The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LN890522	Salmonella enterica subsp. enterica serovar Weltevreden strain 2511STDY5712384 chromosome 1	4875411	610902	661509	4875411	portal,integrase,protease,lysis,head,transposase,tail,terminase,tRNA	Salmonella_phage(56.36%)	67	624153:624208	664321:664376
WP_000912376.1|610902_612288_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.5	1.1e-44
WP_000190281.1|613053_613266_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729165.1|613267_614134_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	36.5	4.2e-29
WP_000681032.1|614680_615238_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000619604.1|615312_615846_+	type 1 fimbrial protein subunit FimI	NA	NA	NA	NA	NA
WP_001519112.1|615889_616582_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_000754203.1|616612_619225_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_000708649.1|619239_620247_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_000603410.1|620256_620775_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000801273.1|620820_621453_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
WP_001258107.1|622056_622779_-	fimbria biosynthesis regulator FimY	NA	NA	NA	NA	NA
WP_000948629.1|623269_623866_-	fimbria biosynthesis transcriptional regulator FimW	NA	NA	NA	NA	NA
624153:624208	attL	CTTCTAAGCCGTGGGTCGCAGGTTCGAATCCTGCAGGGCGCGCCATTATATATCAA	NA	NA	NA	NA
WP_057515775.1|624212_625376_-|integrase	site-specific integrase	integrase	B9UDL9	Salmonella_phage	97.2	9.7e-223
WP_001281207.1|625605_625956_-	hypothetical protein	NA	I6R980	Salmonella_phage	99.1	5.4e-60
WP_000509169.1|626200_626467_-	hypothetical protein	NA	A0A1V0E5L9	Salmonella_phage	97.7	3.7e-45
WP_057515783.1|626543_626987_-	hypothetical protein	NA	Q8HAA7	Salmonella_phage	82.7	9.0e-44
WP_057515776.1|627022_627694_-	DUF550 domain-containing protein	NA	A0A220NQU1	Salmonella_phage	64.9	1.5e-90
WP_057515777.1|627690_628188_-	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	74.8	3.4e-76
WP_057515778.1|628192_628570_-	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	78.1	5.3e-45
WP_057515779.1|628580_628874_-	DUF2856 family protein	NA	I6R984	Salmonella_phage	95.9	2.3e-48
WP_057515780.1|628887_629436_-	3'-5' exoribonuclease	NA	C6ZR35	Salmonella_phage	96.2	2.8e-103
WP_057515781.1|629444_629951_-	single-stranded DNA-binding protein	NA	C6ZR36	Salmonella_phage	91.1	7.3e-82
WP_057515782.1|629951_630659_-	recombinase	NA	C6ZR37	Salmonella_phage	98.3	2.0e-122
WP_000361564.1|630852_630966_-	host cell division inhibitory peptide Kil	NA	C6ZR39	Salmonella_phage	100.0	7.8e-13
WP_071846982.1|630958_631099_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	82.6	1.0e-17
WP_001539177.1|631299_631500_-	hypothetical protein	NA	A0A2H4FQS9	Salmonella_phage	100.0	1.6e-32
WP_060545774.1|631568_632417_-	hypothetical protein	NA	A0A2H4FRY7	Salmonella_phage	78.4	6.7e-80
WP_057515736.1|632495_632798_-	hypothetical protein	NA	I6S5Z3	Salmonella_phage	96.0	7.0e-48
WP_023135942.1|633152_633815_-	LexA family transcriptional regulator	NA	A0A0M4QWY1	Salmonella_phage	100.0	1.7e-126
WP_000067726.1|633933_634149_+	helix-turn-helix transcriptional regulator	NA	A0A0M4RTV8	Salmonella_phage	100.0	4.1e-34
WP_001103492.1|634259_634541_+	hypothetical protein	NA	Q76H54	Enterobacteria_phage	100.0	4.3e-44
WP_057515737.1|634575_635220_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_057515738.1|635206_636049_+	replication protein	NA	K7PGT1	Enterobacteria_phage	94.2	8.5e-128
WP_077945146.1|636051_636897_+	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	72.8	8.1e-110
WP_057515740.1|636893_637199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086011248.1|637313_638568_+|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	34.5	9.8e-19
WP_057515741.1|638584_638857_+	hypothetical protein	NA	H6WZI5	Escherichia_phage	84.3	1.7e-37
WP_057515742.1|638859_639060_+	hypothetical protein	NA	A0A2H4FUS3	Salmonella_phage	86.4	4.2e-25
WP_057515743.1|639062_639485_+	hypothetical protein	NA	A0A2H4FNF5	Salmonella_phage	93.6	7.9e-74
WP_057515744.1|639481_640009_+	phage N-6-adenine-methyltransferase	NA	Q9MCP3	Enterobacteria_phage	95.4	3.7e-97
WP_071846983.1|640005_640179_+	protein ninD	NA	C6ZR56	Salmonella_phage	96.5	9.8e-31
WP_000113767.1|640145_640322_+	NinE family protein	NA	A0A220NRK6	Escherichia_phage	98.3	7.9e-28
WP_057515745.1|640324_640666_+	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	99.1	1.0e-63
WP_057515746.1|640658_640835_+	protein ninF	NA	A0A220NRM2	Escherichia_phage	96.6	9.7e-26
WP_057515747.1|640827_641064_+	hypothetical protein	NA	C6ZR59	Salmonella_phage	96.2	8.7e-38
WP_057515749.1|641502_641685_+	hypothetical protein	NA	C6ZR61	Salmonella_phage	90.0	1.0e-22
WP_000027545.1|641681_642170_+	DUF1133 family protein	NA	I6S672	Salmonella_phage	87.0	3.0e-77
WP_000286100.1|642661_642865_+	hypothetical protein	NA	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_057515763.1|642842_643340_+	lysozyme	NA	A0A192Y6U3	Salmonella_phage	98.2	7.1e-90
WP_057515764.1|643428_643866_+|lysis	lysis protein	lysis	K7P710	Enterobacteria_phage	95.9	3.2e-70
WP_057515750.1|644061_644559_+	KilA-N domain-containing protein	NA	A0A0P0ZBU2	Stx2-converting_phage	94.5	1.1e-90
WP_057515751.1|644555_644813_+	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	90.6	2.0e-35
WP_057515752.1|645047_645428_+	hypothetical protein	NA	Q716B1	Shigella_phage	98.4	4.2e-66
WP_057515753.1|645531_645774_+	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	98.8	3.7e-36
WP_057515754.1|645776_646217_+	hypothetical protein	NA	C7U0W1	Enterobacteria_phage	99.3	7.7e-80
WP_057515755.1|646213_647626_+|terminase	PBSX family phage terminase large subunit	terminase	Q716H3	Shigella_phage	99.8	1.5e-278
WP_057515756.1|647628_649755_+|portal	portal protein	portal	Q9AYZ9	Salmonella_phage	91.2	0.0e+00
WP_057515757.1|649768_650653_+	hypothetical protein	NA	Q716H1	Shigella_phage	71.6	2.8e-89
WP_057515758.1|650663_651941_+|head	head protein	head	Q9AYZ7	Salmonella_phage	94.5	1.2e-226
WP_001531190.1|651980_652166_+	hypothetical protein	NA	Q716G9	Shigella_phage	82.0	7.5e-21
WP_001531195.1|652140_652623_+	packaged DNA stabilization protein p27	NA	Q716G8	Shigella_phage	80.5	3.2e-71
WP_057515759.1|652631_654050_+	packaged DNA stabilization protein gp10	NA	A0A075B8I2	Enterobacteria_phage	93.9	3.3e-265
WP_057515760.1|654053_654755_+	hypothetical protein	NA	I1TEJ2	Salmonella_phage	99.1	6.1e-71
WP_015995284.1|654754_655210_+	DUF2824 family protein	NA	C6ZR15	Salmonella_phage	100.0	2.3e-87
WP_023206221.1|655212_655902_+	hypothetical protein	NA	B9UDK9	Salmonella_phage	99.6	2.3e-102
WP_162847479.1|655911_657267_+	phage DNA ejection protein	NA	C6ZR17	Salmonella_phage	97.6	4.1e-241
WP_072141682.1|659391_661509_+|tail	phage tail protein	tail	C6ZR19	Salmonella_phage	99.1	0.0e+00
664321:664376	attR	CTTCTAAGCCGTGGGTCGCAGGTTCGAATCCTGCAGGGCGCGCCATTATATATCAA	NA	NA	NA	NA
>prophage 2
NZ_LN890522	Salmonella enterica subsp. enterica serovar Weltevreden strain 2511STDY5712384 chromosome 1	4875411	1030186	1039640	4875411	protease,transposase	Dickeya_phage(16.67%)	7	NA	NA
WP_001201754.1|1030186_1031305_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_000125895.1|1031301_1033248_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
WP_000447499.1|1033377_1033599_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|1033922_1034243_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934064.1|1034273_1036550_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_001117984.1|1036760_1036958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086011253.1|1038384_1039640_-|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	34.5	2.2e-18
>prophage 3
NZ_LN890522	Salmonella enterica subsp. enterica serovar Weltevreden strain 2511STDY5712384 chromosome 1	4875411	1080407	1193744	4875411	portal,protease,lysis,transposase,tail,terminase,holin,tRNA	Salmonella_phage(37.29%)	109	NA	NA
WP_086011248.1|1080407_1081662_+|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	34.5	9.8e-19
WP_000705789.1|1081839_1084104_+	ComEC family protein	NA	Q332C0	Clostridium_botulinum_C_phage	22.5	8.8e-10
WP_000551246.1|1084140_1085889_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.5	3.2e-60
WP_000561681.1|1085885_1086863_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_000056917.1|1086906_1088139_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000350061.1|1088190_1088373_+	protein YcaR	NA	NA	NA	NA	NA
WP_000011576.1|1088369_1089116_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000436894.1|1089326_1090220_+	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_000899551.1|1090199_1090976_-	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_001154025.1|1091111_1091915_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288828.1|1091907_1093230_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_000060025.1|1093210_1093915_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_000572742.1|1093914_1098381_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_000925895.1|1098725_1100573_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000357052.1|1100832_1101381_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_001109478.1|1101408_1102056_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000462653.1|1102117_1103308_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_000977709.1|1103492_1104584_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	1.7e-99
WP_000117867.1|1105189_1106590_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	35.8	4.5e-81
WP_000762342.1|1106790_1107252_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000544858.1|1107569_1108784_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000893191.1|1109029_1110463_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000191409.1|1110543_1111746_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001262307.1|1111940_1113233_-	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	100.0	3.4e-253
WP_000065276.1|1113277_1113526_-	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001237031.1|1113566_1113806_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_077905121.1|1113848_1115006_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.7	1.0e-216
WP_001534728.1|1114968_1117896_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	S4TNL0	Salmonella_phage	94.1	0.0e+00
WP_000551856.1|1118036_1118207_-	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	51.0	8.8e-08
WP_010989055.1|1118199_1118460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001038966.1|1118509_1118920_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_000370145.1|1119039_1119279_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
WP_001574095.1|1119244_1119619_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000062941.1|1119703_1120687_+	replication protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_000800010.1|1120689_1121439_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000113629.1|1121449_1121797_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
WP_000065108.1|1121793_1122105_+	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
WP_014343823.1|1122182_1122473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217665.1|1122764_1122998_+	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
WP_000807548.1|1123109_1123331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000929805.1|1123413_1124016_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	8.3e-109
WP_001096550.1|1124224_1124836_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	1.2e-91
WP_001617856.1|1124832_1124979_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001047632.1|1124968_1125766_+	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	8.9e-151
WP_010989004.1|1125832_1126150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|1126323_1126449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798705.1|1126584_1127034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000081842.1|1127595_1128798_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	71.5	4.4e-77
WP_001574216.1|1129659_1129989_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000984585.1|1129972_1130425_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.0	1.4e-79
WP_001534723.1|1130442_1130922_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.7	5.0e-56
WP_000371784.1|1131129_1131663_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_000989241.1|1131619_1133758_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
WP_000196190.1|1133754_1133961_+	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_001009206.1|1133957_1135505_+|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	64.3	2.8e-177
WP_077945123.1|1135428_1137510_+|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.2	3.5e-263
WP_001107907.1|1137600_1137924_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	1.3e-28
WP_000774239.1|1137916_1138216_+	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_000453192.1|1138196_1138763_+|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	95.7	2.1e-13
WP_000196703.1|1138759_1139161_+|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	2.0e-42
WP_000132756.1|1139172_1139922_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000478859.1|1139967_1140366_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_010989009.1|1140362_1140692_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_010989010.1|1140771_1143759_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	8.2e-266
WP_000978295.1|1143755_1144088_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	2.6e-35
WP_000725267.1|1144186_1144684_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000877926.1|1144800_1145334_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001152416.1|1145423_1146119_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.0e-89
WP_000606354.1|1146128_1146866_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	75.6	6.1e-114
WP_001576012.1|1146763_1147468_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	63.1	2.4e-67
WP_077905120.1|1150014_1150890_+	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	79.7	1.5e-50
WP_000178826.1|1150928_1151171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534724.1|1151224_1153903_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A1B0VFW4	Salmonella_phage	64.4	3.0e-150
WP_000421115.1|1153917_1154436_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	51.4	2.5e-45
WP_001534738.1|1155547_1156516_+	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.1	1.1e-192
WP_000334547.1|1157163_1157790_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_031603423.1|1157858_1158158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086011251.1|1158439_1159601_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.9	6.2e-52
WP_000497441.1|1160081_1160273_-	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_000193770.1|1160699_1163312_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	4.8e-20
WP_000291723.1|1163519_1164530_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001220671.1|1164695_1165238_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224074.1|1165234_1166344_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001086485.1|1166442_1168551_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000053044.1|1168563_1170471_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_000333145.1|1170485_1171739_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000433416.1|1171743_1173384_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000759137.1|1173380_1173944_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001537784.1|1174199_1174367_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|1174466_1174985_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000156452.1|1175053_1176814_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877172.1|1176999_1177452_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_001670727.1|1177523_1178576_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288732.1|1178932_1179442_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001202375.1|1179658_1180264_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000950876.1|1180250_1182404_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261222.1|1182422_1182869_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420523.1|1182992_1185047_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
WP_000424187.1|1185082_1185541_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847719.1|1185635_1186298_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_001537782.1|1186471_1186885_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|1186929_1187247_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000140480.1|1187304_1188516_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000859417.1|1188730_1189279_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000548082.1|1189304_1190084_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000072884.1|1190132_1190414_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904446.1|1190410_1190740_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000374046.1|1190826_1191486_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_086011251.1|1192582_1193744_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.9	6.2e-52
>prophage 4
NZ_LN890522	Salmonella enterica subsp. enterica serovar Weltevreden strain 2511STDY5712384 chromosome 1	4875411	1255823	1278058	4875411	transposase,plate	uncultured_Caudovirales_phage(40.0%)	16	NA	NA
WP_000246455.1|1255823_1257155_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_124084121.1|1257157_1257661_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000796941.1|1257687_1258974_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000509050.1|1258998_1260087_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393864.1|1260050_1261904_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000611700.1|1261908_1262325_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000058003.1|1262321_1263794_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000031252.1|1264084_1264588_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142967.1|1265215_1265734_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000103450.1|1265956_1268098_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.2	2.6e-24
WP_001534622.1|1272369_1272582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000335208.1|1272586_1274383_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	43.3	1.8e-21
WP_130559205.1|1274408_1274870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165899064.1|1274914_1275499_+	RHS domain-containing protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	45.0	4.4e-22
WP_060545779.1|1275578_1276781_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	71.5	4.4e-77
WP_086011251.1|1276895_1278058_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.9	6.2e-52
>prophage 5
NZ_LN890522	Salmonella enterica subsp. enterica serovar Weltevreden strain 2511STDY5712384 chromosome 1	4875411	2023696	2106581	4875411	portal,integrase,head,transposase,tail,terminase,holin,capsid,tRNA	Salmonella_phage(32.08%)	102	2095250:2095265	2103546:2103561
WP_161976003.1|2023696_2024215_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_000272237.1|2024211_2024319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000460698.1|2024524_2024971_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_000579793.1|2024950_2025745_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001534685.1|2025845_2027030_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_001222530.1|2027148_2027496_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_000487126.1|2027481_2027793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000673490.1|2027861_2028113_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_001589065.1|2028308_2028407_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_000512149.1|2028545_2028794_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_001532438.1|2029107_2029749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000513733.1|2029978_2030161_-	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_001248993.1|2030163_2030526_-	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_000457190.1|2030698_2031337_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_000617977.1|2031535_2032081_-	chorismate mutase	NA	NA	NA	NA	NA
WP_000208086.1|2032396_2032645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000190263.1|2032899_2033748_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001534706.1|2033816_2034410_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000174558.1|2034554_2035343_-	cryptic aminoglycoside nucleotidyltransferase ANT(3'')/ANT(9)	NA	NA	NA	NA	NA
WP_000502119.1|2035513_2035972_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_001537483.1|2036160_2036808_-	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_001183697.1|2037004_2037331_-	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_000456065.1|2037524_2038658_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_000947455.1|2038739_2039330_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_000950206.1|2039323_2040121_-	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.2	4.7e-11
WP_000966636.1|2040114_2040927_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001520270.1|2040916_2041891_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000946087.1|2041890_2043525_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000182479.1|2044206_2044521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000929974.1|2044669_2045200_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	70.5	2.8e-36
WP_000780159.1|2045282_2046326_-	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_001218118.1|2046664_2047132_-	Hsp20 family protein	NA	NA	NA	NA	NA
WP_077905118.1|2047326_2047557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000977722.1|2048259_2048604_+	c-type lysozyme inhibitor	NA	NA	NA	NA	NA
WP_000789472.1|2049841_2050399_-	virulence membrane protein PagC	NA	Q9LA63	Enterobacterial_phage	33.0	2.2e-15
WP_024134152.1|2051203_2051467_+	virulence protein PagD	NA	NA	NA	NA	NA
WP_001537306.1|2051598_2051811_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_001534683.1|2052228_2052750_+	ricin-type beta-trefoil lectin domain protein	NA	NA	NA	NA	NA
WP_000497448.1|2052940_2053180_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.5	2.5e-32
WP_001033398.1|2053669_2054458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917260.1|2055447_2056572_-	type III secretion system effector SopF	NA	NA	NA	NA	NA
WP_001521673.1|2057018_2057231_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.5e-20
WP_043991223.1|2057482_2058154_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.4	4.0e-80
WP_071587004.1|2058274_2058436_-	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	97.0	1.5e-09
WP_057515787.1|2058615_2058816_+	PagK	NA	NA	NA	NA	NA
WP_000711200.1|2059106_2059664_-	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	32.8	3.9e-20
WP_000143155.1|2060313_2060889_-|tail	tail fiber assembly protein	tail	E5G6P1	Salmonella_phage	86.9	1.0e-92
WP_000593428.1|2060878_2061703_-	macro domain-containing protein	NA	A0A0M4QWS3	Salmonella_phage	94.9	4.9e-152
WP_057525099.1|2061699_2064141_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	63.1	7.3e-87
WP_000178849.1|2064194_2064437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057516412.1|2064475_2067838_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.9	0.0e+00
WP_057524907.1|2067900_2068548_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	78.1	1.0e-88
WP_057515768.1|2068445_2069183_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	84.6	5.7e-128
WP_001152689.1|2069189_2069888_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000447369.1|2069897_2070227_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_057515769.1|2070229_2073271_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	64.7	9.8e-291
WP_077905125.1|2073242_2073581_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	63.6	3.5e-32
WP_000479607.1|2073577_2073973_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_000971954.1|2074023_2074770_-	Ig-like domain-containing protein	NA	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_023184817.1|2074777_2075179_-|tail	phage tail protein	tail	Q9G0F3	Phage_Gifsy-1	98.0	1.2e-50
WP_043991247.1|2075287_2076418_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	99.7	4.5e-217
WP_000677089.1|2076466_2077045_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000083295.1|2077031_2077409_-|tail	tail attachment protein	tail	K7PHD8	Enterobacteria_phage	54.7	3.4e-28
WP_000235459.1|2077419_2077779_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_057515266.1|2077836_2078865_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	60.8	5.0e-114
WP_000011258.1|2078919_2079267_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	53.8	4.1e-20
WP_001189503.1|2079279_2080776_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
WP_000831821.1|2080765_2082346_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_000201415.1|2082342_2082546_-	gpW family protein	NA	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_001534812.1|2082529_2084461_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	2.8e-259
WP_001102153.1|2084432_2084978_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_001252725.1|2085236_2085740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000636436.1|2085842_2086385_-	DUF2514 family protein	NA	NA	NA	NA	NA
WP_001075992.1|2086381_2086996_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	92.2	6.7e-106
WP_000226307.1|2086995_2087277_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
WP_001294875.1|2087263_2087653_-|holin	phage holin family protein	holin	K7PHB9	Enterobacterial_phage	71.8	8.1e-41
WP_000658036.1|2087742_2087931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000057291.1|2088234_2088930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001534776.1|2089232_2090069_-	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	77.4	3.5e-121
WP_000595052.1|2090065_2090338_-	hypothetical protein	NA	A0A1B5FPA6	Escherichia_phage	77.6	9.4e-28
WP_024134153.1|2090352_2091342_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	7.1e-190
WP_001061461.1|2091349_2092210_-	KilA-N domain-containing protein	NA	A0A192Y6F8	Salmonella_phage	98.3	2.3e-160
WP_000767086.1|2092226_2092616_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A192Y8N5	Salmonella_phage	97.7	1.6e-68
WP_000066940.1|2092612_2093506_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	93.9	7.3e-162
WP_001669427.1|2093505_2093988_-	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	98.1	6.0e-86
WP_000104923.1|2093989_2094949_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	83.4	3.2e-123
WP_000620702.1|2094945_2095170_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_001087399.1|2095166_2096309_-	Rha family phage regulatory protein	NA	A0A1C9IHV9	Salmonella_phage	93.4	2.5e-194
2095250:2095265	attL	ACAGGTTTACGGCCAG	NA	NA	NA	NA
WP_000509731.1|2096305_2096860_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
WP_001191666.1|2096888_2097113_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_001020636.1|2097210_2097906_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	100.0	3.2e-128
WP_000883481.1|2098240_2098438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000997190.1|2098976_2099348_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
WP_000080410.1|2099405_2100233_+	DUF2303 family protein	NA	Q8HAA2	Salmonella_phage	98.9	1.1e-151
WP_000008350.1|2100369_2100909_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	98.9	6.5e-97
WP_000089142.1|2101052_2101289_+	excisionase	NA	NA	NA	NA	NA
WP_000741325.1|2101278_2102421_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21929	Phage_21	80.3	8.2e-174
WP_000444507.1|2102534_2103785_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	1.1e-19
2103546:2103561	attR	CTGGCCGTAAACCTGT	NA	NA	NA	NA
WP_001249415.1|2103956_2104622_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000825956.1|2104618_2104948_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_000476064.1|2104959_2105421_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000004540.1|2105474_2106581_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 6
NZ_LN890522	Salmonella enterica subsp. enterica serovar Weltevreden strain 2511STDY5712384 chromosome 1	4875411	2279050	2285347	4875411		Enterobacteria_phage(50.0%)	6	NA	NA
WP_001100807.1|2279050_2279581_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.1	3.7e-52
WP_000857532.1|2279585_2280464_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	1.7e-107
WP_001023657.1|2280511_2281411_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	7.9e-31
WP_000697846.1|2281410_2282496_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_000981469.1|2282872_2283766_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001111837.1|2283943_2285347_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	3.1e-21
>prophage 7
NZ_LN890522	Salmonella enterica subsp. enterica serovar Weltevreden strain 2511STDY5712384 chromosome 1	4875411	2358658	2367829	4875411	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195334.1|2358658_2360692_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703137.1|2360932_2361391_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_001265351.1|2361562_2362093_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950422.1|2362149_2362617_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	89.7	1.1e-73
WP_000598637.1|2362663_2363383_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272850.1|2363379_2365065_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_001240418.1|2365287_2366019_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|2366078_2366186_+	protein YohO	NA	NA	NA	NA	NA
WP_000824854.1|2366166_2366898_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569166.1|2366881_2367829_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 8
NZ_LN890522	Salmonella enterica subsp. enterica serovar Weltevreden strain 2511STDY5712384 chromosome 1	4875411	3380555	3436783	4875411	portal,integrase,plate,head,tail,terminase,holin,capsid,tRNA	Cronobacter_phage(63.41%)	61	3386891:3386908	3418204:3418221
WP_001264389.1|3380555_3381569_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	2.2e-109
WP_001144069.1|3381796_3382012_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918869.1|3382247_3383993_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.2	6.2e-72
WP_001519776.1|3384142_3385990_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_000237776.1|3386113_3386620_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
3386891:3386908	attL	TGTCGCAAAAGTGTCGCA	NA	NA	NA	NA
WP_001215694.1|3386932_3387556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000977538.1|3388206_3389910_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.3	9.9e-224
WP_000200790.1|3389909_3390455_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	73.1	1.5e-64
WP_000267951.1|3390426_3391152_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.4	6.6e-68
WP_000421116.1|3391141_3391669_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	53.1	1.1e-51
WP_000084305.1|3391686_3393714_-|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	47.7	3.1e-155
WP_001534884.1|3393723_3394311_-	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.6	2.2e-90
WP_000136925.1|3394303_3395488_-|plate	baseplate J/gp47 family protein	plate	F1BUK6	Cronobacter_phage	78.4	1.8e-179
WP_001002797.1|3395484_3395814_-	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_000811092.1|3395810_3397781_-|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	71.1	6.4e-275
WP_000411337.1|3397968_3398226_-	hypothetical protein	NA	A5X9I7	Aeromonas_virus	63.4	3.6e-21
WP_000376370.1|3398372_3398705_-	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.9	6.7e-36
WP_000175560.1|3398704_3399046_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_001154425.1|3399042_3399336_-|holin	holin	holin	C7BGD7	Burkholderia_phage	46.2	1.3e-14
WP_000166743.1|3399345_3399801_-	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	1.5e-57
WP_000220203.1|3399797_3400925_-	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	83.7	1.9e-175
WP_000560078.1|3400921_3401629_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	77.4	1.0e-102
WP_000084222.1|3401625_3402132_-|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.1	3.4e-63
WP_024135609.1|3402128_3402581_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	81.3	8.0e-64
WP_000398492.1|3402677_3402872_-	hypothetical protein	NA	Q8W634	Enterobacteria_phage	58.6	3.3e-11
WP_001218538.1|3402875_3403580_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	67.4	4.7e-87
WP_000550496.1|3403583_3404606_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.2	1.1e-158
WP_000018796.1|3404667_3405471_-|capsid	GPO family capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	56.0	1.6e-78
WP_001151942.1|3405631_3407407_+	hypothetical protein	NA	F1BUM5	Cronobacter_phage	83.6	5.2e-292
WP_000038208.1|3407403_3408465_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	77.1	2.3e-162
WP_001552031.1|3408461_3408785_+	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	92.3	8.0e-50
WP_000353141.1|3408758_3408965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000170875.1|3409084_3411106_-	replication endonuclease	NA	F1BUM9	Cronobacter_phage	75.1	1.7e-299
WP_000279408.1|3411102_3411963_-	DNA adenine methylase	NA	F1BUN1	Cronobacter_phage	82.7	2.2e-131
WP_000551169.1|3411953_3412187_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_000022786.1|3412254_3412656_-	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.9	1.4e-48
WP_000996837.1|3412655_3413081_-	hypothetical protein	NA	F1BUN5	Cronobacter_phage	49.6	2.2e-23
WP_000643375.1|3413070_3413298_-	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_000460878.1|3413307_3413811_-	phage regulatory CII family protein	NA	F1BUN6	Cronobacter_phage	72.5	3.5e-60
WP_001247711.1|3413841_3414063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000514631.1|3414206_3414788_+	phage repressor protein	NA	A0A218M4J1	Erwinia_phage	37.2	1.2e-27
WP_000568372.1|3414804_3415371_+	PH domain-containing protein	NA	Q4ZA70	Staphylococcus_virus	32.8	1.3e-18
WP_001145220.1|3415374_3416412_+|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	63.9	1.5e-121
WP_000627044.1|3416401_3418183_+	ATP-binding protein	NA	X2KLG0	Campylobacter_phage	23.2	6.4e-08
WP_000213761.1|3418440_3419208_-	siderophore-interacting protein	NA	NA	NA	NA	NA
3418204:3418221	attR	TGTCGCAAAAGTGTCGCA	NA	NA	NA	NA
WP_000983434.1|3419439_3420087_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000478471.1|3420083_3421649_-	MCP four helix bundle domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.9	1.7e-12
WP_000094639.1|3422036_3423557_-	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	47.8	8.4e-33
WP_001520281.1|3423986_3425366_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	29.0	2.9e-32
WP_000121517.1|3425536_3427555_+	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_000019989.1|3427635_3428772_-	23S rRNA (guanine(1835)-N(2))-methyltransferase RlmG	NA	NA	NA	NA	NA
WP_000202966.1|3428857_3429355_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_000951045.1|3429505_3430198_+	vancomycin high temperature exclusion protein	NA	NA	NA	NA	NA
WP_000617678.1|3430286_3431285_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_001098833.1|3431555_3432524_+	TerC family protein	NA	I7HPH5	Enterobacteria_phage	34.9	5.0e-39
WP_000235363.1|3432778_3434023_+	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_000422141.1|3434472_3435135_+	DedA family protein	NA	NA	NA	NA	NA
WP_000917516.1|3435138_3435522_+	EnvZ/OmpR regulon moderator MzrA	NA	NA	NA	NA	NA
WP_000877297.1|3435666_3436035_+	DUF1090 domain-containing protein	NA	NA	NA	NA	NA
WP_000031219.1|3436076_3436382_+	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_000785626.1|3436384_3436783_+|holin	phage holin family protein	holin	NA	NA	NA	NA
>prophage 9
NZ_LN890522	Salmonella enterica subsp. enterica serovar Weltevreden strain 2511STDY5712384 chromosome 1	4875411	4714082	4773529	4875411	portal,integrase,transposase,tRNA	Enterobacteria_phage(18.18%)	50	4725598:4725614	4771565:4771581
WP_000251089.1|4714082_4714529_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000047544.1|4714603_4714990_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148570.1|4715066_4715528_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013055.1|4715540_4716476_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	39.2	6.5e-52
WP_000249504.1|4716511_4716613_-	pyr operon leader peptide	NA	NA	NA	NA	NA
WP_000666051.1|4716703_4717192_-	arginine repressor	NA	NA	NA	NA	NA
WP_000514433.1|4717378_4718782_-	YfcC family protein	NA	NA	NA	NA	NA
WP_000237035.1|4718837_4719842_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000428751.1|4719953_4720886_-	carbamate kinase	NA	NA	NA	NA	NA
WP_000410846.1|4720896_4722117_-	arginine deiminase	NA	NA	NA	NA	NA
WP_000583454.1|4722792_4723245_+	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_000103041.1|4723318_4724323_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000002940.1|4724488_4724905_+	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_000218452.1|4724916_4725729_+|tRNA	tRNA isopentenyl-2-thiomethyl-A-37 hydroxylase MiaE	tRNA	NA	NA	NA	NA
4725598:4725614	attL	GCGCTGGCGCAGCAGAT	NA	NA	NA	NA
WP_000826193.1|4725962_4726451_-	DUF3617 domain-containing protein	NA	NA	NA	NA	NA
WP_001519079.1|4726557_4727061_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000416350.1|4728585_4731441_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.4	1.2e-141
WP_001523689.1|4731440_4731884_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397158.1|4732020_4733532_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.7	8.3e-49
WP_000584132.1|4733926_4735027_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001182242.1|4735026_4736109_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_001244065.1|4736304_4737303_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001128356.1|4737366_4738686_-	gnt-II system L-idonate transporter	NA	NA	NA	NA	NA
WP_000998692.1|4738747_4739512_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000453359.1|4739536_4740568_-	L-idonate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000896756.1|4740784_4741315_+	gluconokinase	NA	NA	NA	NA	NA
WP_000152563.1|4741342_4742362_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.1	1.3e-42
WP_043991162.1|4742833_4744096_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	35.6	3.7e-66
WP_001066526.1|4744126_4744765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534484.1|4745134_4745365_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001118612.1|4745837_4746014_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	55.6	4.2e-05
WP_001247001.1|4746006_4746360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001027156.1|4746391_4746676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001075575.1|4746672_4747056_+	DUF5375 family protein	NA	NA	NA	NA	NA
WP_000211880.1|4747052_4749725_+	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	34.4	2.1e-58
WP_000648110.1|4749785_4750004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001064139.1|4750124_4750886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015633239.1|4750885_4751158_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000368629.1|4751482_4753153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000369883.1|4753180_4754206_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	88.2	6.0e-168
WP_000254752.1|4756067_4756316_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_000016244.1|4756428_4756668_+	type II toxin-antitoxin system CcdA family antitoxin	NA	NA	NA	NA	NA
WP_001199743.1|4756670_4756979_+	CcdB family protein	NA	NA	NA	NA	NA
WP_001023050.1|4758135_4759155_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000213428.1|4759654_4765975_-	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	22.0	4.7e-45
WP_015632990.1|4765987_4768822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000081842.1|4768913_4770116_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	71.5	4.4e-77
WP_000422448.1|4770899_4771094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000199885.1|4771171_4772047_+	HNH endonuclease	NA	NA	NA	NA	NA
4771565:4771581	attR	GCGCTGGCGCAGCAGAT	NA	NA	NA	NA
WP_000081842.1|4772326_4773529_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	71.5	4.4e-77
>prophage 1
NZ_LN890523	Salmonella enterica subsp. enterica serovar Weltevreden strain 2511STDY5712384 plasmid 2, complete sequence	82119	0	18362	82119	transposase	Shigella_phage(66.67%)	5	NA	NA
WP_000653672.1|13557_14817_+	MFS transporter	NA	NA	NA	NA	NA
WP_106086674.1|15187_16298_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	38.2	1.2e-44
WP_000493752.1|16310_17069_-	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_000537154.1|17226_17511_+|transposase	IS3 family transposase	transposase	U5P4I9	Shigella_phage	46.0	8.1e-14
WP_077905131.1|17507_18362_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	56.2	5.2e-80
>prophage 2
NZ_LN890523	Salmonella enterica subsp. enterica serovar Weltevreden strain 2511STDY5712384 plasmid 2, complete sequence	82119	26582	30805	82119	transposase	Shigella_phage(66.67%)	7	NA	NA
WP_015633273.1|26582_27206_+|transposase	IS4 family transposase	transposase	S5FM71	Shigella_phage	62.1	1.7e-72
WP_138009944.1|27260_27545_+|transposase	transposase	transposase	S5FM71	Shigella_phage	60.3	3.2e-10
WP_001247111.1|27603_28572_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000792037.1|29538_29754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001004831.1|29743_29995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001064756.1|30071_30299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000031011.1|30499_30805_-	hypothetical protein	NA	A0A0K1LL53	Rhodobacter_phage	49.5	9.3e-16
>prophage 3
NZ_LN890523	Salmonella enterica subsp. enterica serovar Weltevreden strain 2511STDY5712384 plasmid 2, complete sequence	82119	35163	35895	82119		Xanthomonas_phage(100.0%)	1	NA	NA
WP_001068034.1|35163_35895_-	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	38.1	1.6e-05
>prophage 4
NZ_LN890523	Salmonella enterica subsp. enterica serovar Weltevreden strain 2511STDY5712384 plasmid 2, complete sequence	82119	45570	52621	82119	transposase	uncultured_virus(25.0%)	8	NA	NA
WP_000081842.1|45570_46773_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	71.5	4.4e-77
WP_000502119.1|46928_47387_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	D9CGB6	Hyperthermophilic_Archaeal_Virus_2	35.3	5.9e-14
WP_043991282.1|47690_48221_-	antirestriction protein	NA	NA	NA	NA	NA
WP_001135896.1|48790_49624_-	SAM-dependent DNA methyltransferase	NA	H7BVT3	unidentified_phage	37.4	4.5e-12
WP_001159046.1|49670_49817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000550116.1|49911_50259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001534946.1|50315_50720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000826380.1|51412_52621_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	91.0	4.7e-204
>prophage 5
NZ_LN890523	Salmonella enterica subsp. enterica serovar Weltevreden strain 2511STDY5712384 plasmid 2, complete sequence	82119	56659	59445	82119		Enterobacteria_phage(50.0%)	5	NA	NA
WP_000218311.1|56659_57214_-	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	74.0	3.3e-51
WP_015633296.1|57448_57730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001534950.1|57906_58224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000761849.1|58704_58896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000108572.1|58938_59445_-	antirestriction protein ArdA	NA	A0A1I9S7Y0	Rhodococcus_phage	28.9	1.1e-08
>prophage 6
NZ_LN890523	Salmonella enterica subsp. enterica serovar Weltevreden strain 2511STDY5712384 plasmid 2, complete sequence	82119	63645	82119	82119	integrase,transposase	Cronobacter_phage(14.29%)	9	60290:60304	71287:71301
60290:60304	attL	TCCGTCAGCCATTCC	NA	NA	NA	NA
WP_000271045.1|63645_64920_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.2	5.0e-156
WP_000064273.1|65001_65976_-	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	52.9	2.0e-83
WP_000427674.1|65975_67181_-	AAA family ATPase	NA	A0A077SL49	Escherichia_phage	69.6	1.4e-163
WP_000728920.1|67606_68548_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	55.0	1.4e-73
WP_000083588.1|68698_69481_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	91.1	3.5e-51
WP_001159862.1|69789_70095_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000813644.1|70096_70315_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_086011258.1|71000_72205_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	70.8	1.1e-115
71287:71301	attR	TCCGTCAGCCATTCC	NA	NA	NA	NA
WP_024134209.1|73737_82119_+	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	28.6	1.9e-190
