The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012801	Bacteroides cellulosilyticus strain WH2 chromosome, complete genome	7084828	5118	34139	7084828	terminase,head,integrase,capsid,portal,tail	environmental_Halophage(16.67%)	29	31116:31132	43368:43384
WP_029427996.1|5118_5502_+|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
WP_029427995.1|5498_7121_+|terminase	terminase large subunit	terminase	H9YSH1	environmental_Halophage	35.8	7.5e-96
WP_060550549.1|7169_8408_+|portal	phage portal protein	portal	A0A0U4IJ43	Pseudomonas_phage	34.5	3.4e-48
WP_029427991.1|9017_10262_+|capsid	phage major capsid protein	capsid	S0A3Y1	Cellulophaga_phage	26.4	2.8e-26
WP_029427990.1|10263_10575_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	31.8	9.8e-05
WP_029427988.1|10571_10886_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_029427987.1|10882_11320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029427986.1|11319_11694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029427985.1|11696_12173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081679844.1|12242_13043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060550550.1|13002_13569_+	GIY-YIG nuclease family protein	NA	I4DSI5	Enterococcus_phage	35.7	9.5e-06
WP_060550553.1|16059_17271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029427981.1|17347_19396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029427980.1|19395_21063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029427979.1|21059_22214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029427977.1|22227_22581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060550554.1|22573_23647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029427975.1|23612_24932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029427970.1|25067_25562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029427971.1|25578_26097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060550555.1|26209_26698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029427973.1|26814_27357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029427974.1|27420_27927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029427967.1|29269_29764_+	N-acetylmuramoyl-L-alanine amidase	NA	F6MIJ9	Haemophilus_phage	43.4	9.1e-29
WP_029427966.1|29760_30213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029427965.1|30733_30964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029427964.1|31060_31579_+	hypothetical protein	NA	NA	NA	NA	NA
31116:31132	attL	TCAATGAAATATCTATA	NA	NA	NA	NA
WP_029427962.1|31766_32660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029427961.1|32894_34139_-|integrase	phage integrase SAM-like domain-containing protein	integrase	NA	NA	NA	NA
43368:43384	attR	TATAGATATTTCATTGA	NA	NA	NA	NA
>prophage 2
NZ_CP012801	Bacteroides cellulosilyticus strain WH2 chromosome, complete genome	7084828	786898	794745	7084828		Bacteroides_phage(33.33%)	11	NA	NA
WP_029428975.1|786898_788149_+	Y-family DNA polymerase	NA	A0A1W6JNT0	Morganella_phage	43.8	1.3e-92
WP_029428976.1|788151_788850_+	SOS response-associated peptidase	NA	A0A1P8CX02	Bacillus_phage	41.3	3.1e-22
WP_029428977.1|788895_789414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029428978.1|789436_789667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144430722.1|789695_790208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029428980.1|790311_791031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029428981.1|791023_792499_-	AAA family ATPase	NA	C7BGE8	Burkholderia_phage	35.4	2.1e-12
WP_029428982.1|792523_792976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029427967.1|792972_793467_-	N-acetylmuramoyl-L-alanine amidase	NA	F6MIJ9	Haemophilus_phage	43.4	9.1e-29
WP_033160603.1|793463_793958_-	hypothetical protein	NA	H2A0C3	Bacteroides_phage	50.0	1.2e-36
WP_029427969.1|794124_794745_-	master DNA invertase Mpi family serine-type recombinase	NA	H2A0H0	Bacteroides_phage	52.8	1.1e-44
>prophage 3
NZ_CP012801	Bacteroides cellulosilyticus strain WH2 chromosome, complete genome	7084828	5084218	5139649	7084828	protease,integrase,tail	Ostreococcus_lucimarinus_virus(12.5%)	50	5138570:5138590	5139993:5140013
WP_007212353.1|5084218_5086315_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	M4QNJ1	Ostreococcus_lucimarinus_virus	46.8	7.4e-104
WP_007212354.1|5086323_5086683_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_033160507.1|5087043_5087676_+	murein L,D-transpeptidase catalytic domain family protein	NA	NA	NA	NA	NA
WP_029427237.1|5087732_5088911_+	phosphoribosylaminoimidazolecarboxamide formyltransferase	NA	S4VT61	Pandoravirus	24.9	1.5e-16
WP_007215140.1|5088982_5090839_-	DUF349 domain-containing protein	NA	NA	NA	NA	NA
WP_026367655.1|5090955_5092296_-	magnesium transporter	NA	NA	NA	NA	NA
WP_007212359.1|5092434_5093250_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_026367656.1|5093363_5094356_+	flippase-like domain-containing protein	NA	NA	NA	NA	NA
WP_026367657.1|5094453_5096022_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_029427236.1|5096157_5097009_-	DUF4373 domain-containing protein	NA	NA	NA	NA	NA
WP_007212364.1|5097055_5097403_-	DUF2693 domain-containing protein	NA	NA	NA	NA	NA
WP_007215144.1|5097590_5097821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029427235.1|5098525_5099059_+	UpxY family transcription antiterminator	NA	NA	NA	NA	NA
WP_029427234.1|5099075_5099558_+	UpxZ family transcription anti-terminator antagonist	NA	NA	NA	NA	NA
WP_007212368.1|5099576_5100212_+	sugar transferase	NA	NA	NA	NA	NA
WP_118451542.1|5100283_5100526_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_029427231.1|5100509_5102048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144430753.1|5102096_5103209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029427229.1|5103242_5104271_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_029427228.1|5104300_5105398_+	glycoside hydrolase family 99-like domain-containing protein	NA	NA	NA	NA	NA
WP_158508069.1|5105495_5106380_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_029427225.1|5106384_5107392_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	33.3	1.9e-09
WP_029427223.1|5107496_5108567_+	polysaccharide pyruvyl transferase family protein	NA	NA	NA	NA	NA
WP_029427222.1|5108582_5109398_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_029427221.1|5109490_5110072_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	51.1	6.9e-44
WP_029427219.1|5110124_5110343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029427217.1|5110607_5111675_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_029427216.1|5111671_5112319_+	DUF4276 family protein	NA	NA	NA	NA	NA
WP_029427215.1|5112481_5112985_+	HU family DNA-binding protein	NA	NA	NA	NA	NA
WP_149919918.1|5113046_5113145_+	smalltalk protein	NA	NA	NA	NA	NA
WP_029427212.1|5113807_5114344_+	DUF4255 domain-containing protein	NA	NA	NA	NA	NA
WP_029427211.1|5114360_5115239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029427210.1|5115263_5116901_+|tail	phage tail sheath family protein	tail	A0A142EZL9	Stenotrophomonas_phage	26.8	5.4e-09
WP_029427209.1|5116933_5118466_+|tail	phage tail sheath family protein	tail	A0A0F6WCG7	Sinorhizobium_phage	32.0	9.8e-13
WP_007212392.1|5118503_5118968_+|tail	phage tail protein	tail	J9PV93	Bacillus_phage	29.2	3.8e-13
WP_007212393.1|5118980_5119457_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_007212394.1|5119462_5119645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029427208.1|5119667_5120327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029427207.1|5120335_5122111_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_029427206.1|5122161_5122464_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_029427205.1|5122469_5122904_+	GPW/gp25 family protein	NA	NA	NA	NA	NA
WP_029427203.1|5122962_5124354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029427202.1|5124577_5127796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029427201.1|5127802_5128546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029427200.1|5128550_5130815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029427199.1|5130801_5135001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029427198.1|5135027_5135621_+	DUF4157 domain-containing protein	NA	NA	NA	NA	NA
WP_007215181.1|5135632_5136925_+	ATP-binding protein	NA	A0A1C9EGA6	Acidianus_two-tailed_virus	34.5	4.1e-12
WP_029427197.1|5137022_5138480_+	aminoacyl-histidine dipeptidase	NA	NA	NA	NA	NA
5138570:5138590	attL	CCGTTACTTTATAGGTAACGG	NA	NA	NA	NA
WP_033160505.1|5138701_5139649_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_033160505.1|5138701_5139649_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
5139993:5140013	attR	CCGTTACCTATAAAGTAACGG	NA	NA	NA	NA
