The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LT904893	Salmonella enterica subsp. enterica serovar Typhi strain 1016889 genome assembly, chromosome: 1	4807786	739049	782752	4807786	transposase,tRNA,protease,bacteriocin	Acinetobacter_phage(25.0%)	47	NA	NA
WP_000421096.1|739049_739328_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_000768134.1|739570_739837_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_001141622.1|739833_740151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071525158.1|741271_741451_-	type VI secretion system protein	NA	NA	NA	NA	NA
WP_001681938.1|741800_742085_-	DUF4102 domain-containing protein	NA	A0A0P0IRB7	Acinetobacter_phage	35.2	3.2e-10
WP_000234466.1|742426_743134_-	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_001049802.1|745744_747001_-	nucleoside permease	NA	NA	NA	NA	NA
WP_000976287.1|747217_748303_-	membrane-bound lytic murein transglycosylase MltC	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	5.8e-12
WP_000091706.1|748415_748691_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_001148958.1|748718_749771_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000786887.1|749925_750645_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001107559.1|750644_750971_+	YggL family protein	NA	NA	NA	NA	NA
WP_000984827.1|751020_751740_+	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_000502119.1|751862_752321_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	NA	NA	NA	NA
WP_000394189.1|752639_753686_+	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000252198.1|753818_754826_+	DUF1202 domain-containing protein	NA	NA	NA	NA	NA
WP_001096530.1|754916_756053_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_001174773.1|756045_756639_-	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_001277205.1|756646_756937_-	YggU family protein	NA	NA	NA	NA	NA
WP_001094848.1|756933_757500_-	YggT family protein	NA	NA	NA	NA	NA
WP_000997790.1|757518_758223_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_001055657.1|758240_759221_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000098333.1|759350_760037_+	global regulatory protein	NA	NA	NA	NA	NA
WP_001285491.1|760083_760500_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001053167.1|760499_761063_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000593242.1|761278_762226_-	glutathione synthase	NA	NA	NA	NA	NA
WP_001800534.1|762245_762977_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000286121.1|763053_763761_-	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_000856775.1|763856_764354_-|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_001113171.1|764432_765827_-	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_001062140.1|766319_767474_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.9	1.5e-130
WP_001803086.1|767529_767829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000729109.1|768123_768255_+	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_001278580.1|768263_770240_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_000105550.1|770467_771388_+	agmatinase	NA	NA	NA	NA	NA
WP_000701830.1|771488_772247_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_000098658.1|772522_774514_+	transketolase	NA	NA	NA	NA	NA
WP_000502119.1|774702_775161_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	NA	NA	NA	NA
WP_000956919.1|775265_775922_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	28.6	1.6e-09
WP_000367758.1|775915_776599_-	energy-coupling factor ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_000553254.1|776580_777288_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_000124001.1|777288_777867_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_000218564.1|777892_778318_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000218338.1|778691_779738_+	erythrose-4-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_000111274.1|779759_780923_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_000034386.1|781024_782104_+	class II fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_001204111.1|782293_782752_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_LT904893	Salmonella enterica subsp. enterica serovar Typhi strain 1016889 genome assembly, chromosome: 1	4807786	1047610	1113601	4807786	tail,tRNA	Salmonella_phage(41.18%)	54	NA	NA
WP_000047238.1|1047610_1050241_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	38.3	3.5e-79
WP_000906486.1|1050475_1050661_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000271296.1|1052059_1052626_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	M1I5S4	Acanthocystis_turfacea_Chlorella_virus	27.6	7.2e-14
WP_001279499.1|1052622_1053048_+	DedA family protein	NA	NA	NA	NA	NA
WP_000611827.1|1053124_1054681_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_001130194.1|1054830_1055346_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_000645128.1|1055691_1057062_+	glycoporin	NA	NA	NA	NA	NA
WP_001187289.1|1057110_1058649_-	multidrug efflux MFS transporter permease subunit EmrB	NA	NA	NA	NA	NA
WP_001275597.1|1058665_1059838_-	multidrug efflux MFS transporter periplasmic adaptor subunit EmrA	NA	NA	NA	NA	NA
WP_000378431.1|1059964_1060495_-	transcriptional repressor MprA	NA	NA	NA	NA	NA
WP_000165770.1|1060991_1062176_-	MFS transporter	NA	NA	NA	NA	NA
WP_001216613.1|1062340_1063336_-	glycine betaine/L-proline ABC transporter substrate-binding protein ProX	NA	NA	NA	NA	NA
WP_000775015.1|1063405_1064470_-	glycine betaine/L-proline ABC transporter permease ProW	NA	NA	NA	NA	NA
WP_000777898.1|1066018_1066978_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	71.8	4.0e-129
WP_000201426.1|1066988_1069133_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	49.0	3.5e-194
WP_001275403.1|1069105_1069516_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	41.8	4.3e-16
WP_000028873.1|1069512_1069758_-	glutaredoxin-like protein NrdH	NA	NA	NA	NA	NA
WP_010989219.1|1069856_1070033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000209805.1|1070029_1070461_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_001519557.1|1071967_1072294_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_000281304.1|1072455_1072806_+	YgaC family protein	NA	NA	NA	NA	NA
WP_000492647.1|1072840_1073290_-	L-alanine exporter AlaE	NA	NA	NA	NA	NA
WP_001051100.1|1073988_1074390_+	DNA-binding protein StpA	NA	NA	NA	NA	NA
WP_000022010.1|1074738_1075266_-	DUF2892 domain-containing protein	NA	NA	NA	NA	NA
WP_000137417.1|1075275_1075575_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000508175.1|1075757_1075916_+	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_000126152.1|1076486_1077164_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_001095643.1|1078735_1080019_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	31.4	1.2e-32
WP_001176534.1|1080033_1081482_-	NADP-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000271916.1|1081503_1082772_-	L-2-hydroxyglutarate oxidase	NA	NA	NA	NA	NA
WP_001782268.1|1082797_1083784_-	carbon starvation induced protein CsiD	NA	NA	NA	NA	NA
WP_000382024.1|1084077_1085592_-	tripartite tricarboxylate transporter permease	NA	NA	NA	NA	NA
WP_001574835.1|1085602_1086037_-	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
WP_000744418.1|1086048_1086858_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_001237936.1|1087012_1087687_+	transcriptional regulator TctD	NA	NA	NA	NA	NA
WP_000872343.1|1087673_1089089_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_000947097.1|1089329_1090235_+	HoxN/HupN/NixA family nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_000701509.1|1090956_1091853_-	antimicrobial resistance protein Mig-14	NA	NA	NA	NA	NA
WP_000178741.1|1092146_1093076_-	VirK family antimicrobial peptide resistance protein	NA	NA	NA	NA	NA
WP_001801692.1|1093592_1094645_+	SPI-2 type III secretion system effector PipB2	NA	NA	NA	NA	NA
WP_001682025.1|1095666_1097847_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_000274373.1|1097906_1098824_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001239947.1|1098855_1100100_-	esterase family protein	NA	NA	NA	NA	NA
WP_001111827.1|1100209_1103866_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.6	1.0e-44
WP_001221113.1|1103946_1105062_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_000905046.1|1105745_1106312_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.3	1.1e-86
WP_000046142.1|1106454_1107627_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
WP_001207656.1|1107636_1108152_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
WP_001280897.1|1108206_1108509_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
WP_000763311.1|1108523_1108643_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001282793.1|1108635_1111713_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
WP_000980381.1|1111709_1112195_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
WP_001011760.1|1112191_1113292_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
WP_000972389.1|1113382_1113601_+	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	71.9	1.9e-18
>prophage 3
NZ_LT904893	Salmonella enterica subsp. enterica serovar Typhi strain 1016889 genome assembly, chromosome: 1	4807786	1799955	1807267	4807786	integrase,protease	Dickeya_phage(16.67%)	7	1801206:1801220	1812385:1812399
WP_001201759.1|1799955_1801074_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
WP_000125880.1|1801070_1803017_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
1801206:1801220	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
WP_000447499.1|1803146_1803368_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|1803691_1804012_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934058.1|1804042_1806319_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	1.8e-164
WP_001117984.1|1806530_1806728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001539594.1|1806889_1807267_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
1812385:1812399	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
>prophage 4
NZ_LT904893	Salmonella enterica subsp. enterica serovar Typhi strain 1016889 genome assembly, chromosome: 1	4807786	1878405	1952505	4807786	tail,transposase,holin,protease,integrase,terminase,head	Salmonella_phage(75.41%)	91	1860471:1860490	1931078:1931097
1860471:1860490	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_001262313.1|1878405_1879698_-|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	99.8	5.0e-252
WP_000065276.1|1879742_1879991_-	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001754984.1|1880031_1880271_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	96.2	9.7e-37
WP_010989138.1|1880276_1881158_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4R347	Salmonella_phage	93.0	1.2e-153
WP_000034527.1|1881154_1882219_-	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	74.6	6.3e-152
WP_000187053.1|1882296_1882977_-	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	98.7	1.9e-130
WP_001764962.1|1882973_1883759_-	phage recombination protein Bet	NA	A0A0M4RD39	Salmonella_phage	99.6	9.7e-150
WP_000995349.1|1883764_1884061_-	host-nuclease inhibitor protein Gam	NA	A0A0M5M5Z9	Salmonella_phage	96.9	4.4e-47
WP_000186242.1|1884151_1884352_-	cell division protein FtsZ	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
WP_001009036.1|1884640_1885045_-	transcriptional regulator	NA	H6WRX4	Salmonella_phage	99.3	7.1e-72
WP_000869365.1|1885174_1885411_+	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	98.7	1.1e-37
WP_001574095.1|1885376_1885751_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_001681803.1|1885835_1886819_+	hypothetical protein	NA	H6WRX7	Salmonella_phage	99.7	2.1e-162
WP_000800010.1|1886821_1887571_+	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000113623.1|1887581_1887929_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
WP_000065105.1|1887925_1888450_+	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
WP_000445792.1|1888449_1888923_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
WP_000208074.1|1888926_1889499_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	68.0	1.3e-66
WP_001220318.1|1889592_1889859_+	hypothetical protein	NA	S4TNF2	Salmonella_phage	100.0	1.5e-46
WP_010989139.1|1889940_1890102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000509711.1|1890344_1890524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000963896.1|1890534_1891032_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_001217670.1|1891216_1891456_+	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
WP_001574100.1|1891445_1891751_+	hypothetical protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
WP_000929790.1|1891790_1892393_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
WP_001096560.1|1892601_1893213_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	2.5e-92
WP_001617856.1|1893209_1893356_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001047634.1|1893345_1894143_+	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	3.4e-150
WP_001534733.1|1894541_1894667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798706.1|1894802_1895252_-	lipoprotein	NA	NA	NA	NA	NA
WP_001294876.1|1895468_1895858_+	membrane protein	NA	K7PHB9	Enterobacterial_phage	70.2	3.1e-40
WP_000226307.1|1895844_1896126_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
WP_001075998.1|1896125_1896740_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	93.1	3.2e-108
WP_000495544.1|1897317_1897695_+	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	68.5	4.9e-43
WP_001070544.1|1897791_1898019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001118118.1|1898108_1898861_+	hypothetical protein	NA	A0A0M3ULJ9	Salmonella_phage	56.5	3.4e-11
WP_000204794.1|1898826_1900230_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	70.1	6.5e-189
WP_000113511.1|1900229_1901699_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	99.2	1.7e-280
WP_138010671.1|1901583_1902321_+|head	phage head morphogenesis protein	head	A0A0M4REK0	Salmonella_phage	88.1	7.8e-101
WP_000873182.1|1902335_1903568_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	99.0	1.4e-227
WP_000128060.1|1903572_1904070_+	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	8.7e-88
WP_000627464.1|1904081_1905023_+	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	100.0	3.1e-179
WP_001040702.1|1905064_1905433_+	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	100.0	8.7e-61
WP_001125675.1|1905398_1905806_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	97.8	7.1e-72
WP_000008737.1|1905802_1906357_+	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	100.0	4.8e-95
WP_001142488.1|1906343_1906733_+	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	6.0e-68
WP_000389379.1|1906707_1907271_+	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	75.3	8.9e-81
WP_001135544.1|1907274_1908420_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	74.5	2.2e-163
WP_000257259.1|1908431_1908872_+	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	3.5e-56
WP_000389047.1|1908875_1909328_+	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	76.6	1.9e-57
WP_000990867.1|1909505_1911458_+	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	56.0	1.8e-181
WP_000346974.1|1911457_1912108_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	60.6	3.0e-56
WP_000388505.1|1912111_1912414_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	57.0	2.0e-26
WP_000042301.1|1912416_1913448_+	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	51.4	1.2e-96
WP_000826019.1|1913444_1913780_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	52.2	1.1e-20
WP_000050472.1|1913974_1914706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144794.1|1914705_1915134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001685627.1|1915192_1915948_+	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	85.3	4.1e-105
WP_000564971.1|1916035_1916173_+	hypothetical protein	NA	A0A0M4S639	Salmonella_phage	100.0	2.0e-18
WP_001270647.1|1916188_1916542_+	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	98.3	3.2e-60
WP_001197092.1|1916542_1917742_+	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	97.5	8.5e-214
WP_000049938.1|1917738_1918419_+	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	98.7	6.9e-128
WP_001681975.1|1918418_1919930_+	hypothetical protein	NA	S4TP62	Salmonella_phage	59.4	1.5e-111
WP_000421106.1|1919944_1920463_+|tail	tail fiber assembly protein	tail	A0A1B0VCD0	Salmonella_phage	62.8	1.7e-46
WP_000480169.1|1921384_1922086_-	DUF1076 domain-containing protein	NA	NA	NA	NA	NA
WP_000497443.1|1922398_1922677_-	DinI-like family protein	NA	S4TNM0	Salmonella_phage	92.3	2.4e-26
WP_000193884.1|1923102_1925715_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	1.1e-19
WP_000291724.1|1925922_1926933_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001220671.1|1927098_1927641_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224084.1|1927637_1928747_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001086472.1|1928845_1930954_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	W6LLI2	Streptococcus_phage	29.6	5.1e-20
WP_000053045.1|1930966_1932874_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1931078:1931097	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_000333152.1|1932888_1934142_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000433416.1|1934146_1935787_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000759136.1|1935783_1936347_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001764860.1|1936600_1936768_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|1936867_1937386_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000156455.1|1937454_1939215_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877174.1|1939400_1939853_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_010989142.1|1939924_1940977_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288732.1|1941331_1941841_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001202371.1|1942057_1942663_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000950867.1|1942649_1944803_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261222.1|1944821_1945268_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420526.1|1945391_1947446_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
WP_000424187.1|1947481_1947940_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847719.1|1948034_1948697_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000975203.1|1948867_1949284_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|1949328_1949646_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000140485.1|1949703_1950915_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000502118.1|1952046_1952505_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_LT904893	Salmonella enterica subsp. enterica serovar Typhi strain 1016889 genome assembly, chromosome: 1	4807786	2398535	2472133	4807786	transposase,tail,protease,integrase,head,plate,tRNA	Burkholderia_virus(40.48%)	89	2388865:2388880	2444738:2444753
2388865:2388880	attL	GATTTTACCTGCCTTT	NA	NA	NA	NA
WP_000502118.1|2398535_2398994_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	NA	NA	NA	NA
WP_001766314.1|2399526_2399778_+	acid shock protein	NA	NA	NA	NA	NA
WP_000549642.1|2400046_2400868_+|protease	serine protease	protease	NA	NA	NA	NA
WP_001183821.1|2400902_2401232_-	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_000500278.1|2401218_2401581_-	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_001539987.1|2401692_2401863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001118268.1|2401997_2403032_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_000014056.1|2403206_2404595_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit beta	NA	NA	NA	NA	NA
WP_001219360.1|2404605_2406135_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_000769298.1|2406661_2407606_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001281695.1|2407787_2408177_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	54.2	4.5e-31
WP_000988475.1|2408148_2408601_-	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	46.6	1.2e-24
WP_010989166.1|2408590_2408806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000631816.1|2408795_2409026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000131941.1|2409022_2409706_-	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	37.3	2.6e-34
WP_000132655.1|2409702_2409918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001315283.1|2409910_2410294_-	hypothetical protein	NA	K7PJQ4	Enterobacteria_phage	58.9	2.3e-27
WP_000197790.1|2410290_2410593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000632575.1|2410602_2410875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001140134.1|2411163_2411694_-	host-nuclease inhibitor protein Gam	NA	L7P7T1	Pseudomonas_phage	66.1	3.4e-58
WP_000843446.1|2411721_2411991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000960673.1|2411993_2413160_-	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	59.7	3.3e-122
WP_000990529.1|2413170_2414940_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6QIE0	Burkholderia_phage	68.5	2.8e-229
WP_124682070.1|2415117_2415456_-	hypothetical protein	NA	A4JWN3	Burkholderia_virus	57.1	1.9e-22
WP_100208317.1|2415544_2416141_+	nucleoid-associated protein	NA	NA	NA	NA	NA
WP_000793143.1|2416384_2416735_+	membrane protein	NA	A4JWP3	Burkholderia_virus	53.0	4.5e-22
WP_001104436.1|2416737_2417466_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	57.4	2.7e-61
WP_000264664.1|2417449_2418100_+	lipoprotein	NA	Q5ZQY9	Pseudomonas_phage	32.9	8.1e-09
WP_000175097.1|2418096_2418423_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
WP_000227700.1|2418422_2418734_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
WP_000124060.1|2418733_2419279_+	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
WP_000167502.1|2419275_2420871_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.6	9.3e-184
WP_000090679.1|2420870_2422367_+	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.6	8.0e-169
WP_000117561.1|2422347_2423169_+|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.2	5.3e-98
WP_000135517.1|2423171_2423630_+	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	1.5e-30
WP_001273072.1|2423844_2424960_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.1	7.9e-97
WP_001286905.1|2424974_2425928_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	44.5	5.2e-65
WP_000537457.1|2425937_2426276_+	DUF2190 family protein	NA	NA	NA	NA	NA
WP_000271668.1|2426277_2426724_+	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
WP_001101804.1|2426723_2427188_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
WP_001789770.1|2427184_2427439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000729859.1|2427428_2428856_+|tail	tail protein	tail	A4JWK5	Burkholderia_virus	77.4	3.7e-216
WP_000034292.1|2428855_2429377_+|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	68.2	8.0e-68
WP_000110118.1|2429379_2429661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000084228.1|2429758_2430094_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001148841.1|2430038_2430176_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_000135574.1|2430269_2432735_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	42.6	2.2e-168
WP_000458383.1|2432734_2433619_+|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	47.0	7.5e-50
WP_048662102.1|2433615_2433831_+	membrane protein	NA	A4JWL2	Burkholderia_virus	60.0	2.4e-18
WP_000808000.1|2433818_2434973_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	47.1	4.7e-84
WP_000148263.1|2434969_2435497_+|plate	phage baseplate assembly protein V	plate	Q6QIA1	Burkholderia_phage	46.5	1.5e-21
WP_000859114.1|2435553_2435901_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	60.6	8.6e-34
WP_001219103.1|2435891_2436995_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	54.3	5.4e-106
WP_000852584.1|2436987_2437566_+|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	65.8	6.4e-66
WP_000002046.1|2437568_2438594_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	53.3	1.6e-64
WP_024134057.1|2438604_2439066_+|tail	tail fiber protein	tail	K7P7Q7	Enterobacteria_phage	53.9	5.9e-38
WP_024131173.1|2439076_2439550_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	53.0	4.3e-36
WP_024131174.1|2439560_2440037_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	56.4	1.9e-44
WP_001057643.1|2440043_2440661_-|tail	tail assembly protein	tail	Q9MCR5	Enterobacteria_phage	59.9	5.8e-65
WP_001802272.1|2440660_2441164_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	54.0	2.3e-43
WP_001165548.1|2441235_2441808_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	84.7	8.8e-84
WP_000412353.1|2442088_2443471_+	amino acid permease	NA	NA	NA	NA	NA
WP_000524877.1|2443532_2443868_-	GlpM family protein	NA	NA	NA	NA	NA
WP_001080045.1|2443994_2444726_+	two-component system response regulator RstA	NA	NA	NA	NA	NA
WP_000924582.1|2444790_2445090_-	hypothetical protein	NA	NA	NA	NA	NA
2444738:2444753	attR	GATTTTACCTGCCTTT	NA	NA	NA	NA
WP_000824321.1|2445206_2446358_+	porin OmpS2	NA	Q1MVN1	Enterobacteria_phage	59.1	3.2e-117
WP_000928668.1|2446510_2448217_+	amidohydrolase	NA	NA	NA	NA	NA
WP_001681605.1|2448327_2449629_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	22.7	5.7e-14
WP_000092483.1|2449704_2450634_+	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
WP_000259129.1|2450630_2452034_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_000066606.1|2452201_2453848_-	fumarate hydratase	NA	NA	NA	NA	NA
WP_001170615.1|2454047_2455223_+	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000753325.1|2455325_2456834_+	YdgA family protein	NA	NA	NA	NA	NA
WP_077949083.1|2456954_2457173_+	PTS maltose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000565566.1|2457539_2458541_+	adenosine deaminase	NA	NA	NA	NA	NA
WP_021013203.1|2458614_2459730_-	oxidoreductase	NA	NA	NA	NA	NA
WP_000361450.1|2459832_2459988_+	division septum protein Blr	NA	NA	NA	NA	NA
WP_000217946.1|2460286_2460502_+	transcription modulator YdgT	NA	NA	NA	NA	NA
WP_000214061.1|2460590_2461031_+	DUF2569 domain-containing protein	NA	NA	NA	NA	NA
WP_000133179.1|2461107_2461689_+	electron transport complex subunit RsxA	NA	NA	NA	NA	NA
WP_001092600.1|2461688_2462267_+	electron transport complex subunit RsxB	NA	NA	NA	NA	NA
WP_000915581.1|2462259_2464281_+	electron transport complex subunit RsxC	NA	NA	NA	NA	NA
WP_000231887.1|2464281_2465340_+	electron transport complex subunit RsxD	NA	NA	NA	NA	NA
WP_000920820.1|2465343_2465964_+	electron transport complex subunit RsxG	NA	NA	NA	NA	NA
WP_001289628.1|2465966_2466659_+	electron transport complex subunit E	NA	NA	NA	NA	NA
WP_001030324.1|2466658_2467294_+	endonuclease III	NA	NA	NA	NA	NA
WP_000100913.1|2467894_2469400_+	dipeptide/tripeptide permease DtpA	NA	NA	NA	NA	NA
WP_000765713.1|2469504_2470110_+	glutathione transferase GstA	NA	NA	NA	NA	NA
WP_000168626.1|2470858_2472133_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.1	1.6e-85
>prophage 6
NZ_LT904893	Salmonella enterica subsp. enterica serovar Typhi strain 1016889 genome assembly, chromosome: 1	4807786	2653170	2657582	4807786		Escherichia_phage(50.0%)	7	NA	NA
WP_000497459.1|2653170_2653410_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	87.3	5.5e-32
WP_001036668.1|2653621_2653786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001529135.1|2654282_2655092_+	cytolethal distending toxin S-CDT	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
WP_001277616.1|2655164_2655542_+	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
WP_000158843.1|2655689_2656232_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
WP_001766395.1|2656423_2657152_-	pertussis-like toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	4.9e-63
WP_000281950.1|2657168_2657582_-	subtilase cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
>prophage 7
NZ_LT904893	Salmonella enterica subsp. enterica serovar Typhi strain 1016889 genome assembly, chromosome: 1	4807786	2861435	2868669	4807786		Morganella_phage(33.33%)	8	NA	NA
WP_001157299.1|2861435_2862866_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
WP_000377043.1|2862939_2863635_-	phosphohydrolase	NA	S4W232	Pandoravirus	27.5	2.1e-07
WP_000107435.1|2863714_2864026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001080666.1|2864676_2865861_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.4	1.4e-107
WP_024131163.1|2866121_2866310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208507.1|2866320_2866533_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	1.5e-20
WP_000457648.1|2866978_2868247_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.2	3.3e-224
WP_000394197.1|2868249_2868669_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 8
NZ_LT904893	Salmonella enterica subsp. enterica serovar Typhi strain 1016889 genome assembly, chromosome: 1	4807786	2974969	2985476	4807786		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126347.1|2974969_2976283_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565909.1|2976309_2977389_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	1.3e-16
WP_000648783.1|2977393_2978167_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018220.1|2978182_2979157_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973711.1|2979162_2979714_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.6	7.7e-53
WP_000857536.1|2979714_2980593_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.8	2.3e-107
WP_001023656.1|2980640_2981540_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	7.9e-31
WP_000697846.1|2981539_2982625_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_000981469.1|2983001_2983895_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001111852.1|2984072_2985476_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	1.1e-21
>prophage 9
NZ_LT904893	Salmonella enterica subsp. enterica serovar Typhi strain 1016889 genome assembly, chromosome: 1	4807786	3061367	3070538	4807786	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195338.1|3061367_3063401_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
WP_000703137.1|3063641_3064100_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_001197951.1|3064271_3064802_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|3064858_3065326_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598632.1|3065372_3066092_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272853.1|3066088_3067774_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	1.1e-278
WP_001240415.1|3067996_3068728_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|3068787_3068895_+	protein YohO	NA	NA	NA	NA	NA
WP_000824854.1|3068875_3069607_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569166.1|3069590_3070538_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 10
NZ_LT904893	Salmonella enterica subsp. enterica serovar Typhi strain 1016889 genome assembly, chromosome: 1	4807786	3305047	3311078	4807786		Salmonella_virus(50.0%)	6	NA	NA
WP_000377769.1|3305047_3305989_+	membrane protein	NA	E7DYY8	Enterobacteria_phage	88.2	2.4e-147
WP_001682026.1|3307231_3307621_+	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	91.5	6.9e-56
WP_000703599.1|3307589_3307844_+	glycosyltransferase	NA	A8CG95	Salmonella_phage	79.5	3.1e-25
WP_000400611.1|3307860_3309783_+	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	77.2	5.6e-300
WP_106417236.1|3310772_3310916_-	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	87.8	9.0e-14
WP_106417237.1|3310931_3311078_-	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	73.9	1.1e-14
>prophage 11
NZ_LT904893	Salmonella enterica subsp. enterica serovar Typhi strain 1016889 genome assembly, chromosome: 1	4807786	3967395	3977160	4807786	capsid,integrase	Enterobacteria_phage(50.0%)	10	3963966:3963979	3975369:3975382
3963966:3963979	attL	CGAAGGCCGGACTC	NA	NA	NA	NA
WP_015701354.1|3967395_3967947_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.1e-30
WP_000556589.1|3967879_3968203_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	70.0	3.6e-26
WP_010989311.1|3968625_3969486_+|capsid	phage capsid protein	capsid	NA	NA	NA	NA
WP_000468230.1|3969489_3969729_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	60.5	3.7e-20
WP_000214423.1|3969744_3970311_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	1.8e-60
WP_000493739.1|3970586_3971750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989310.1|3971724_3972798_+	serine/threonine protein kinase	NA	G9BWE0	Planktothrix_phage	44.7	6.5e-56
WP_000573583.1|3972794_3973871_+	serine/threonine protein kinase	NA	A0A2H4UU60	Bodo_saltans_virus	28.2	7.8e-17
WP_000772672.1|3973933_3975199_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.0	1.6e-74
WP_000152561.1|3975669_3977160_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	36.1	4.0e-11
3975369:3975382	attR	CGAAGGCCGGACTC	NA	NA	NA	NA
>prophage 12
NZ_LT904893	Salmonella enterica subsp. enterica serovar Typhi strain 1016889 genome assembly, chromosome: 1	4807786	4116123	4190659	4807786	tail,integrase,capsid,terminase,lysis,head,plate,portal	Salmonella_phage(83.33%)	80	4146461:4146476	4169464:4169479
WP_000954536.1|4116123_4117383_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.7	3.2e-78
WP_000975154.1|4117693_4118977_+	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_000511749.1|4119957_4120740_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000193665.1|4121596_4121818_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	58.3	4.6e-17
WP_000246267.1|4121814_4122276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989301.1|4122822_4124496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989300.1|4124576_4126862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000905294.1|4127153_4127417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000434168.1|4127498_4127951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000622308.1|4128130_4128619_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001143724.1|4128615_4128909_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_000449622.1|4129335_4130349_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_000488995.1|4130512_4132102_-	DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001120833.1|4132085_4133597_-	ATP-dependent helicase	NA	A0A126DN25	Acinetobacter_phage	29.0	2.0e-42
WP_001210944.1|4134450_4134990_+	Vi polysaccharide biosynthesis regulator TviA	NA	NA	NA	NA	NA
WP_000466893.1|4135234_4136512_+	Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB	NA	M1HYW7	Paramecium_bursaria_Chlorella_virus	26.7	1.3e-21
WP_000127915.1|4136514_4137561_+	Vi polysaccharide biosynthesis UDP-N-acetylglucosaminuronic acid C-4 epimerase TviC	NA	A0A2K9L0I7	Tupanvirus	45.0	1.4e-74
WP_010989299.1|4137584_4140080_+	Vi polysaccharide biosynthesis protein TviD	NA	NA	NA	NA	NA
WP_000632616.1|4140079_4141816_+	Vi polysaccharide biosynthesis glycosyltransferase TviE	NA	NA	NA	NA	NA
WP_000720235.1|4141860_4142928_+	Vi polysaccharide ABC transporter protein VexA	NA	NA	NA	NA	NA
WP_001023498.1|4142937_4143732_+	Vi polysaccharide ABC transporter inner membrane protein VexB	NA	NA	NA	NA	NA
WP_000467404.1|4143757_4144453_+	Vi polysaccharide ABC transporter ATP-binding protein VexC	NA	NA	NA	NA	NA
WP_000431675.1|4144475_4145780_+	Vi polysaccharide ABC transporter inner membrane protein VexD	NA	NA	NA	NA	NA
WP_000052242.1|4145799_4147770_+	Vi polysaccharide transport protein VexE	NA	NA	NA	NA	NA
4146461:4146476	attL	CGCTGTGCGCTGTCGG	NA	NA	NA	NA
WP_000354257.1|4148071_4148818_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001681808.1|4148817_4149708_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001681810.1|4149718_4149976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000902197.1|4150622_4150976_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	I6S1S3	Salmonella_phage	59.3	6.7e-10
WP_000027757.1|4151082_4152108_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	98.2	2.7e-200
WP_000052560.1|4152111_4152744_-	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
WP_000102106.1|4152860_4153103_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
WP_000460852.1|4153135_4153645_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	94.1	1.3e-83
WP_000956167.1|4153652_4153853_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	97.0	4.6e-32
WP_000963479.1|4153816_4154158_+	DUF5347 domain-containing protein	NA	A0A1S6L019	Salmonella_phage	99.1	4.6e-56
WP_001244240.1|4154225_4154459_+	DUF2732 domain-containing protein	NA	A0A1S6L021	Salmonella_phage	84.4	9.8e-26
WP_000785510.1|4154458_4154686_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	94.7	1.0e-35
WP_001090717.1|4154682_4155267_+	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	73.7	1.1e-76
WP_000104130.1|4155263_4156124_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	81.8	3.4e-132
WP_001154438.1|4158677_4158866_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	96.8	7.9e-26
WP_001217561.1|4158877_4159111_+	DinI family protein	NA	A0A1S6L014	Salmonella_phage	92.2	2.2e-33
WP_000835188.1|4159206_4159425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000829584.1|4159434_4160499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000789323.1|4160495_4161560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000080839.1|4161579_4162275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001681813.1|4162323_4163367_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.6	2.1e-176
WP_001098453.1|4163366_4165133_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	96.4	0.0e+00
WP_000216272.1|4165275_4166109_+|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	87.4	6.1e-126
WP_000730751.1|4166125_4167190_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	98.3	1.3e-194
WP_000059175.1|4167193_4167844_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	99.5	2.4e-114
WP_000673540.1|4167937_4168402_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	98.1	2.4e-84
WP_000868184.1|4168401_4168605_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_000171566.1|4168608_4168824_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	98.6	3.8e-32
WP_001097942.1|4168804_4169314_+	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.0	1.3e-91
WP_000731034.1|4169318_4169696_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	99.2	1.5e-60
4169464:4169479	attR	CGCTGTGCGCTGTCGG	NA	NA	NA	NA
WP_001772475.1|4169695_4170121_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	97.9	2.5e-67
WP_001039966.1|4170216_4170648_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	98.6	2.5e-75
WP_000343944.1|4170640_4171087_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	90.4	2.2e-66
WP_000993749.1|4171155_4171734_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	99.5	3.9e-108
WP_000177408.1|4171730_4172090_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	96.6	6.8e-58
WP_000268327.1|4172076_4172985_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	97.0	5.2e-155
WP_001086816.1|4172977_4173583_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
WP_000104806.1|4173579_4175199_+|tail	phage tail protein	tail	E5G6P0	Salmonella_phage	90.9	2.7e-154
WP_000006337.1|4175205_4175613_+|tail	tail assembly protein	tail	A0A1B0V844	Salmonella_phage	84.2	4.1e-59
WP_000161708.1|4175810_4176533_-	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
WP_000388790.1|4176746_4176965_+	Hin recombinase	NA	A0A1S6L009	Salmonella_phage	90.3	1.4e-29
WP_000046101.1|4177067_4178240_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	9.8e-223
WP_001207653.1|4178249_4178765_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
WP_001280965.1|4178819_4179122_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	93.9	3.3e-42
WP_000763315.1|4179136_4179256_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	94.9	1.2e-14
WP_001282813.1|4179248_4182029_+|tail	phage tail tape measure protein	tail	A0A2H4JGB2	uncultured_Caudovirales_phage	41.1	3.5e-125
WP_000980405.1|4182028_4182514_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	93.2	9.4e-71
WP_001011750.1|4182510_4183611_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	92.1	7.9e-190
WP_001775272.1|4183678_4183897_+	positive regulator of late gene transcription	NA	E5G6Q4	Salmonella_phage	75.0	4.9e-27
WP_001039750.1|4183983_4184361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000457555.1|4184580_4185855_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	62.0	7.5e-152
WP_001222413.1|4185986_4186256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989298.1|4186355_4186715_-	DUF3085 domain-containing protein	NA	NA	NA	NA	NA
WP_000022216.1|4186756_4187656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000881183.1|4187729_4188638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097965.1|4188709_4190659_-	DUF1738 domain-containing protein	NA	A0A2K9V411	Faecalibacterium_phage	38.3	5.9e-31
>prophage 13
NZ_LT904893	Salmonella enterica subsp. enterica serovar Typhi strain 1016889 genome assembly, chromosome: 1	4807786	4454674	4565340	4807786	transposase,tail,integrase,capsid,terminase,lysis,head,plate,tRNA,portal	Salmonella_phage(55.56%)	108	4498313:4498329	4552358:4552374
WP_000935452.1|4454674_4455979_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001067855.1|4456025_4456730_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000240536.1|4457485_4458337_+	replication protein	NA	NA	NA	NA	NA
WP_001043265.1|4458644_4459460_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_024261901.1|4459520_4460324_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_000480968.1|4460323_4461160_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001067855.1|4461220_4461925_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001387387.1|4461971_4462373_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000027057.1|4462522_4463383_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001067855.1|4463882_4464587_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000259031.1|4464820_4465660_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|4465653_4466001_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000703418.1|4466230_4466704_-	trimethoprim-resistant dihydrofolate reductase DfrA7	NA	A0A1B2IBQ4	Erwinia_phage	32.0	8.4e-16
WP_000845048.1|4466861_4467875_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000454193.1|4468077_4468428_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000147567.1|4468553_4469114_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_001138064.1|4469116_4472083_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_000656305.1|4472149_4472527_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000412211.1|4472727_4473387_-	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_000752582.1|4474435_4474789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000281718.1|4474896_4477443_-	class I adenylate cyclase	NA	NA	NA	NA	NA
WP_001521319.1|4477819_4478761_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_000025500.1|4478757_4479498_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_000138976.1|4479519_4480689_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_000979266.1|4480688_4481888_+	protoheme IX biogenesis protein HemY	NA	NA	NA	NA	NA
WP_000818378.1|4483004_4484390_-	amino acid permease	NA	NA	NA	NA	NA
WP_000183613.1|4484596_4485337_-	lipopolysaccharide N-acetylmannosaminouronosyltransferase	NA	NA	NA	NA	NA
WP_000055604.1|4485333_4486692_-	O-antigen assembly polymerase	NA	NA	NA	NA	NA
WP_000217176.1|4486688_4487768_-	TDP-N-acetylfucosamine:lipid II N-acetylfucosaminyltransferase	NA	NA	NA	NA	NA
WP_000050302.1|4487764_4489015_-	lipid III flippase WzxE	NA	NA	NA	NA	NA
WP_000612080.1|4489016_4490147_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	40.9	3.3e-18
WP_077905078.1|4490151_4490856_-	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_000676077.1|4490806_4491688_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.0	1.3e-107
WP_000011236.1|4492777_4494040_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1H3J6	Paramecium_bursaria_Chlorella_virus	27.0	1.6e-24
WP_000866686.1|4494036_4495167_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	27.7	1.8e-27
WP_000193415.1|4495222_4496269_-	ECA polysaccharide chain length modulation protein	NA	NA	NA	NA	NA
WP_000771938.1|4496280_4497384_-	UDP-N-acetylglucosamine--undecaprenyl-phosphate N-acetylglucosaminephosphotransferase	NA	NA	NA	NA	NA
WP_001054532.1|4497613_4498873_-	transcription termination factor Rho	NA	NA	NA	NA	NA
4498313:4498329	attL	CAGCATGGTTTTACCCG	NA	NA	NA	NA
WP_099107992.1|4498960_4499095_-	rho operon leader peptide	NA	NA	NA	NA	NA
WP_001280776.1|4499291_4499621_-	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
WP_000047525.1|4499764_4501030_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.7	3.7e-42
WP_001089447.1|4501148_4502630_+	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001238841.1|4502669_4504694_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.2	2.1e-111
WP_001682173.1|4504793_4505522_-	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	30.7	1.3e-20
WP_001182428.1|4505521_4506265_-	nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_001096806.1|4507187_4507469_+	peptidylprolyl isomerase PpiC	NA	NA	NA	NA	NA
WP_000024943.1|4507560_4509036_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_000365798.1|4509200_4510088_+	HTH-type transcriptional activator IlvY	NA	NA	NA	NA	NA
WP_000560819.1|4510090_4510432_-	XRE family transcriptional regulator	NA	A0A2D1GR59	Pseudomonas_phage	38.5	1.7e-05
WP_001779357.1|4510428_4510791_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_010989250.1|4511026_4512571_-	threonine ammonia-lyase, biosynthetic	NA	NA	NA	NA	NA
WP_001127449.1|4512573_4514424_-	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_000208528.1|4514580_4515510_-	branched-chain-amino-acid transaminase	NA	NA	NA	NA	NA
WP_000983260.1|4515527_4515791_-	acetolactate synthase 2 small subunit	NA	NA	NA	NA	NA
WP_001012560.1|4515787_4517434_-	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.5	9.0e-65
WP_001311244.1|4517573_4517672_-	ilv operon leader peptide	NA	NA	NA	NA	NA
WP_000290950.1|4518297_4519350_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
WP_000900883.1|4519538_4519730_-	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	65.9	6.8e-09
WP_001047327.1|4519745_4520315_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	43.4	2.5e-38
WP_001247706.1|4520440_4520662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460893.1|4520694_4521204_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000956176.1|4521211_4521508_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	90.4	4.9e-22
WP_000996717.1|4521625_4521967_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
WP_001244218.1|4522034_4522268_+	DUF2732 domain-containing protein	NA	E5G6L6	Salmonella_phage	94.8	2.0e-31
WP_000752613.1|4522267_4522495_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_000104152.1|4522491_4523349_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.2	3.5e-161
WP_000017503.1|4523345_4525760_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
WP_001580533.1|4525913_4526102_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	95.2	7.9e-26
WP_000822803.1|4526169_4526469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001251692.1|4526577_4527456_-	hypothetical protein	NA	A0A2H4J8D6	uncultured_Caudovirales_phage	49.4	6.1e-52
WP_001146827.1|4528069_4528984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000185757.1|4528980_4529721_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_000518064.1|4529755_4530793_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	89.5	1.3e-173
WP_001098422.1|4530792_4532559_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
WP_000216244.1|4532701_4533535_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	1.5e-121
WP_000742518.1|4533551_4534610_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.4e-180
WP_000059191.1|4534613_4535264_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_000673504.1|4535359_4535824_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	1.4e-76
WP_000868175.1|4535823_4536027_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000171568.1|4536030_4536246_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_001341072.1|4536265_4536739_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
WP_000727853.1|4536740_4537118_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
WP_001080928.1|4537114_4537543_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	77.3	2.2e-47
WP_001039939.1|4537638_4538070_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	95.1	1.5e-72
WP_000829146.1|4538062_4538509_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
WP_000993754.1|4538577_4539156_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	86.5	5.5e-94
WP_000177595.1|4539152_4539512_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.9	6.1e-51
WP_000268271.1|4539498_4540407_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	89.7	1.3e-142
WP_001086816.1|4540399_4541005_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
WP_000104804.1|4541001_4542516_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	73.2	6.8e-200
WP_000805568.1|4542515_4543109_+|tail	tail assembly protein	tail	M1SV83	Escherichia_phage	64.3	9.2e-60
WP_001174915.1|4543080_4543521_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	68.0	3.1e-52
WP_072075000.1|4543523_4543922_-|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	37.5	1.3e-12
WP_000905046.1|4543949_4544516_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.3	1.1e-86
WP_000046142.1|4544658_4545831_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
WP_001207656.1|4545840_4546356_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
WP_001280897.1|4546410_4546713_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
WP_000763311.1|4546727_4546847_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001282793.1|4546839_4549917_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
WP_000980381.1|4549913_4550399_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
WP_001011760.1|4550395_4551496_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
WP_000972391.1|4551586_4551805_+	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_000502114.1|4553386_4553845_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
4552358:4552374	attR	CGGGTAAAACCATGCTG	NA	NA	NA	NA
WP_000840996.1|4553952_4554291_-	macrodomain Ori organization protein MaoP	NA	NA	NA	NA	NA
WP_001541181.1|4554397_4555246_+	HTH-type transcriptional regulator HdfR	NA	NA	NA	NA	NA
WP_000201804.1|4561225_4562077_-	glutamate racemase	NA	NA	NA	NA	NA
WP_000591414.1|4562021_4563866_-	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	30.0	2.2e-11
WP_000186987.1|4564239_4565340_+|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
