_-	flagellin FliC	NA	NA	NA	NA	NA
WP_000190912.1|2994682_2995255_+	flagellar phase variation DNA invertase Hin	NA	A0A0A7NPV4	Enterobacteria_phage	72.6	8.8e-68
WP_000081842.1|2995875_2997078_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	71.5	4.4e-77
>prophage 10
NZ_LN890524	Salmonella enterica subsp. enterica serovar Weltevreden strain 2511STDY5712385 chromosome 1	4966880	3455773	3528231	4966880	tRNA,tail,holin,integrase,plate,terminase,capsid,transposase,portal,head	Cronobacter_phage(57.78%)	76	3478339:3478356	3509652:3509669
WP_086011248.1|3455773_3457028_+|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	34.5	9.8e-19
WP_001076978.1|3457045_3457699_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.8	1.6e-44
WP_000566824.1|3458135_3458432_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_000928927.1|3458505_3458715_-	cell surface composition regulator GlgS	NA	NA	NA	NA	NA
WP_000171739.1|3458972_3459593_+	DUF1449 family protein	NA	NA	NA	NA	NA
WP_000342878.1|3459611_3461291_+	flotillin family protein	NA	NA	NA	NA	NA
WP_000502755.1|3461392_3461590_+	type I toxin-antitoxin system Ibs family toxin	NA	NA	NA	NA	NA
WP_000867682.1|3461749_3463183_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.0	8.8e-40
WP_000188304.1|3463230_3466074_-	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_000046220.1|3466191_3467493_-	inorganic triphosphatase	NA	NA	NA	NA	NA
WP_001125344.1|3467734_3468349_+	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_000708449.1|3468411_3469653_+	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	47.9	6.5e-92
WP_001281933.1|3469757_3470579_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_000355776.1|3470676_3471036_-	bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase	NA	NA	NA	NA	NA
WP_001272784.1|3471142_3471754_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_001264389.1|3472003_3473017_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	2.2e-109
WP_001144069.1|3473244_3473460_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918869.1|3473695_3475441_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.2	6.2e-72
WP_001519776.1|3475590_3477438_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_000237776.1|3477561_3478068_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
3478339:3478356	attL	TGTCGCAAAAGTGTCGCA	NA	NA	NA	NA
WP_001215694.1|3478380_3479004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000977538.1|3479654_3481358_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.3	9.9e-224
WP_000200790.1|3481357_3481903_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	73.1	1.5e-64
WP_000267951.1|3481874_3482600_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.4	6.6e-68
WP_000421116.1|3482589_3483117_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	53.1	1.1e-51
WP_000084305.1|3483134_3485162_-|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	47.7	3.1e-155
WP_001534884.1|3485171_3485759_-	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.6	2.2e-90
WP_000136925.1|3485751_3486936_-|plate	baseplate J/gp47 family protein	plate	F1BUK6	Cronobacter_phage	78.4	1.8e-179
WP_001002797.1|3486932_3487262_-	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_000811092.1|3487258_3489229_-|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	71.1	6.4e-275
WP_000411337.1|3489416_3489674_-	hypothetical protein	NA	A5X9I7	Aeromonas_virus	63.4	3.6e-21
WP_057516593.1|3489820_3490153_-	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.0	2.0e-35
WP_000175560.1|3490152_3490494_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_001154425.1|3490490_3490784_-|holin	holin	holin	C7BGD7	Burkholderia_phage	46.2	1.3e-14
WP_000166743.1|3490793_3491249_-	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	1.5e-57
WP_000220203.1|3491245_3492373_-	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	83.7	1.9e-175
WP_000560078.1|3492369_3493077_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	77.4	1.0e-102
WP_000084222.1|3493073_3493580_-|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.1	3.4e-63
WP_024135609.1|3493576_3494029_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	81.3	8.0e-64
WP_000398492.1|3494125_3494320_-	hypothetical protein	NA	Q8W634	Enterobacteria_phage	58.6	3.3e-11
WP_001218538.1|3494323_3495028_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	67.4	4.7e-87
WP_000550496.1|3495031_3496054_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.2	1.1e-158
WP_000018796.1|3496115_3496919_-|capsid	GPO family capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	56.0	1.6e-78
WP_001151942.1|3497079_3498855_+	hypothetical protein	NA	F1BUM5	Cronobacter_phage	83.6	5.2e-292
WP_000038208.1|3498851_3499913_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	77.1	2.3e-162
WP_001552031.1|3499909_3500233_+	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	92.3	8.0e-50
WP_000353141.1|3500206_3500413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000170875.1|3500532_3502554_-	replication endonuclease	NA	F1BUM9	Cronobacter_phage	75.1	1.7e-299
WP_000279408.1|3502550_3503411_-	DNA adenine methylase	NA	F1BUN1	Cronobacter_phage	82.7	2.2e-131
WP_000551169.1|3503401_3503635_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_000022786.1|3503702_3504104_-	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.9	1.4e-48
WP_000996837.1|3504103_3504529_-	hypothetical protein	NA	F1BUN5	Cronobacter_phage	49.6	2.2e-23
WP_000643375.1|3504518_3504746_-	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_000460878.1|3504755_3505259_-	phage regulatory CII family protein	NA	F1BUN6	Cronobacter_phage	72.5	3.5e-60
WP_001247711.1|3505289_3505511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000514631.1|3505654_3506236_+	phage repressor protein	NA	A0A218M4J1	Erwinia_phage	37.2	1.2e-27
WP_000568372.1|3506252_3506819_+	PH domain-containing protein	NA	Q4ZA70	Staphylococcus_virus	32.8	1.3e-18
WP_001145220.1|3506822_3507860_+|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	63.9	1.5e-121
WP_000627044.1|3507849_3509631_+	ATP-binding protein	NA	X2KLG0	Campylobacter_phage	23.2	6.4e-08
WP_000213761.1|3509888_3510656_-	siderophore-interacting protein	NA	NA	NA	NA	NA
3509652:3509669	attR	TGTCGCAAAAGTGTCGCA	NA	NA	NA	NA
WP_000983434.1|3510887_3511535_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000478471.1|3511531_3513097_-	MCP four helix bundle domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.9	1.7e-12
WP_000094639.1|3513484_3515005_-	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	47.8	8.4e-33
WP_001520281.1|3515434_3516814_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	29.0	2.9e-32
WP_000121517.1|3516984_3519003_+	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_000019989.1|3519083_3520220_-	23S rRNA (guanine(1835)-N(2))-methyltransferase RlmG	NA	NA	NA	NA	NA
WP_000202966.1|3520305_3520803_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_000951045.1|3520953_3521646_+	vancomycin high temperature exclusion protein	NA	NA	NA	NA	NA
WP_000617678.1|3521734_3522733_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_001098833.1|3523003_3523972_+	TerC family protein	NA	I7HPH5	Enterobacteria_phage	34.9	5.0e-39
WP_000235363.1|3524226_3525471_+	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_000422141.1|3525920_3526583_+	DedA family protein	NA	NA	NA	NA	NA
WP_000917516.1|3526586_3526970_+	EnvZ/OmpR regulon moderator MzrA	NA	NA	NA	NA	NA
WP_000877297.1|3527114_3527483_+	DUF1090 domain-containing protein	NA	NA	NA	NA	NA
WP_000031219.1|3527524_3527830_+	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_000785626.1|3527832_3528231_+|holin	phage holin family protein	holin	NA	NA	NA	NA
>prophage 11
NZ_LN890524	Salmonella enterica subsp. enterica serovar Weltevreden strain 2511STDY5712385 chromosome 1	4966880	4805551	4864998	4966880	integrase,portal,transposase,tRNA	Enterobacteria_phage(18.18%)	51	4817067:4817083	4863034:4863050
WP_000251089.1|4805551_4805998_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000047544.1|4806072_4806459_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148570.1|4806535_4806997_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013055.1|4807009_4807945_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	39.2	6.5e-52
WP_000249504.1|4807980_4808082_-	pyr operon leader peptide	NA	NA	NA	NA	NA
WP_000666051.1|4808172_4808661_-	arginine repressor	NA	NA	NA	NA	NA
WP_000514433.1|4808847_4810251_-	YfcC family protein	NA	NA	NA	NA	NA
WP_000237035.1|4810306_4811311_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000428751.1|4811422_4812355_-	carbamate kinase	NA	NA	NA	NA	NA
WP_000410846.1|4812365_4813586_-	arginine deiminase	NA	NA	NA	NA	NA
WP_000583454.1|4814261_4814714_+	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_000103041.1|4814787_4815792_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000002940.1|4815957_4816374_+	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_000218452.1|4816385_4817198_+|tRNA	tRNA isopentenyl-2-thiomethyl-A-37 hydroxylase MiaE	tRNA	NA	NA	NA	NA
4817067:4817083	attL	GCGCTGGCGCAGCAGAT	NA	NA	NA	NA
WP_000826193.1|4817431_4817920_-	DUF3617 domain-containing protein	NA	NA	NA	NA	NA
WP_001519079.1|4818026_4818530_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000416350.1|4820054_4822910_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.4	1.2e-141
WP_001523689.1|4822909_4823353_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397158.1|4823489_4825001_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.7	8.3e-49
WP_000584132.1|4825395_4826496_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001182242.1|4826495_4827578_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_001244065.1|4827773_4828772_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_057516578.1|4828835_4830155_-	gnt-II system L-idonate transporter	NA	NA	NA	NA	NA
WP_000998692.1|4830216_4830981_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000453359.1|4831005_4832037_-	L-idonate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000896756.1|4832253_4832784_+	gluconokinase	NA	NA	NA	NA	NA
WP_000152563.1|4832811_4833831_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.1	1.3e-42
WP_043991162.1|4834302_4835565_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	35.6	3.7e-66
WP_001066526.1|4835595_4836234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534484.1|4836603_4836834_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000190569.1|4836930_4837116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001118612.1|4837306_4837483_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	55.6	4.2e-05
WP_001247001.1|4837475_4837829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001027156.1|4837860_4838145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001075575.1|4838141_4838525_+	DUF5375 family protein	NA	NA	NA	NA	NA
WP_000211880.1|4838521_4841194_+	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	34.4	2.1e-58
WP_000648110.1|4841254_4841473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001064139.1|4841593_4842355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015633239.1|4842354_4842627_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000368629.1|4842951_4844622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000369883.1|4844649_4845675_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	88.2	6.0e-168
WP_000254752.1|4847536_4847785_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_000016244.1|4847897_4848137_+	type II toxin-antitoxin system CcdA family antitoxin	NA	NA	NA	NA	NA
WP_001199743.1|4848139_4848448_+	CcdB family protein	NA	NA	NA	NA	NA
WP_001023050.1|4849604_4850624_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000213428.1|4851123_4857444_-	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	22.0	4.7e-45
WP_015632990.1|4857456_4860291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000081842.1|4860382_4861585_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	71.5	4.4e-77
WP_000422448.1|4862368_4862563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057516642.1|4862640_4863516_+	HNH endonuclease	NA	NA	NA	NA	NA
4863034:4863050	attR	GCGCTGGCGCAGCAGAT	NA	NA	NA	NA
WP_000081842.1|4863795_4864998_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	71.5	4.4e-77
>prophage 1
NZ_LN890525	Salmonella enterica subsp. enterica serovar Weltevreden strain 2511STDY5712385 plasmid 2, complete sequence	84987	0	13343	84987		uncultured_Caudovirales_phage(100.0%)	14	NA	NA
WP_063100280.1|64_235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000148286.1|265_517_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001161115.1|550_748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021513954.1|1096_1945_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000157095.1|2030_2366_-	molybdopterin-guanine dinucleotide biosynthesis protein MobC	NA	NA	NA	NA	NA
WP_001283947.1|2599_2932_+	IncI1-type relaxosome accessory protein NikA	NA	NA	NA	NA	NA
WP_052971501.1|2942_5642_+	IncI1-type relaxase NikB	NA	NA	NA	NA	NA
WP_072121498.1|5678_7970_-	conjugal transfer protein TrbC	NA	NA	NA	NA	NA
WP_000151579.1|7962_9033_-	IncI1-type conjugal transfer protein TrbB	NA	NA	NA	NA	NA
WP_001383960.1|9051_10260_-	IncI1-type conjugal transfer protein TrbA	NA	NA	NA	NA	NA
WP_060527633.1|10477_11464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023156060.1|12032_12185_+	Hok/Gef family protein	NA	NA	NA	NA	NA
WP_001291965.1|12256_12508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001054901.1|13166_13343_-	hypothetical protein	NA	A0A2H4J7S3	uncultured_Caudovirales_phage	48.2	9.7e-10
>prophage 2
NZ_LN890525	Salmonella enterica subsp. enterica serovar Weltevreden strain 2511STDY5712385 plasmid 2, complete sequence	84987	28545	32954	84987		Pseudomonas_phage(50.0%)	2	NA	NA
WP_060527647.1|28545_32313_-	DNA primase	NA	A0A1B0VML8	Pseudomonas_phage	29.4	2.0e-19
WP_000014584.1|32402_32954_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	33.9	1.5e-19
>prophage 3
NZ_LN890525	Salmonella enterica subsp. enterica serovar Weltevreden strain 2511STDY5712385 plasmid 2, complete sequence	84987	36068	40130	84987	integrase	Escherichia_phage(50.0%)	4	34616:34628	41355:41367
34616:34628	attL	TGAGGGTTTTCTG	NA	NA	NA	NA
WP_000977520.1|36068_36653_-	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	39.8	1.7e-10
WP_000976357.1|36712_37915_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_015058912.1|38000_38825_-	conjugal transfer protein TraE	NA	NA	NA	NA	NA
WP_001139955.1|38975_40130_-|integrase	integrase	integrase	B5WZU7	Pseudomonas_phage	43.0	1.0e-46
41355:41367	attR	TGAGGGTTTTCTG	NA	NA	NA	NA
>prophage 4
NZ_LN890525	Salmonella enterica subsp. enterica serovar Weltevreden strain 2511STDY5712385 plasmid 2, complete sequence	84987	43917	44478	84987		Ralstonia_phage(100.0%)	1	NA	NA
WP_000014005.1|43917_44478_-	lytic transglycosylase domain-containing protein	NA	A0A0A8J856	Ralstonia_phage	33.7	6.1e-05
>prophage 5
NZ_LN890525	Salmonella enterica subsp. enterica serovar Weltevreden strain 2511STDY5712385 plasmid 2, complete sequence	84987	56002	56266	84987		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001324596.1|56002_56266_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	54.0	6.1e-08
>prophage 6
NZ_LN890525	Salmonella enterica subsp. enterica serovar Weltevreden strain 2511STDY5712385 plasmid 2, complete sequence	84987	64997	73145	84987	integrase	Macacine_betaherpesvirus(16.67%)	11	59175:59188	68469:68482
59175:59188	attL	TGCAAATGAAAAAC	NA	NA	NA	NA
WP_001164198.1|64997_65777_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	95.6	4.0e-55
WP_001144036.1|65956_66601_+	ParA family protein	NA	NA	NA	NA	NA
WP_000030199.1|66687_66996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000688514.1|67409_68390_+	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	51.4	1.7e-79
WP_001278818.1|68382_68799_+	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
68469:68482	attR	TGCAAATGAAAAAC	NA	NA	NA	NA
WP_015058887.1|68800_70075_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	60.7	9.9e-144
WP_000109071.1|70074_70512_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	48.4	8.3e-26
WP_000618110.1|70508_70757_-	DinI-like family protein	NA	Q2A098	Sodalis_phage	48.0	1.9e-14
WP_077795348.1|71174_72077_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_015058890.1|72080_72386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021513974.1|72461_73145_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	3.0e-30
>prophage 7
NZ_LN890525	Salmonella enterica subsp. enterica serovar Weltevreden strain 2511STDY5712385 plasmid 2, complete sequence	84987	76903	82500	84987		Xanthomonas_phage(25.0%)	8	NA	NA
WP_001276114.1|76903_77431_+	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	74.4	9.3e-48
WP_000005985.1|77488_77722_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_060527653.1|77780_79739_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	28.9	3.6e-20
WP_000845897.1|79793_80228_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001276261.1|80224_80944_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_000978012.1|80940_81537_+	hypothetical protein	NA	A0A0N7KZV3	Escherichia_phage	61.9	3.1e-15
WP_071847006.1|81608_82079_+	DUF1472 domain-containing protein	NA	NA	NA	NA	NA
WP_000117622.1|81999_82500_+	antirestriction protein ArdA	NA	G9FHQ1	Rhodococcus_virus	27.3	4.2e-05
>prophage 1
NZ_LN890526	Salmonella enterica subsp. enterica serovar Weltevreden strain 2511STDY5712385 plasmid 3, complete sequence	47244	873	27328	47244	tail,protease,capsid,portal,plate,terminase	Vibrio_phage(63.64%)	30	NA	NA
WP_057516506.1|873_1497_+	ParB N-terminal domain-containing protein	NA	A0A067ZI74	Vibrio_phage	50.7	5.0e-32
WP_057516507.1|1496_2870_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_171823856.1|2880_3600_+	hypothetical protein	NA	A0A1W6JTE1	Pseudomonas_phage	37.1	3.9e-28
WP_020844528.1|4121_4712_+	ParB N-terminal domain-containing protein	NA	A0A067ZI74	Vibrio_phage	53.7	1.4e-36
WP_020844527.1|4711_5257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023220975.1|5262_7122_+|terminase	phage terminase large subunit family protein	terminase	A0A059WKL6	Vibrio_phage	63.5	1.1e-231
WP_021000635.1|7133_7373_+	hypothetical protein	NA	A0A067ZJ01	Vibrio_phage	54.8	6.8e-14
WP_020844525.1|7369_8932_+|portal	phage portal protein	portal	A0A067ZJA4	Vibrio_phage	64.5	3.2e-189
WP_057516508.1|8924_9989_+|protease	Clp protease ClpP	protease	A0A067ZG37	Vibrio_phage	51.4	2.0e-81
WP_057516509.1|9999_10386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057516510.1|10401_11445_+|capsid	major capsid protein	capsid	A0A059WRQ2	Vibrio_phage	45.5	1.7e-72
WP_057516511.1|11445_11901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021000629.1|11907_12252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021000628.1|12248_12734_+	hypothetical protein	NA	A0A067ZIL8	Vibrio_phage	36.0	8.4e-19
WP_001623389.1|12733_13033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057516512.1|13032_14502_+	hypothetical protein	NA	A0A059WKP9	Vibrio_phage	54.7	1.5e-148
WP_001623391.1|14514_15036_+|tail	phage major tail tube protein	tail	A0A067ZJA9	Vibrio_phage	53.2	1.2e-47
WP_001623392.1|15045_15327_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_057516514.1|15481_17938_+|tail	phage tail tape measure protein	tail	A0A097I4X9	Vibrio_phage	25.9	6.5e-43
WP_021000622.1|17930_18149_+|tail	tail protein X	tail	A0A067ZJB1	Vibrio_phage	41.5	1.0e-08
WP_001623396.1|18138_19140_+	phage late control D	NA	A0A067ZG47	Vibrio_phage	42.8	3.3e-70
WP_001623397.1|19140_19761_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	55.9	1.3e-32
WP_024145350.1|19757_20225_+|tail	phage tail protein	tail	A0A0C5AN08	Bacteriophage	34.6	1.7e-13
WP_057516515.1|20221_20545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021000618.1|20541_21666_+|plate	baseplate J/gp47 family protein	plate	A0A0C5AEG2	Bacteriophage	44.7	7.2e-90
WP_023220967.1|21658_22240_+|tail	phage tail protein I	tail	R4JET8	Burkholderia_phage	36.5	2.3e-23
WP_077945182.1|24415_25033_+|tail	tail fiber assembly protein	tail	A0A1B0VCD0	Salmonella_phage	88.2	1.2e-99
WP_057516516.1|25036_25570_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	89.3	5.1e-86
WP_065314816.1|25572_26658_-	hypothetical protein	NA	Q6K1H2	Salmonella_virus	73.5	2.2e-128
WP_057516631.1|26740_27328_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	77.3	2.6e-75
